Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2007 Dec 1.
Published in final edited form as: Dev Biol. 2006 Sep 1;300(1):153–164. doi: 10.1016/j.ydbio.2006.08.064

Genomics and expression profiles of the Hedgehog and Notch signaling pathways in sea urchin development

Katherine D Walton 1,*, Jenifer C Croce 1, Thomas D Glenn 1, Shu-Yu Wu 1, David R McClay 1
PMCID: PMC1880897  NIHMSID: NIHMS14900  PMID: 17067570

Abstract

The Hedgehog (Hh) and Notch signal transduction pathways control a variety of developmental processes including cell fate choice, differentiation, proliferation, patterning and boundary formation. Because many components of these pathways are conserved, it was predicted and confirmed that pathway components are largely intact in the sea urchin genome. Spatial and temporal location of these pathways in the embryo, and their function in development offer added insight into their mechanistic contributions. Accordingly, all major components of both pathways were identified and annotated in the sea urchin Strongylocentrotus purpuratus genome and the embryonic expression of key components was explored. Relationships of the pathway components, and modifiers predicted from the annotation of Strongylocentrotus purpuratus, were compared against cnidarians, arthropods, urochordates, and vertebrates. These analyses support the prediction that the pathways are highly conserved through metazoan evolution. Further, the location of these two pathways appears to be conserved among deuterostomes, and in the case of Notch at least, display similar capacities in endomesoderm gene regulatory networks. RNA expression profiles by quantitative PCR and RNA in situ hybridization reveal that Hedgehog is produced by the archenteron beginning just prior to invagination, and signals to the secondary mesenchyme-derived tissues at least until the pluteus larva stage. RNA in situ hybridization of Notch pathway members confirms that Notch functions sequentially in the vegetal-most secondary mesenchyme cells and later in the endoderm. Functional analyses in future studies will embed these pathways into the growing knowledge of gene regulatory networks that govern early specification and morphogenesis.

Keywords: Hedgehog, Notch, Endoderm, Mesoderm, sea urchin

Introduction

The transducing machinery in both the Notch and the Hh signaling systems is relatively simple compared to the number of modifying components in other signal transduction pathways. Nevertheless the pathways are tightly controlled and modifiers play a clear role as reported in many animal systems. Based on published data, numerous duplications occur in vertebrates, and other duplications or losses are reported in various organisms. All of these changes tend to obscure ancestral function in development. Using a comparative approach animals such as the sea urchin, that occupy a basal position in the deuterostome clade, provide a means of gaining perspective on how these pathways operate in development. The sequencing of the sea urchin genome gives an opportunity to explore these signal transduction pathways in detail. The goal of this project, therefore, was to annotate all members of both signal transduction pathways and then to begin to explore where and how some of the main components of these pathways operate in the sea urchin embryo.

Figure 1 depicts the main components of both the Hh and the Notch signaling pathways as a combination of molecules known from studies largely in Drosophila and vertebrates. Although differences exist between vertebrates and Drosophila (reviewed in (Huangfu and Anderson, 2006), a generalized Hh pathway can be described as follows. Hh is a secreted protein that is enzymatically modified to make it active (Bumcrot et al., 1995; Chamoun et al., 2001; Lee et al., 1994; Pepinsky et al., 1998; Porter et al., 1995; Porter et al., 1996) and it binds to its cognate receptor Ptc (Chen and Struhl, 1996; Marigo et al., 1996; Stone et al., 1996). In the absence of Hh, the receptor Patched (Ptc) operates as an inhibitor by blocking the ability of Smoothened (Smo) to activate the pathway. In this case the downstream transcription factor Cubitus interruptus (Ci, or Gli in vertebrates, note that there are 3 forms of Gli in vertebrates: Gli1, Gli2, and Gli3) becomes phosphorylated by PKA, GSK3β and CK1, and is subsequently targeted for processing by the protease, Slimb (Chen et al., 1998; Jia et al., 2002; Jiang and Struhl, 1998; Price and Kalderon, 2002; Theodosiou et al., 1998). Slimb cleaves the full-length 155 kDa Ci to a shortened 75 kDa form and this shortened form translocates to the nucleus where it acts as a repressor (Akimaru et al., 1997; Aza-Blanc et al., 1997; Chen et al., 1999). Gli3 (and Gli2 in some contexts) is also similarly cleaved in vertebrates and it is thought that the ratio of full-length activator forms to shortened repressor forms determines the transcriptional regulatory action (von Mering and Basler, 1999). Costal-2 (Cos2) is a kinesin-like protein which is part of a complex of proteins that act to sequester Ci/Gli in the cytoplasm and promote the cleavage of the full-length Ci in Drosophila, however the currently identified vertebrate orthologs of Cos2 appears unable to affect subcellular localization of Glis or promote their cleavage (Chen et al., 1999; Lefers et al., 2001; Methot and Basler, 1999; Methot and Basler, 2000; Varjosalo et al., 2006; Wang et al., 2000). Suppressor of Fused (Su(Fu)) and Fused are also part of this protein complex (Preat, 1992). Su(Fu) is a weak antagonist of Hh signaling in Drosophila, but can act as a potent inhibitor of Hh signaling in vertebrate cells (Varjosalo et al., 2006) while Fused is a kinase thought to inactivate Su(Fu) possibly by direct phosphorylation (Lum et al., 2003; Methot and Basler, 2000).

Figure 1.

Figure 1

Open in a new tab

Diagram of the major components and modifiers of the Hh and Notch signaling pathways that were identified in the annotation of the S.purpuratus genome. These components and modifiers are also listed in Supplemental Table 1 along with their other names, Glean3 model/SPU_ numbers, best human genome blast hit and relative level of embryonic expression detected by the tiling array experiment. See the text for a brief functional description of these pathways

When Hh is present, it binds to Ptc, alleviating the inhibition of Smo. Smo is then able to antagonize Cos2 activity and Slimb protease activity is prevented. As a result the full-length form of Ci is retained and this molecule proceeds to the nucleus where it activates transcription, often of the same genes that previously were repressed by the smaller Ci protein (Methot and Basler, 2000).

In addition to the major components described above, other modifiers affect the Hh pathway including Dispatched (Disp), Exostosins (Exts), Rab23, Hedgehog-interacting protein (Hip), Intraflagellar transport proteins (IFTs), Tectonic (Tect), SIL, Talpid3 and FKBP8. Disp is required for Hh secretion from Hh releasing cells (Burke et al., 1999). The Drosophila tout-velu (ttv) genes, which are homologs of the vertebrate ext genes, are critical to the movement of the Hh signal between cells, and are required in the receiving cells (Bellaiche et al., 1998; The et al., 1999). Rab23 is a negative regulator of vertebrate Hh signaling and is a member of the small GTP-activated proteins, which are associated with membrane trafficking (Eggenschwiler et al., 2001). Its function appears to be in localizing some factor in Hh signaling that acts between Ptc and Smo and the downstream transcription factor, Gli (Eggenschwiler et al., 2006). Hip, a Hh binding protein previously thought to be vertebrate specific, is upregulated by Hh signaling and has a negative effect on that signal, thereby providing a feedback mechanism (Chuang and McMahon, 1999). IFTs are required for assembling cilia and flagella (Rosenbaum and Witman, 2002) and are necessary for Gli activity in response to Hh signaling in vertebrates at a step between Smo and Gli (Huangfu and Anderson, 2005; Huangfu et al., 2003; Liu et al., 2005). This requirement for IFTs in Hh signaling appears not to be conserved in Drosophila since IFT knock out flies do not have the phenotypic patterning defects of Hh pathway mutations (Avidor-Reiss et al., 2004; Han et al., 2003; Ray et al., 1999). Tect, SIL, Talpid3, and FKBP8 are some relatively new additions to the vertebrate pathway. Tect appears to function in the Hh pathway somewhere downstream of Smo and Rab23. (Reiter and Skarnes, 2006). It is a transmembrane protein and is required for full activation of Hh signaling and specification of the ventral most cell types in the neural tube and may also play a separate role in repressing Hh activity. SIL is a cytosolic protein required in mouse for left-right axis development and Shh signaling (Izraeli et al., 2001; Izraeli et al., 1999). Talpid3 is another cytoplasmic protein required for the function of Gli repressor and Gli activator in chickens (Davey et al., 2006). Finally, FKBP8 is a member of the FK506-binding protein family and is an antagonist of Shh signaling in the development of the central nervous system (Bulgakov et al., 2004).

In contrast to the Hh pathway, activation of The Notch pathway (Figure 1) involves direct cell contact. Ligands of the Notch pathway are transmembrane proteins of the DSL family known as Delta and Serrate (Fehon et al., 1990; Rebay et al., 1991) while the receptor Notch is also a transmembrane protein. Prior to contact between the ligand and receptor, several modifiers are involved. In the cells displaying Delta or Serrate, the neuralized and the mind bomb genes encode ubiquitin-3 ligases that are thought to interact with the ligands and stimulate their endocytosis and signaling activity (Deblandre et al., 2001; Fleming et al., 1997; Lai et al., 2001; Panin et al., 1997; Pavlopoulos et al., 2001; Pitsouli and Delidakis, 2005). On the other hand in the cells expressing Notch, the Notch receptor has to be processed before its arrival at the membrane. The Notch protein is made as a long precursor molecule with 36 EGF repeats on the external chain (35 in the sea urchin (Sherwood and McClay, 1997), a single pass transmembrane region and a long cytoplasmic domain containing ankyrin repeats, (Artavanis-Tsakonas et al., 1999). Prior to its arrival at the cell surface Notch is cleaved on the future extracellular surface by the furin protease and the two fragments are linked by disulfide bonds (Logeat et al., 1998). Some Notch-bearing cells express a Fringe protein ( Fleming, et. al., 1997; Peterson and McClay, 2005), a glycosyl transferase, that modifies the Notch receptors making them receptive to the Delta signal. Absence of Fringe-catalyzed glycosylation makes the Notch-bearing cell selectively receptive to the Serrate signal (Fleming, et. al., 1997). After the binding of either Delta or Serrate, Notch receptors undergo two further specific cleavages required for the activation and transduction of the signal. The second cleavage (after the first furin-dependent cleavage) follows ligand binding and is mediated by an ADAM metalloprotease while the third is based on γ-secretase activity and releases the Notch Intracellular Domain (NICD) (Annaert and De Strooper, 1999; Brou et al., 2000; Lieber et al., 2002; Mumm et al., 2000; Sotillos et al., 1997; Weinmaster, 2000). When the NICD goes to the nucleus it binds to a transcription factor of the CSL family, such as Suppressor of Hairless (Su(H)), where it converts the CSL factor’s regulation from repression to activation (Kopan, 2002). Targets of Notch signaling are quite varied throughout the animal kingdom, but a common target is hairy (Davidson, et al., 2002; Ransick, 2006).

Additional modifiers of Notch pathway are found in the Notch-bearing cell as shown in Figure 1. Nicastrin is a membrane protein that is part of the Presenilin complex in vertebrates. Functionally, it enables the γ-secretase cut of Notch and therefore enables activation of the transcription of Notch target genes. Numb is a cytosolic protein that is localized close to the membrane of the Notch containing cell and that acts in many animal systems as an antagonizer of Notch signaling possibly through a role in the endocytosis of a positive modifier of the signaling pathway (Cayouette and Raff, 2002). Deltex is another cytosolic protein that regulates Notch signaling in some contexts. It is an E3 ubiquitin ligase that binds to the ankyrin repeats of Notch and promotes Notch endocytic trafficking to the late endosome and possibly activates Su(H), although it appears not to be essential during development in Drosophila (Diederich et al., 1994; Fuwa et al., 2006; Matsuno et al., 1995).

Homologs for all of the genes in the Hh and Notch signaling pathways listed in Supplemental Tables 1 and 2 have been identified within the sea urchin genome. Functional roles for all of the Hh pathway components as well as for many of the Notch pathway components have not yet been determined in detail in the sea urchin embryo but an early picture has emerged. Oligonucleotide tiling microarrays covering the genome were explored in silico and temporal and spatial patterns of expression for some of the main components of these pathways were examined to determine when and where the pathways operate. Here, we begin to address Hh signaling function and add to a growing knowledge about Notch signaling function in the sea urchin during development.

Materials and Methods

Identification and naming of Sea urchin homologs

S. purpuratus homologs were identified by blasting (tblastn)(Altschul, 1997) protein sequences from other species against the S.purpuratus Glean3 predicted model database released July 18, 2005 (http://www.hgsc.bcm.tmc.edu/blast/blast.cgi?organism=Spurpuratus). Matches were confirmed by blasting (blastp) the predicted protein sequence of the Glean3 model against the National Center for Biotechnology Information (NCBI) GenBank protein database. Glean3 models were named according to the best blast matches identified from GenBank and confirmed by bootstrap and neighbor-joining phylogenetic tree analysis against human, Ciona intestinalis, Drosophila melanogaster, and Nematostella vectensis. Sequences for human and Drosophila were obtained from GenBank and Ensembl. Ciona sequences were obtained from GenBank and the Ciona database ANISEED or Ascidian Network for In Situ Expression and Embryological Data (http://crfb.univ-mrs.fr/aniseed/index.php). Nematostella sequences were identified by domain searches and blast searches in the Nematostella vectensis genomics database StellaBase (http://www.stellabase.org/). Neighbor-joining and bootstrap phylogenetic tree analyses were performed in PAUP from nexus files prepared with Clustal-X. 1000 repetitions were used for the bootstrap analyses.

High-density Oligonucleotide Tiling Microarrays

High-density oligonucleotide tiling microarrays were performed as described in Samanta et al., 2006. Briefly, 50 oligonucleotide lengths at a time were arrayed on glass slides and hybridized with labeled RNA pooled from equal quantities of egg, early blastula, gastrula and prism RNA. Where labeled RNA hybridized with the arrayed oligonucleotides, levels of hybridization were optically detected. Hybridization levels for each of the oligonucleotides were then coordinately matched with their corresponding location on the genomic scaffolds of sequence so that the levels of hybridization could be viewed as they appear along the sequence scaffold. This information is available for review using Genboree (http://www.genboree.org/java-bin/login.jsp). Each Glean model listed in the Supplementary tables was examined in Genboree. The resulting transcript levels for each area were considered against the exon predictions for each Glean model and relative levels of transcript were assigned as described in the figure legends.

Cloning of sea urchin genes

Primers were designed within highly conserved regions of the predicted S.purpuratus Glean3 models to amplify partial sequences of those genes by PCR. Primers were also used in some cases with L. variegatus cDNA at lower annealing temperatures. PCR products were ligated into pGEMT Easy vector and electroporated into XL-1 blue competent cells. Plasmids were extracted using Qiagen miniprep and maxiprep kits. Clones were sequenced to confirm their identity and orientation within the vector.

Quantitative PCR

RNA was extracted from embryos at various stages of development using Trizol reagent followed by ethanol washes and resuspension in nuclease free water. 2 μg of total RNA were treated with DNaseI and used as a template for reverse transcription with the TaqMan cDNA synthesis kit (Roche Cat #N808-0234). 0.5 μl of cDNA was then used in a quantitative PCR reaction using the Roche LightCycler Fast Start DNA Master SYBR Green I kit (Roche Cat#12 239 264 001). Primers were designed using the Probe Design program for the Roche Light Cycler. Primer sets were as follows: Sp/Lvhh, F: GACACATTTGGTGCCAGTGG, R: GTCTTTGCATCGCTGTGTC; LvPtc, F: GATCCTTCAGACCGGC, R: TGACTTACTTGTGACATCG; LvSmo, F: GCTCAGTGGGAGAAGG, R: TCCGCTTCCATATAGCC; LvGli, F: TCTGTCGATGGCGTGA, R: GGTACATCCGGCGTGA; LvNotch, F: TCCCGGCTTAGTCCCGT, R: AGGTTGTACCGCGCTG; LvDelta, F: TTCGGCGGACCCAACTG, R: CCCGGATGTTAGGCCGT Primer sets were validated using plasmid-cloned templates for each gene for a positive control or water as a negative control. Threshold crossing cycle determined by the Light Cycler program was averaged for at least two runs per set of developmentally staged cDNAs. Within each data set, the threshold crossing cycle was also determined for ubiquitin. The number of transcripts per embryo was calculated assuming 87,000 transcripts for ubiquitin per embryo at each stage of development and a QPCR amplification rate of 1.9-fold per cycle (Nemer et al., 1991; Ransick et al., 2002). Transcripts per embryo at each stage of development were plotted using a logarithmic scale to allow the timecourses to be evaluated on the same scale. Dashed lines at 150 and 350 transcripts were included to indicate the minimum and maximum range of significance for biological activity of a gene transcript.

RNA in situ hybridization

Embryos were fixed in 4% PFA/ASW with 10 mM EPPS for 1 hour at room temperature. Then they were washed with ASW and stored in methanol at −20°C. Stored embryos were rehydrated and prehybridized with 50% formamide, 25% 20X SSC pH 5.0, 0.001% of 50 mg/ml of heparin, 0.001% of 50 mg/ml of yeast tRNA, and 0.002% of 50% tween 20. Digoxigenin labeled probes were hybridized overnight at 65°C at 1 ng/ml and washed through a series of hybridization solution, and SSCT from 2X to 0.1X at 65°C. Embryos were then blocked in 0.5% BSA and 2% heat-inactivated goat serum in 1XTBST for 1 hour and then incubated in anti-digoxigenin antibody at 1:2000 in blocking solution for 2 hours. Embryos were then washed several times in 1X TBST. Color reactions were performed with NBT/BCIP for 2 hours at room temperature or overnight at 4°C. Images were taken at 200X magnification using a Zeiss Axioplan2 microscope with a Zeiss AxioCam HRc camera and AxioVision Rel.4.4 software. Processing of the images was performed in Adobe Photoshop to orient and crop the images.

Results & Discussion

The sea urchin Hh pathway

To date the composition of the Hh pathway has mainly been studied in two evolutionary groups, vertebrates representing deuterostome lineages and arthropods for the protostome lineages. The evolutionary position of the sea urchin as a basal deuterostome provides an opportunity to examine basal deuterostome components, thus is an organism that could answer some questions about the evolution of this pathway. The vertebrate and Drosophila Hh pathways contain 30 and 18 genes repectively (excluding newly identified modifiers of the pathway). The sea urchin genome was examined to find orthologs for each pathway component and to augment the study we also included in our survey Hh pathway orthologs in the urochordate genome of Ciona intestinalis and Nematostella, a Cnidarian, to include an animal basal to bilaterians. We identified 25 genes (30 including the newly identified modifiers of the pathway) belonging to the Hh pathway in the sea urchin genome (Supplemental Table 1). All of the Hh pathway genes in Drosophila and most of the vertebrate genes are present in S. purpuratus, although in some cases fewer paralogs of the genes were found, probably due to the later genome duplication in the vertebrate line. Below we describe some of the more intriguing results from the annotation as well as the expression patterns of some of the main components in the Hh pathway.

In vertebrates three distinct Hh ligands are present, Ciona has two, and Drosophila and sea urchins each have only one. Despite the numbers of paralogs, S. purpuratus Hh, Nematostella Hh and Drosophila Hh were equally similar to the human Hhs. Surprisingly, all were more similar to the human Hhs than Ciona Hhs (Supplemental Figure 1A) suggesting that the Ciona hh gene diverged from the ancestral, and more conserved gene.

Vertebrates also have more ptc paralogs (two ptc genes) than Ciona, Drosophila, or S. purpuratus, each of which have only one ptc gene. S. purpuratus Ptc is similar to other deuterostome Ptc proteins as its predicted protein clades with bootstrap values of 92 to Ciona Ptc and to human Ptc 1 and Ptc 2. Drosophila Ptc demonstrates an earlier divergence (Supplemental Figure 1B). One disp and two dispatched-like genes were also identified as homologs to human and Ciona disp along with two Nematostella predicted proteins.

A single smo gene was found in the S. purpuratus genome which agrees with the number found in all other organisms sequenced to date. The sea urchin Smo protein is most similar to human Smo and the most different from a predicted Nematostella protein and the Drosophila Smo (Supplemental Figure 1C). This correlates with an apparent divergence of the cytoplasmic domain in Drosophila relative to deuterostome Smos. The cytoplasmic portion of the Smo protein was shown to convey the Hh signal (Hooper, 2003; Jia et al., 2003; Nakano et al., 2004), yet there is a great difference in the length of these tails between Drosophila and vertebrates and differences in the role that phosphorylation of this domain may play in Hh signaling as well differences in its interaction with Cos2 (Huangfu and Anderson, 2006; Jia et al., 2003; Varjosalo et al., 2006). Protein alignment of human, Drosophila and Sp Smo reveal that S. purpuratus Smo is 43% similar to human Smo and 30% similar to Drosophila Smo while an alignment of the C-terminal portions (CTD) of these Smo proteins shows that this portion of S. purpuratus Smo is similar in length to the vertebrate CTD and is 31% similar to human and only 18% similar to Drosophila Smo. The similarity of the sea urchin Smo in CTD length to vertebrates may suggest that the cytoplasmic function of Smo may be more similar to that of vertebrates than Drosophila.

Sea urchin and Ciona each have a single ortholog of gli that is related to the three vertebrate gli transcription factors. Sea urchin GliA is most similar to the Nematostella Gli and is more similar to human Gli2 and Gli3 than it is to human Gli1 by neighbor- joining phylogenetic analysis (Supplemental Figure 1D). Drosophila Ci and vertebrate Gli2 and Gli3 are cleaved to produce a shortened repressor form while Gli1 is not cleaved. Phosphorylation of Ci/Gli by PKA, CKI and GSK3-β is required for proteolysis to the shortened form. There are 3 PKA, 3 CKI, and 2 GSK3-β sites occurring in 3 clusters that are conserved between Ci and the Gli proteins (Lefers and Holmgren, 2002). Alignment of S. purpuratus GliA with human and mouse Gli1, 2 and 3 and Drosophila Ci revealed conservation of these sites (Figure 5), indicating the likelihood that S. purpuratus GliA is cleaved similarly to a shortened form. Additionally, there are two sea urchin gli-similar genes (glisB and glisC) that were predicted as compared to the three in vertebrates. S. purpuratus GlisC is most similar to human Glis2 and S. purpuratus GlisB is more similar to human Glis3 and Glis1. The S. purpuratus Glis appear similar in length to the shortened form of Ci when aligned with Ci and the Gli proteins, suggesting that these genes may represent repressor forms of Gli-similar proteins in the sea urchin.

Figure 5.

Figure 5

Open in a new tab

Protein alignment of Drosophila Ci, Human Gli1, 2 and 3 and S. purpuratus GliA showing conservation of PKA, CKI, and GSK3β phosphorylation sites thought to be important in Slimb cleavage of these proteins (modified from (Lefers and Holmgren, 2002).

Hedgehog-interacting protein (hip), previously thought to be vertebrate specific, was also identified in the sea urchin extending its history to all deuterostomes. Phylogenetic analysis revealed that sea urchin Hip is an ortholog of a Ciona Hip with a bootstrap value of 100. Sea urchin and Ciona Hip have a weaker but significant similarity to the human protein (Supplemental Figure 1E).

Several other components of the Hh signaling pathway were also annotated and are represented in the schematic of the signaling pathway in Figure 1. In summary, the main Hh pathway components are all present in the sea urchin genome. The function of some of the vertebrate-specific components of the pathway (Hip, IFTs, SIL, Rab23, FKBP8, Tect, and Talpid3), remain to be investigated in detail. In examining the 30 genes in the Hh pathway family it is clear that a number of patterns of evolutionary dispersion are found indicating that the pathway was not treated as a unit by evolutionary selection.

Embryonic expression of Hh genes in sea urchin

To assess when and where genes present in the Hh pathway function in the developing embryo, we first surveyed the high-density oligonucleotide tiling microarray hybridizations performed by Samanta et al. for embryonic expression of the genes (Samanta et al., 2006; accessed through Genboree at http://www.genboree.org/java-bin/login.jsp). These data reveal that all genes in the Hh pathway are expressed embryonically (Supplemental Table 1) with the exception of su(fu), disp, tect and hip. For those genes not showing embryonic expression on the high-density oligonucleotide tiling microarray hybridizations, we searched in silico for transcripts of these genes by Blast searching of an embryonic EST database (accessed at http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi?taxid=7668). These searches revealed ESTs for su(fu) and disp. These were respectively: CD306952.1 and CD291291.1. EST CD306952.1 is from a 2–3 week larva stage library. Using the sequence of EST CD291291.1 in a tblastn comparison against the GenBank protein database reveals that this EST is most similar to su(fu). EST CD291291.1 is from a primary mesenchyme cell library. When the sequence of EST CD306952.1 is compared to the GenBank protein database by tblastn, it is most similar to ptc. No ESTs were discovered by blast comparison of the predicted proteins for the annotated tect and hip genes. EST data was not available for many of these genes since most of the Hh signaling pathway components seem to be expressed at low levels at the early stages of development when most of the EST libraries are currently available.

Temporal expression patterns of key Hh pathway components

Since most pathway components are present in the embryo, we next cloned several Hh pathway components in L. variegatus and S. purpuratus to confirm annotation predictions and analyze in situ patterns for pathway localization. The predicted Hh sequence matched well with the GenBank database sequences for S. purpuratus, L. variegatus, and H. pulcherrimus (gi60593030, gi3089555, gi60677667). The timing of expression of several of the key components of the pathway was examined by Quantitative PCR. Lytechinus variegatus (Lv) hh mRNA begins to accumulate during the late blastula to mesenchyme blastula stages and accumulates throughout gastrulation and into the prism and pluteus stages (Figure 2A). L. variegatus ptc mRNA is expressed in a highly varying pattern with an overall increase in expression from the blastula stages through gastrulation (Figure 2B). L. variegatus smo mRNA is expressed in a pattern similar to that of L. variegatus hh. There is a small peak at 16-cell stage with an overall increasing trend from the hatched blastula stage through the gastrula stages and a large increase at the late pluteus stage (Figure 2C). L. variegatus gliA appears to have maternal transcripts with zygotic mRNA beginning to be expressed during the hatched blastula stage and increases throughout the later blastula stages and gastrulation (Figure 2D). Much of the specification for endoderm and mesoderm occurs prior to the gastrula stage of development, and this is followed by a later refinement of specification and patterning of these tissues in the gastrula stage. The pattern of accumulation of hh pathway members during gastrulation and into the pluteus stage suggests that Hh signaling is a relatively late event during the development of the endoderm and mesoderm of the sea urchin. Specification of SMC cell types appears to occur in 3 phases during the separation of the endomesodermal compartment (A. Ransick personal communication). During phase 1 and 2 initial specification of endoderm and mesoderm occurs and specification of the pigment and blastocoelar cell SMC subtypes takes place. Little is known about the signals involved in the third phase when the late specification of muscle and coelomic pouch SMC cell types occurs, except that more endomesoderm is committed toward these late SMC subtypes.

Figure 2.

Figure 2

Open in a new tab

Quantitative PCR for major components of the Hh and Notch signaling pathways. A, hh mRNA; B, ptc mRNA; C, smo mRNA; D, GliA mRNA; E, Notch mRNA; F, Delta mRNA begins to accumulate during the blastula and gastrula stages. Stages are: egg, 16 cell, 60 cell, hatched blastula, early mesenchyme blastula, mesenchyme blastula, early gastrula, mid-gastrula, late gastrula, prism, pluteus, and late pluteus. Data are shown on logarithmic scales as the number of transcripts per embryo at a given stage of development. Dashed lines at 150 and 350 transcripts were included to indicate the minimum and maximum range of significance for biological activity of a gene transcript.

RNA localization patterns of key Hh pathway components

RNA in situ hybridization shows a localization pattern for L. variegatus hh in the endoderm of the embryo during the gastrula stages, which continues through the prism and early pluteus stages (Figure 3A–D). At a later stage of pluteus larva, L. variegatus hh expression is confined to the esophagus with higher expression at the sphincters than elsewhere along the archenteron (Figure 3E). Our in situ analysis was unable to repeat previously published patterns of Hh expression in Strongylocentrotus purpuratus and Hemicentrotus pulcherrimus (Hp) (Egana and Ernst, 2004; Hara and Katow, 2005). Egana and Ernst (2004) used what were purported to be cross-reactive antibodies to localize S. purpuratus Hh in the secondary mesenchyme cells, however the in situ pattern of expression occurs in the endoderm. The RNA localization of Hemicentrotus pulcherrimus hh to the small micromeres by Hara and Katow (2005) also was not repeated and that pattern fails to correlate either with the expression pattern for S. purpuratus hh RNA published in Egana and Ernst, 2004, nor with the QPCR pattern for L. variegatus hh RNA shown here in Figure 2A. The localization of hh to the endoderm in L. variegatus, shown here (Figure 3A–E) is in agreement with the QPCR data in terms of timing and is by a strong RNA in situ hybridization signal that is highly repeatable. Further, one might predict that the hh expression profile is adjacent to the tissue expressing ptc and smo, and the data on expression of these genes support that prediction, reported here for the first time in the sea urchin. Further, expression of the Hh pathway in the sea urchin matches a well-described comparative function of endoderm signaling to mesoderm in both Drosophila and vertebrates (see below, RNA in situ analysis shows that L. variegatus ptc is expressed in the secondary mesenchyme cells throughout gastrulation and continues to be expressed in SMC-derived tissues in the 2 day old pluteus (Figure 3F–J). RNA in situ analysis shows that L. variegatus smo is expressed in the same pattern as L. variegatus ptc with localization in the secondary mesenchyme cells throughout gastrulation with continued expression in SMC-derived tissues (Figure 3K–O).

Figure 3.

Figure 3

Open in a new tab

RNA in situ localization pattern for main components of the Hh signaling pathway. A–E, hh; F–J, ptc; K–O, smo. Stages are: EG, early gastrula; MG, mid-gastrula; LG, late gastrula; PR, prism; EPl, early pluteus; PL, 2 day pluteus. All views are lateral.

These data on all Hh pathway members suggests that the pathway functions most strongly during late embryonic development. A functional role for Hh signaling has not yet been described in the sea urchin, however the patterns seen here by RNA in situ hybridization for L. variegatus hh, L. variegatus ptc, and L. variegatus smo suggest that the Hedgehog signal is produced by the endodermal tissues of the archenteron and function in formation of the mesodermal tissues.

Role of Hh in germ layer specification across the animal kingdom

Hh signaling is used in a wide variety of contexts during embryonic development in other model systems. One such role for Hh signaling is in the development of the gut where pathway components are expressed in a variety of animals during development including: chicken (Sukegawa et al., 2000), leech (Kang et al., 2003), amphioxus (Shimeld, 1999), mouse (Bitgood and McMahon, 1995; Echelard et al., 1993), Drosophila (Mohler and Vani, 1992), zebrafish (Strahle et al., 1996), and xenopus (Ekker et al., 1995). Hh signaling is essential for patterning the gut in these animals since mutations or interference with other components of the Hh signaling pathway result in a variety of gut malformations (reviewed in (Lees et al., 2005). Communication between endoderm and the overlying mesoderm are essential to specification and patterning of the gut. Sonic hedgehog is one molecule that is essential to this communication since it has been shown to be expressed in the epithelium and signals to Ptc and Gli that are expressed in the neighboring mesenchyme cells (Ramalho-Santos et al., 2000). Based on expression patterns of hh and ptc plus smo, a similar function in sea urchins may occur as the embryonic coelomic pouches are specified in preparation for metamorphosis. Functional studies based on the molecules described herein will further our understanding of how these two pathways are involved first in specification of germ layers, and later in modification of those germ layers to generate functional larval structures.

2a. An overview of the Notch signaling pathway The Notch pathway in sea urchins

The Notch pathway in vertebrates, arthropods, and nematodes is well studied, with much less information available about the Notch pathway from other phyla. Analysis of the Notch signaling system in the sea urchin (as a basal deuterostome) provides important information about the evolution and comparative function of this pathway. Similar to the Hh signaling pathway, the Notch pathway in the sea urchin has an intermediate global number of genes as compared to Drosophila and vertebrates (23 sea urchin genes compared to 36 in humans and 20 in Drosophila, excluding Notch-ligands besides Delta and Serrate/Jagged). Orthologs for all major components of the Notch pathway were identified with thirty-one members of the identified in the S. purpuratus genome (including Notch-like ligands). A complete list of genes that were examined is in Supplemental Table 2. Several other main components were also identified and are represented in the schematic of the signaling pathway in Figure 1. Below we describe the most informative of our results from the annotation as well as the expression patterns of notch and delta in the sea urchin.

2.b. Notch Pathway components present in the sea urchin genome

Relative to vertebrates, the sea urchin genome contains fewer paralogs in some gene families. For example humans have 4 notch genes while Drosophila has one notch gene and sea urchins have one notch gene plus two notch-like genes. In humans there are seven hairy gene homologs (hairy and enhancer of split) while sea urchin appears to have two and Drosophila just one. Most other genes had equal numbers in all three genome groups examined with the exception of fringe, su(h) and deltex, each of which were expanded, presumably by duplications, in vertebrates.

The notch receptor, as well as its ligands delta and serrate/jagged, were identified and subjected to phylogenetic analysis for comparison. The computationally predicted gene sequences for notch, delta and serrate matched strongly to previously published sequences in L. variegatus and S. purpuratus (GenBank gi2570351, gi18535661, gi18535657). Neighbor-joining phylogenetic tree analysis shows that sea urchin Notch is most closely related to D. melanogaster Notch with a bootstrap confidence level of 68 (Supplemental Figure 2A). Drosophila and sea urchin form a clade with human and Ciona Notch with a bootstrap value of 99. L. variegatus delta was cloned and previously described (Sweet et al., 2002). Phylogenetic analysis showed that sea urchin Deltas (H. pulcherrimus, S. purpuratus and L. variegatus) join in a clade with Delta from other species and are most closely related to Ciona Delta with a bootstrap value of 70 (Supplemental Figure 7). Finally, S. purpuratus Nicastrin was analyzed and is most similar to human Nicastrin (bootstrap value of 96) suggesting that the nicastrin gene is conserved in deuterostomes. Taken together, these data suggest that the Notch pathway did not evolve as a unit, but rather each component changed subject to independent evolutionary selection.

Much more is known about the function of the Notch pathway in the sea urchin as compared to the Hh pathway. Notch is known to play a key role in the segregation of mesoderm from endoderm, the specification of the SMC derived pigment and blastocoelar cells, and in setting the boundary between endoderm and ectoderm (Sherwood and McClay, 1997; Sherwood and McClay, 1999; Sherwood and McClay, 2001). Complementary to the Notch experiments, Delta expressed in the micromeres is the ligand that activates the Notch receptor triggering pigment and blastocoelar cell specification, while Delta expressed by veg2 progeny signals to specify blastocoelar cells, coelomic pouches and muscle cells (Sweet et al., 2002). Gcm is a target of Notch signaling in the sea urchin and is essential for pigment cell specification (Ransick, 2006). Fringe modification of Notch is also required for Notch signaling in the sea urchin to specify SMCs and some endodermal genes (Peterson and McClay, 2005).

Expression of Notch genes in the sea urchin embryo

Data from the high-density oligonucleotide tiling microarray performed by Samanta et al. was examined for Notch pathway components (Samanta, 2006). These data reveal that all pathway genes are expressed embryonically with the exception of serrate (Supplemental Table 2). We were unable to amplify serrate from embryonic cDNA. An in silico search for sea urchin serrate transcripts by Blast comparison of the Glean3 predicted sea urchin Serrate protein against the sea urchin EST database did identify several possible serrate ESTs (http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi?taxid=7668). However, these same ESTs matched with higher identity to delta than to serrate. Additionally, blast comparison of the ESTs against the GenBank protein database matched the delta sequence of other species. Several other Notch-ligands were also identified as possible DSL family members since they have EGF repeats and a DSL domain, however they did not form a clade with Delta or Serrate/Jagged in the phylogenetic analyses. Thus, by some criteria, serrate is present, but the embryo does not express this gene, and it does not form a clade distinct from Delta-related ligands.

Temporal RNA expression patterns of sea urchin delta and notch

Three sea urchin Notch pathway genes were cloned. Notch and delta were cloned in Lytechinus variegatus and have previously been described (Sherwood and McClay, 1997) ;(Sherwood and McClay, 1999); (Sherwood and McClay, 2001); (Sweet et al., 2002). The RNA expression patterns of notch and delta were examined by Quantitative PCR. Notch is expressed maternally, decreases during the first cleavages and then begins to increase again at the blastula stages (Figure 2F). This pattern agrees with the previously published northern analysis data (Sherwood and McClay, 1997). Delta begins to accumulate during the blastula and gastrula stages (Figure 2G). This pattern agrees with the previously published northern analysis (Sweet et al., 2002) with the exception of a continued expression pattern at later stages not seen in the published northern analysis.

RNA localization patterns for delta and notch

The delta RNA in situ expression pattern observed matches the previously published pattern (Sweet et al., 2002), in which delta first localizes to micromeres. Then it localizes to a ring of cells at the vegetal pole at the hatched blastula stage and is expressed in the vegetal plate cells with the exception of the primary mesenchyme cells at the mesenchyme blastula stage (Figure 4B and C). Expression is confined to the secondary mesenchyme cells at the prism stage (Figure 4D) with the possible exception being expression in presumptive neuroblasts at the apical region (see the paper by Burke, et al., in this issue).

Figure 4.

Figure 4

Open in a new tab

RNA in situ localization pattern for main components of the Notch signaling pathway. A–D, Delta; E–G, Notch. Stages are: HB, hatched blastula; MB, mesenchyme blastula; EG, early gastrula; LG, late gastrula; PR, prism. All views are lateral except C,F and J which are indicated as vegetal views.

Zygotic notch mRNA is confined to ring of cells in the presumptive endoderm at the mesenchyme blastula stage (Figure 4E and F). That ring of notch expression is predictably outside the ring of delta expression at the same stage (Figure 4C). Earlier in development Notch protein was shown with antibodies initially to be expressed on all cells of the embryo, and the early maternally expressed Notch on presumptive SMCs is activated by Delta from micromeres as a necessary step in SMC specification (Sherwood and McClay, 1997. 1999. 2001). Notch continues to be expressed in the endoderm throughout gastrulation where it plays an essential role in defining the fate of endoderm, just as it earlier had an important role in separation of SMCs and endoderm from early endomesoderm (Sherwood and McClay, 1999). Notch also appears to have a later role in determining the border between endoderm and ectoderm (Sherwood and McClay, 2001). A further role in patterning of the endoderm itself is suggested by the interaction of Notch with other molecules within the Endomesodermal Gene Regulatory Network (McClay, unpublished data), however further investigation is needed to define this endodermal patterning role.

Role of Notch in germ layer specification across the animal kingdom

Notch is expressed in the gut of amphioxus (Holland et al., 2001) and developing mouse embryos (Schroder and Gossler, 2002) and is essential to gut development. Notch has also been shown to play a role in endoderm development in xenopus (Contakos et al., 2005), chicken (Matsuda et al., 2005), zebrafish (Kikuchi et al., 2004), and Drosophila (Fusse and Hoch, 2002). Thus, in addition to its well-characterized role in neural specification, the Notch pathway is involved broadly in the specification of other tissues in the embryo. A later pattern of expression in the sea urchin suggests that Delta-Notch could be used for neural specification (Figure 4D), but functional data testing this hypothesis is lacking at present.

Summary

Thirty Hh pathway genes and twenty-three Notch pathway genes (excluding Notch-ligands besides Delta and Serrate) have been identified from the sea urchin genome. Analysis of these genes revealed that for the most part all main components and modifiers were present in the sea urchin and that the number of copies of genes was consistent with its place in evolutionary history. In addition, the differences in relationships of the proteins produced from these genes relative to humans, Ciona, Drosophila and Nematostella suggests that the pathways did not evolve as a unit, but rather each component was subjected to its own evolutionary selection. Finally, temporal and spatial RNA expression patterns for these genes suggest their importance in gut development is conserved in the sea urchin relative to similar known functions in other species.

Supplementary Material

Supplementary Figure 1

Supplemental Figure 1. Phylogenetic neighbor-joining analysis with bootstrap values for Hh signaling pathway components. A, Hh homolog comparison. B, Ptc, Niemann-Pick and Disp homolog comparison. C, Smo comparison. D. Gli and Glis comparison. E. Hip/KIAA1822 comparison. Outgroups were: A, C. elegans Warthog, B, C. elegans Ptc, C, human and Drosophila Frizzled, D, human BCL5 and Drosophila.kruppel, E, Oryza sativa glucose/sorbosone dehydrogenases-like and Mycobacterium tuberculosis gi15842564. S. purpuratus Glean3 model numbers, C. intestinalis ANISEED numbers, N. vectensis StellaBase numbers, and H. sapiens Ensembl numbers are indicated in the figure. Other GenBank accession numbers (gi) were: DmHh gi37999912, HsShh gi51094663, HsIhh 51467741, HsDhh gi19482158, CiHh1 gi74096313, CiHh2 gi74096315, CeWarthog1 gi2731171; HsNPC2 gi5453678, HsNPC1 gi4557803, DmNPC1 gi5921280, HsNPC1like1 gi7019469, HsDisp1 gi295952134, HsDisp2 gi25121980, DmDisp gi6683905, DmPtc gi8390, CiPtc1 gi70570843, HsPtc gi4506247, HsPtc2 52145305, CePtc1 gi17536373; DmFrz gi7981, HsSmo 5032099, DmSmo gi2613076, HsFrz1 gi4503825; HsGlis1 gi56749098, HsGlis3 gi34303944, HsGlis2 gi14211891, CiGli12 gi70569782, HsGli1 gi20152843, HsGli2 gi12644112, HsGli3 gi13518032, DmCi, gi25453428, DmKruppel gi17647565, HsBCL5 gi2136417; Hs Hip gi11528010, Mt gi15842564; Os g/s-dehydrogenases-like gi50510121. Bootstrap values less than 50 are not shown. Dashed line indicates weak similarity.

Supplementary Figure 2

Supplemental Figure 2. Phylogenetic neighbor-joining analysis with bootstrap values for Notch signaling pathway components. A, Notch homolog comparison. B, Nicastrin homolog comparison. C, Notch ligand comparison including Delta, Jagged/Serrate, and Notch-like ligands. Outgroups were: A, human and Drosophila epidermal growth factor receptor, B, Oryza sativa putative nicastrin, C, human and Drosophila crumbs. S. purpuratus Glean3 model numbers, C. intestinalis ANISEED numbers, N. vectensis StellaBase numbers, and H. sapiens Ensembl numbers are indicated in the figure. Other GenBank accession numbers (gi) were: HsNotch1 gi27894368, HsNotch2 gi11275978, HsNotch3 gi4557799, HsNotch4 gi57209680, DmNotch gi24639454, HsEGFRa gi29725609, DmEGFRA gi17136534; DmNicastrin CG7012-PA gi24649805, DmNicastrin CG7012-PB gi45553509, Os putative Nicastrin gi50912531; HsCrumbs1 gi41327708, DmCrumbs gi552087, HsDelta4 gi76827108, HsDelta1 gi9963831, DmDelta gi577774, CiDelta gi70569213, DmSerrate gi8564, HsDelta3 gi12652923, HsJagged2a gi21704277, HsJagged2b gi21704279, HsJagged1 gi1695274. Bootstrap values less than 50 are not shown.

Supplementary Table 1

Supplemental Table 1. Chart of all annotated genes in the Hh signaling pathway with Glean3 model/SPU_ number, best human blast hit from GenBank, and High-density oligonucleotide microarray relative expression level. Inline graphic High expression above 20, Inline graphic medium expression between 5-20, Inline graphic no expression detected.

Supplementary Table 2

Supplemental Table 2. Chart of all annotated genes in the Notch signaling pathway with Glean3 model/SPU_ number, best human blast hit from GenBank, and High-density oligonucleotide microarray relative expression level. Inline graphic High expression above 20, Inline graphic medium expression between 5-20, Inline graphic no expression detected.

Acknowledgments

We would like to thank Ronghui Xu, Cynthia Bradham, Christine Byrum, Wendy Beane, Arcady Mushegian, Karl Bergeron, Shuguang Liang, Richard Hynes, Lynne Angerer, and Sofia Hussain for annotating some of the genes described here. Jim Balhoff was also instrumental in discussions and provided great advice in analyzing the relationships between species. This work was supported by the U.S. Army Medical Research and Materiel Command under W81XWH-04-1-0324 to K.D.W. and NIH grants HD14483 and GM61464 to D.R.M.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Akimaru H, Chen Y, Dai P, Hou DX, Nonaka M, Smolik SM, Armstrong S, Goodman RH, Ishii S. Drosophila CBP is a co-activator of cubitus interruptus in hedgehog signalling. Nature. 1997;386:735–8. doi: 10.1038/386735a0. [DOI] [PubMed] [Google Scholar]
  3. Annaert W, De Strooper B. Presenilins: molecular switches between proteolysis and signal transduction. Trends Neurosci. 1999;22:439–43. doi: 10.1016/s0166-2236(99)01455-1. [DOI] [PubMed] [Google Scholar]
  4. Artavanis-Tsakonas S, Rand MD, Lake RJ. Notch signaling: cell fate control and signal integration in development. Science. 1999;284:770–6. doi: 10.1126/science.284.5415.770. [DOI] [PubMed] [Google Scholar]
  5. Avidor-Reiss T, Maer AM, Koundakjian E, Polyanovsky A, Keil T, Subramaniam S, Zuker CS. Decoding cilia function: defining specialized genes required for compartmentalized cilia biogenesis. Cell. 2004;117:527–39. doi: 10.1016/s0092-8674(04)00412-x. [DOI] [PubMed] [Google Scholar]
  6. Aza-Blanc P, Ramirez-Weber FA, Laget MP, Schwartz C, Kornberg TB. Proteolysis that is inhibited by hedgehog targets Cubitus interruptus protein to the nucleus and converts it to a repressor. Cell. 1997;89:1043–53. doi: 10.1016/s0092-8674(00)80292-5. [DOI] [PubMed] [Google Scholar]
  7. Bellaiche Y, The I, Perrimon N. Tout-velu is a Drosophila homologue of the putative tumour suppressor EXT-1 and is needed for Hh diffusion. Nature. 1998;394:85–8. doi: 10.1038/27932. [DOI] [PubMed] [Google Scholar]
  8. Bitgood MJ, McMahon AP. Hedgehog and Bmp genes are coexpressed at many diverse sites of cell-cell interaction in the mouse embryo. Dev Biol. 1995;172:126–38. doi: 10.1006/dbio.1995.0010. [DOI] [PubMed] [Google Scholar]
  9. Brou C, Logeat F, Gupta N, Bessia C, LeBail O, Doedens JR, Cumano A, Roux P, Black RA, Israel A. A novel proteolytic cleavage involved in Notch signaling: the role of the disintegrin-metalloprotease TACE. Mol Cell. 2000;5:207–16. doi: 10.1016/s1097-2765(00)80417-7. [DOI] [PubMed] [Google Scholar]
  10. Bulgakov OV, Eggenschwiler JT, Hong DH, Anderson KV, Li T. FKBP8 is a negative regulator of mouse sonic hedgehog signaling in neural tissues. Development. 2004;131:2149–59. doi: 10.1242/dev.01122. [DOI] [PubMed] [Google Scholar]
  11. Bumcrot DA, Takada R, McMahon AP. Proteolytic processing yields two secreted forms of sonic hedgehog. Mol Cell Biol. 1995;15:2294–303. doi: 10.1128/mcb.15.4.2294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Burke R, Nellen D, Bellotto M, Hafen E, Senti KA, Dickson BJ, Basler K. Dispatched, a novel sterol-sensing domain protein dedicated to the release of cholesterol-modified hedgehog from signaling cells. Cell. 1999;99:803–15. doi: 10.1016/s0092-8674(00)81677-3. [DOI] [PubMed] [Google Scholar]
  13. Cayouette M, Raff M. Asymmetric segregation of Numb: a mechanism for neural specification from Drosophila to mammals. Nat Neurosci. 2002;5:1265–9. doi: 10.1038/nn1202-1265. [DOI] [PubMed] [Google Scholar]
  14. Chamoun Z, Mann RK, Nellen D, von Kessler DP, Bellotto M, Beachy PA, Basler K. Skinny hedgehog, an acyltransferase required for palmitoylation and activity of the hedgehog signal. Science. 2001;293:2080–4. doi: 10.1126/science.1064437. [DOI] [PubMed] [Google Scholar]
  15. Chen CH, von Kessler DP, Park W, Wang B, Ma Y, Beachy PA. Nuclear trafficking of Cubitus interruptus in the transcriptional regulation of Hedgehog target gene expression. Cell. 1999;98:305–16. doi: 10.1016/s0092-8674(00)81960-1. [DOI] [PubMed] [Google Scholar]
  16. Chen Y, Gallaher N, Goodman RH, Smolik SM. Protein kinase A directly regulates the activity and proteolysis of cubitus interruptus. Proc Natl Acad Sci U S A. 1998;95:2349–54. doi: 10.1073/pnas.95.5.2349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Chen Y, Struhl G. Dual roles for patched in sequestering and transducing Hedgehog. Cell. 1996;87:553–63. doi: 10.1016/s0092-8674(00)81374-4. [DOI] [PubMed] [Google Scholar]
  18. Chuang PT, McMahon AP. Vertebrate Hedgehog signalling modulated by induction of a Hedgehog-binding protein. Nature. 1999;397:617–21. doi: 10.1038/17611. [DOI] [PubMed] [Google Scholar]
  19. Contakos SP, Gaydos CM, Pfeil EC, McLaughlin KA. Subdividing the embryo: a role for Notch signaling during germ layer patterning in Xenopus laevis. Dev Biol. 2005;288:294–307. doi: 10.1016/j.ydbio.2005.09.015. [DOI] [PubMed] [Google Scholar]
  20. Davey MG, Paton IR, Yin Y, Schmidt M, Bangs FK, Morrice DR, Smith TG, Buxton P, Stamataki D, Tanaka M, Munsterberg AE, Briscoe J, Tickle C, Burt DW. The chicken talpid3 gene encodes a novel protein essential for Hedgehog signaling. Genes Dev. 2006;20:1365–77. doi: 10.1101/gad.369106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Deblandre GA, Lai EC, Kintner C. Xenopus neuralized is a ubiquitin ligase that interacts with XDelta1 and regulates Notch signaling. Dev Cell. 2001;1:795–806. doi: 10.1016/s1534-5807(01)00091-0. [DOI] [PubMed] [Google Scholar]
  22. Diederich RJ, Matsuno K, Hing H, Artavanis-Tsakonas S. Cytosolic interaction between deltex and Notch ankyrin repeats implicates deltex in the Notch signaling pathway. Development. 1994;120:473–81. doi: 10.1242/dev.120.3.473. [DOI] [PubMed] [Google Scholar]
  23. Echelard Y, Epstein DJ, St-Jacques B, Shen L, Mohler J, McMahon JA, McMahon AP. Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell. 1993;75:1417–30. doi: 10.1016/0092-8674(93)90627-3. [DOI] [PubMed] [Google Scholar]
  24. Egana AL, Ernst SG. Sphedgehog is expressed by pigment cell precursors during early gastrulation in Strongylocentrotus purpuratus. Dev Dyn. 2004;231:370–8. doi: 10.1002/dvdy.20125. [DOI] [PubMed] [Google Scholar]
  25. Ekker SC, McGrew LL, Lai CJ, Lee JJ, von Kessler DP, Moon RT, Beachy PA. Distinct expression and shared activities of members of the hedgehog gene family of Xenopus laevis. Development. 1995;121:2337–47. doi: 10.1242/dev.121.8.2337. [DOI] [PubMed] [Google Scholar]
  26. Fehon RG, Kooh PJ, Rebay I, Regan CL, Xu T, Muskavitch MA, Artavanis-Tsakonas S. Molecular interactions between the protein products of the neurogenic loci Notch and Delta, two EGF-homologous genes in Drosophila. Cell. 1990;61:523–34. doi: 10.1016/0092-8674(90)90534-l. [DOI] [PubMed] [Google Scholar]
  27. Fleming RJ, Gu Y, Hukriede NA. Serrate-mediated activation of Notch is specifically blocked by the product of the gene fringe in the dorsal compartment of the Drosophila wing imaginal disc. Development. 1997;124:2973–81. doi: 10.1242/dev.124.15.2973. [DOI] [PubMed] [Google Scholar]
  28. Fusse B, Hoch M. Notch signaling controls cell fate specification along the dorsoventral axis of the Drosophila gut. Curr Biol. 2002;12:171–9. doi: 10.1016/s0960-9822(02)00653-x. [DOI] [PubMed] [Google Scholar]
  29. Fuwa TJ, Hori K, Sasamura T, Higgs J, Baron M, Matsuno K. The first deltex null mutant indicates tissue-specific deltex-dependent Notch signaling in Drosophila. Mol Genet Genomics. 2006;275:251–63. doi: 10.1007/s00438-005-0087-3. [DOI] [PubMed] [Google Scholar]
  30. Han YG, Kwok BH, Kernan MJ. Intraflagellar transport is required in Drosophila to differentiate sensory cilia but not sperm. Curr Biol. 2003;13:1679–86. doi: 10.1016/j.cub.2003.08.034. [DOI] [PubMed] [Google Scholar]
  31. Hara Y, Katow H. Exclusive expression of hedgehog in small micromere descendants during early embryogenesis in the sea urchin, Hemicentrotus pulcherrimus. Gene Expr Patterns. 2005;5:503–10. doi: 10.1016/j.modgep.2004.12.003. [DOI] [PubMed] [Google Scholar]
  32. Holland LZ, Rached LA, Tamme R, Holland ND, Kortschak D, Inoko H, Shiina T, Burgtorf C, Lardelli M. Characterization and developmental expression of the amphioxus homolog of Notch (AmphiNotch): evolutionary conservation of multiple expression domains in amphioxus and vertebrates. Dev Biol. 2001;232:493–507. doi: 10.1006/dbio.2001.0160. [DOI] [PubMed] [Google Scholar]
  33. Hooper JE. Smoothened translates Hedgehog levels into distinct responses. Development. 2003;130:3951–63. doi: 10.1242/dev.00594. [DOI] [PubMed] [Google Scholar]
  34. Huangfu D, Anderson KV. Cilia and Hedgehog responsiveness in the mouse. Proc Natl Acad Sci U S A. 2005;102:11325–30. doi: 10.1073/pnas.0505328102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Huangfu D, Anderson KV. Signaling from Smo to Ci/Gli: conservation and divergence of Hedgehog pathways from Drosophila to vertebrates. Development. 2006;133:3–14. doi: 10.1242/dev.02169. [DOI] [PubMed] [Google Scholar]
  36. Huangfu D, Liu A, Rakeman AS, Murcia NS, Niswander L, Anderson KV. Hedgehog signalling in the mouse requires intraflagellar transport proteins. Nature. 2003;426:83–7. doi: 10.1038/nature02061. [DOI] [PubMed] [Google Scholar]
  37. Izraeli S, Lowe LA, Bertness VL, Campaner S, Hahn H, Kirsch IR, Kuehn MR. Genetic evidence that Sil is required for the Sonic Hedgehog response pathway. Genesis. 2001;31:72–7. doi: 10.1002/gene.10004. [DOI] [PubMed] [Google Scholar]
  38. Izraeli S, Lowe LA, Bertness VL, Good DJ, Dorward DW, Kirsch IR, Kuehn MR. The SIL gene is required for mouse embryonic axial development and left-right specification. Nature. 1999;399:691–4. doi: 10.1038/21429. [DOI] [PubMed] [Google Scholar]
  39. Jia J, Amanai K, Wang G, Tang J, Wang B, Jiang J. Shaggy/GSK3 antagonizes Hedgehog signalling by regulating Cubitus interruptus. Nature. 2002;416:548–52. doi: 10.1038/nature733. [DOI] [PubMed] [Google Scholar]
  40. Jia J, Tong C, Jiang J. Smoothened transduces Hedgehog signal by physically interacting with Costal2/Fused complex through its C-terminal tail. Genes Dev. 2003;17:2709–20. doi: 10.1101/gad.1136603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Jiang J, Struhl G. Regulation of the Hedgehog and Wingless signalling pathways by the F-box/WD40-repeat protein Slimb. Nature. 1998;391:493–6. doi: 10.1038/35154. [DOI] [PubMed] [Google Scholar]
  42. Kang D, Huang F, Li D, Shankland M, Gaffield W, Weisblat DA. A hedgehog homolog regulates gut formation in leech (Helobdella) Development. 2003;130:1645–57. doi: 10.1242/dev.00395. [DOI] [PubMed] [Google Scholar]
  43. Kikuchi Y, Verkade H, Reiter JF, Kim CH, Chitnis AB, Kuroiwa A, Stainier DY. Notch signaling can regulate endoderm formation in zebrafish. Dev Dyn. 2004;229:756–62. doi: 10.1002/dvdy.10483. [DOI] [PubMed] [Google Scholar]
  44. Kopan R. Notch: a membrane-bound transcription factor. J Cell Sci. 2002;115:1095–7. doi: 10.1242/jcs.115.6.1095. [DOI] [PubMed] [Google Scholar]
  45. Lai EC, Deblandre GA, Kintner C, Rubin GM. Drosophila neuralized is a ubiquitin ligase that promotes the internalization and degradation of delta. Dev Cell. 2001;1:783–94. doi: 10.1016/s1534-5807(01)00092-2. [DOI] [PubMed] [Google Scholar]
  46. Lee JJ, Ekker SC, von Kessler DP, Porter JA, Sun BI, Beachy PA. Autoproteolysis in hedgehog protein biogenesis. Science. 1994;266:1528–37. doi: 10.1126/science.7985023. [DOI] [PubMed] [Google Scholar]
  47. Lees C, Howie S, Sartor RB, Satsangi J. The hedgehog signalling pathway in the gastrointestinal tract: implications for development, homeostasis, and disease. Gastroenterology. 2005;129:1696–710. doi: 10.1053/j.gastro.2005.05.010. [DOI] [PubMed] [Google Scholar]
  48. Lefers MA, Holmgren R. Ci proteolysis: regulation by a constellation of phosphorylation sites. Curr Biol. 2002;12:R422–3. doi: 10.1016/s0960-9822(02)00914-4. [DOI] [PubMed] [Google Scholar]
  49. Lefers MA, Wang QT, Holmgren RA. Genetic dissection of the Drosophila Cubitus interruptus signaling complex. Dev Biol. 2001;236:411–20. doi: 10.1006/dbio.2001.0345. [DOI] [PubMed] [Google Scholar]
  50. Lieber T, Kidd S, Young MW. kuzbanian-mediated cleavage of Drosophila Notch. Genes Dev. 2002;16:209–21. doi: 10.1101/gad.942302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Liu A, Wang B, Niswander LA. Mouse intraflagellar transport proteins regulate both the activator and repressor functions of Gli transcription factors. Development. 2005;132:3103–11. doi: 10.1242/dev.01894. [DOI] [PubMed] [Google Scholar]
  52. Logeat F, Bessia C, Brou C, LeBail O, Jarriault S, Seidah NG, Israel A. The Notch1 receptor is cleaved constitutively by a furin-like convertase. Proc Natl Acad Sci U S A. 1998;95:8108–12. doi: 10.1073/pnas.95.14.8108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Lum L, Zhang C, Oh S, Mann RK, von Kessler DP, Taipale J, Weis-Garcia F, Gong R, Wang B, Beachy PA. Hedgehog signal transduction via Smoothened association with a cytoplasmic complex scaffolded by the atypical kinesin, Costal-2. Mol Cell. 2003;12:1261–74. doi: 10.1016/s1097-2765(03)00426-x. [DOI] [PubMed] [Google Scholar]
  54. Marigo V, Davey RA, Zuo Y, Cunningham JM, Tabin CJ. Biochemical evidence that patched is the Hedgehog receptor. Nature. 1996;384:176–9. doi: 10.1038/384176a0. [DOI] [PubMed] [Google Scholar]
  55. Matsuda Y, Wakamatsu Y, Kohyama J, Okano H, Fukuda K, Yasugi S. Notch signaling functions as a binary switch for the determination of glandular and luminal fates of endodermal epithelium during chicken stomach development. Development. 2005;132:2783–93. doi: 10.1242/dev.01853. [DOI] [PubMed] [Google Scholar]
  56. Matsuno K, Diederich RJ, Go MJ, Blaumueller CM, Artavanis-Tsakonas S. Deltex acts as a positive regulator of Notch signaling through interactions with the Notch ankyrin repeats. Development. 1995;121:2633–44. doi: 10.1242/dev.121.8.2633. [DOI] [PubMed] [Google Scholar]
  57. Methot N, Basler K. Hedgehog controls limb development by regulating the activities of distinct transcriptional activator and repressor forms of Cubitus interruptus. Cell. 1999;96:819–31. doi: 10.1016/s0092-8674(00)80592-9. [DOI] [PubMed] [Google Scholar]
  58. Methot N, Basler K. Suppressor of fused opposes hedgehog signal transduction by impeding nuclear accumulation of the activator form of Cubitus interruptus. Development. 2000;127:4001–10. doi: 10.1242/dev.127.18.4001. [DOI] [PubMed] [Google Scholar]
  59. Mohler J, Vani K. Molecular organization and embryonic expression of the hedgehog gene involved in cell-cell communication in segmental patterning of Drosophila. Development. 1992;115:957–71. doi: 10.1242/dev.115.4.957. [DOI] [PubMed] [Google Scholar]
  60. Mumm JS, Schroeter EH, Saxena MT, Griesemer A, Tian X, Pan DJ, Ray WJ, Kopan R. A ligand-induced extracellular cleavage regulates gamma-secretase-like proteolytic activation of Notch1. Mol Cell. 2000;5:197–206. doi: 10.1016/s1097-2765(00)80416-5. [DOI] [PubMed] [Google Scholar]
  61. Nakano Y, Nystedt S, Shivdasani AA, Strutt H, Thomas C, Ingham PW. Functional domains and sub-cellular distribution of the Hedgehog transducing protein Smoothened in Drosophila. Mech Dev. 2004;121:507–18. doi: 10.1016/j.mod.2004.04.015. [DOI] [PubMed] [Google Scholar]
  62. Nemer M, Rondinelli E, Infante D, Infante AA. Polyubiquitin RNA characteristics and conditional induction in sea urchin embryos. Dev Biol. 1991;145:255–65. doi: 10.1016/0012-1606(91)90124-l. [DOI] [PubMed] [Google Scholar]
  63. Panin VM, Papayannopoulos V, Wilson R, Irvine KD. Fringe modulates Notch-ligand interactions. Nature. 1997;387:908–12. doi: 10.1038/43191. [DOI] [PubMed] [Google Scholar]
  64. Pavlopoulos E, Pitsouli C, Klueg KM, Muskavitch MA, Moschonas NK, Delidakis C. neuralized Encodes a peripheral membrane protein involved in delta signaling and endocytosis. Dev Cell. 2001;1:807–16. doi: 10.1016/s1534-5807(01)00093-4. [DOI] [PubMed] [Google Scholar]
  65. Pepinsky RB, Zeng C, Wen D, Rayhorn P, Baker DP, Williams KP, Bixler SA, Ambrose CM, Garber EA, Miatkowski K, Taylor FR, Wang EA, Galdes A. Identification of a palmitic acid-modified form of human Sonic hedgehog. J Biol Chem. 1998;273:14037–45. doi: 10.1074/jbc.273.22.14037. [DOI] [PubMed] [Google Scholar]
  66. Peterson RE, McClay DR. A Fringe-modified Notch signal affects specification of mesoderm and endoderm in the sea urchin embryo. Dev Biol. 2005;282:126–37. doi: 10.1016/j.ydbio.2005.02.033. [DOI] [PubMed] [Google Scholar]
  67. Pitsouli C, Delidakis C. The interplay between DSL proteins and ubiquitin ligases in Notch signaling. Development. 2005;132:4041–50. doi: 10.1242/dev.01979. [DOI] [PubMed] [Google Scholar]
  68. Porter JA, von Kessler DP, Ekker SC, Young KE, Lee JJ, Moses K, Beachy PA. The product of hedgehog autoproteolytic cleavage active in local and long-range signalling. Nature. 1995;374:363–6. doi: 10.1038/374363a0. [DOI] [PubMed] [Google Scholar]
  69. Porter JA, Young KE, Beachy PA. Cholesterol modification of hedgehog signaling proteins in animal development. Science. 1996;274:255–9. doi: 10.1126/science.274.5285.255. [DOI] [PubMed] [Google Scholar]
  70. Preat T. Characterization of Suppressor of fused, a complete suppressor of the fused segment polarity gene of Drosophila melanogaster. Genetics. 1992;132:725–36. doi: 10.1093/genetics/132.3.725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Price MA, Kalderon D. Proteolysis of the Hedgehog signaling effector Cubitus interruptus requires phosphorylation by Glycogen Synthase Kinase 3 and Casein Kinase 1. Cell. 2002;108:823–35. doi: 10.1016/s0092-8674(02)00664-5. [DOI] [PubMed] [Google Scholar]
  72. Ramalho-Santos M, Melton DA, McMahon AP. Hedgehog signals regulate multiple aspects of gastrointestinal development. Development. 2000;127:2763–72. doi: 10.1242/dev.127.12.2763. [DOI] [PubMed] [Google Scholar]
  73. Ransick A, Davidson EH. cis-Regulatory processing of Notch signaling input to the sea urchin glial cells missing gene during mesoderm specification. Developmental Biology. 2006 doi: 10.1016/j.ydbio.2006.05.037. In Press, Accepted Manuscript. [DOI] [PubMed] [Google Scholar]
  74. Ransick A, Rast JP, Minokawa T, Calestani C, Davidson EH. New early zygotic regulators expressed in endomesoderm of sea urchin embryos discovered by differential array hybridization. Dev Biol. 2002;246:132–47. doi: 10.1006/dbio.2002.0607. [DOI] [PubMed] [Google Scholar]
  75. Ray K, Perez SE, Yang Z, Xu J, Ritchings BW, Steller H, Goldstein LS. Kinesin-II is required for axonal transport of choline acetyltransferase in Drosophila. J Cell Biol. 1999;147:507–18. doi: 10.1083/jcb.147.3.507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Rebay I, Fleming RJ, Fehon RG, Cherbas L, Cherbas P, Artavanis-Tsakonas S. Specific EGF repeats of Notch mediate interactions with Delta and Serrate: implications for Notch as a multifunctional receptor. Cell. 1991;67:687–99. doi: 10.1016/0092-8674(91)90064-6. [DOI] [PubMed] [Google Scholar]
  77. Reiter JF, Skarnes WC. Tectonic, a novel regulator of the Hedgehog pathway required for both activation and inhibition. Genes Dev. 2006;20:22–7. doi: 10.1101/gad.1363606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Rosenbaum JL, Witman GB. Intraflagellar transport. Nat Rev Mol Cell Biol. 2002;3:813–25. doi: 10.1038/nrm952. [DOI] [PubMed] [Google Scholar]
  79. Samanta M, Tongprasit W, Istrail S, Cameron A, Tu Q, Davidson EH. High resolution transcriptome map of the sea urchin embryo. Developmental Biology. 2006 In press. [Google Scholar]
  80. Schroder N, Gossler A. Expression of Notch pathway components in fetal and adult mouse small intestine. Gene Expr Patterns. 2002;2:247–50. doi: 10.1016/s1567-133x(02)00060-1. [DOI] [PubMed] [Google Scholar]
  81. Sherwood DR, McClay DR. Identification and localization of a sea urchin Notch homologue: insights into vegetal plate regionalization and Notch receptor regulation. Development. 1997;124:3363–74. doi: 10.1242/dev.124.17.3363. [DOI] [PubMed] [Google Scholar]
  82. Sherwood DR, McClay DR. LvNotch signaling mediates secondary mesenchyme specification in the sea urchin embryo. Development. 1999;126:1703–13. doi: 10.1242/dev.126.8.1703. [DOI] [PubMed] [Google Scholar]
  83. Sherwood DR, McClay DR. LvNotch signaling plays a dual role in regulating the position of the ectoderm-endoderm boundary in the sea urchin embryo. Development. 2001;128:2221–32. doi: 10.1242/dev.128.12.2221. [DOI] [PubMed] [Google Scholar]
  84. Shimeld SM. The evolution of the hedgehog gene family in chordates: insights from amphioxus hedgehog. Dev Genes Evol. 1999;209:40–7. doi: 10.1007/s004270050225. [DOI] [PubMed] [Google Scholar]
  85. Sotillos S, Roch F, Campuzano S. The metalloprotease-disintegrin Kuzbanian participates in Notch activation during growth and patterning of Drosophila imaginal discs. Development. 1997;124:4769–79. doi: 10.1242/dev.124.23.4769. [DOI] [PubMed] [Google Scholar]
  86. Stone DM, Hynes M, Armanini M, Swanson TA, Gu Q, Johnson RL, Scott MP, Pennica D, Goddard A, Phillips H, Noll M, Hooper JE, de Sauvage F, Rosenthal A. The tumour-suppressor gene patched encodes a candidate receptor for Sonic hedgehog. Nature. 1996;384:129–34. doi: 10.1038/384129a0. [DOI] [PubMed] [Google Scholar]
  87. Strahle U, Blader P, Ingham PW. Expression of axial and sonic hedgehog in wildtype and midline defective zebrafish embryos. Int J Dev Biol. 1996;40:929–40. [PubMed] [Google Scholar]
  88. Sukegawa A, Narita T, Kameda T, Saitoh K, Nohno T, Iba H, Yasugi S, Fukuda K. The concentric structure of the developing gut is regulated by Sonic hedgehog derived from endodermal epithelium. Development. 2000;127:1971–80. doi: 10.1242/dev.127.9.1971. [DOI] [PubMed] [Google Scholar]
  89. Sweet HC, Gehring M, Ettensohn CA. LvDelta is a mesoderm-inducing signal in the sea urchin embryo and can endow blastomeres with organizer-like properties. Development. 2002;129:1945–55. doi: 10.1242/dev.129.8.1945. [DOI] [PubMed] [Google Scholar]
  90. The I, Bellaiche Y, Perrimon N. Hedgehog movement is regulated through tout velu-dependent synthesis of a heparan sulfate proteoglycan. Mol Cell. 1999;4:633–9. doi: 10.1016/s1097-2765(00)80214-2. [DOI] [PubMed] [Google Scholar]
  91. Theodosiou NA, Zhang S, Wang WY, Xu T. slimb coordinates wg and dpp expression in the dorsal-ventral and anterior-posterior axes during limb development. Development. 1998;125:3411–6. doi: 10.1242/dev.125.17.3411. [DOI] [PubMed] [Google Scholar]
  92. Varjosalo M, Li SP, Taipale J. Divergence of hedgehog signal transduction mechanism between Drosophila and mammals. Dev Cell. 2006;10:177–86. doi: 10.1016/j.devcel.2005.12.014. [DOI] [PubMed] [Google Scholar]
  93. von Mering C, Basler K. Distinct and regulated activities of human Gli proteins in Drosophila. Curr Biol. 1999;9:1319–22. doi: 10.1016/s0960-9822(00)80054-8. [DOI] [PubMed] [Google Scholar]
  94. Wang G, Amanai K, Wang B, Jiang J. Interactions with Costal2 and suppressor of fused regulate nuclear translocation and activity of cubitus interruptus. Genes Dev. 2000;14:2893–905. doi: 10.1101/gad.843900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  95. Weinmaster G. Notch signal transduction: a real rip and more. Curr Opin Genet Dev. 2000;10:363–9. doi: 10.1016/s0959-437x(00)00097-6. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figure 1

Supplemental Figure 1. Phylogenetic neighbor-joining analysis with bootstrap values for Hh signaling pathway components. A, Hh homolog comparison. B, Ptc, Niemann-Pick and Disp homolog comparison. C, Smo comparison. D. Gli and Glis comparison. E. Hip/KIAA1822 comparison. Outgroups were: A, C. elegans Warthog, B, C. elegans Ptc, C, human and Drosophila Frizzled, D, human BCL5 and Drosophila.kruppel, E, Oryza sativa glucose/sorbosone dehydrogenases-like and Mycobacterium tuberculosis gi15842564. S. purpuratus Glean3 model numbers, C. intestinalis ANISEED numbers, N. vectensis StellaBase numbers, and H. sapiens Ensembl numbers are indicated in the figure. Other GenBank accession numbers (gi) were: DmHh gi37999912, HsShh gi51094663, HsIhh 51467741, HsDhh gi19482158, CiHh1 gi74096313, CiHh2 gi74096315, CeWarthog1 gi2731171; HsNPC2 gi5453678, HsNPC1 gi4557803, DmNPC1 gi5921280, HsNPC1like1 gi7019469, HsDisp1 gi295952134, HsDisp2 gi25121980, DmDisp gi6683905, DmPtc gi8390, CiPtc1 gi70570843, HsPtc gi4506247, HsPtc2 52145305, CePtc1 gi17536373; DmFrz gi7981, HsSmo 5032099, DmSmo gi2613076, HsFrz1 gi4503825; HsGlis1 gi56749098, HsGlis3 gi34303944, HsGlis2 gi14211891, CiGli12 gi70569782, HsGli1 gi20152843, HsGli2 gi12644112, HsGli3 gi13518032, DmCi, gi25453428, DmKruppel gi17647565, HsBCL5 gi2136417; Hs Hip gi11528010, Mt gi15842564; Os g/s-dehydrogenases-like gi50510121. Bootstrap values less than 50 are not shown. Dashed line indicates weak similarity.

NIHMS14900-supplement-fig1.pdf (707.1KB, pdf)
Supplementary Figure 2

Supplemental Figure 2. Phylogenetic neighbor-joining analysis with bootstrap values for Notch signaling pathway components. A, Notch homolog comparison. B, Nicastrin homolog comparison. C, Notch ligand comparison including Delta, Jagged/Serrate, and Notch-like ligands. Outgroups were: A, human and Drosophila epidermal growth factor receptor, B, Oryza sativa putative nicastrin, C, human and Drosophila crumbs. S. purpuratus Glean3 model numbers, C. intestinalis ANISEED numbers, N. vectensis StellaBase numbers, and H. sapiens Ensembl numbers are indicated in the figure. Other GenBank accession numbers (gi) were: HsNotch1 gi27894368, HsNotch2 gi11275978, HsNotch3 gi4557799, HsNotch4 gi57209680, DmNotch gi24639454, HsEGFRa gi29725609, DmEGFRA gi17136534; DmNicastrin CG7012-PA gi24649805, DmNicastrin CG7012-PB gi45553509, Os putative Nicastrin gi50912531; HsCrumbs1 gi41327708, DmCrumbs gi552087, HsDelta4 gi76827108, HsDelta1 gi9963831, DmDelta gi577774, CiDelta gi70569213, DmSerrate gi8564, HsDelta3 gi12652923, HsJagged2a gi21704277, HsJagged2b gi21704279, HsJagged1 gi1695274. Bootstrap values less than 50 are not shown.

NIHMS14900-supplement-fig2.pdf (641.2KB, pdf)
Supplementary Table 1

Supplemental Table 1. Chart of all annotated genes in the Hh signaling pathway with Glean3 model/SPU_ number, best human blast hit from GenBank, and High-density oligonucleotide microarray relative expression level. Inline graphic High expression above 20, Inline graphic medium expression between 5-20, Inline graphic no expression detected.

NIHMS14900-supplement-t1.pdf (45.5KB, pdf)
Supplementary Table 2

Supplemental Table 2. Chart of all annotated genes in the Notch signaling pathway with Glean3 model/SPU_ number, best human blast hit from GenBank, and High-density oligonucleotide microarray relative expression level. Inline graphic High expression above 20, Inline graphic medium expression between 5-20, Inline graphic no expression detected.

NIHMS14900-supplement-t2.pdf (43.6KB, pdf)

RESOURCES