Abstract
Aims
The goal of this study was to determine the frequencies of important allelic variants in the TPMT, NAT2, GST, SULT1A1 and MDR-1 genes in the Egyptian population and compare them with the frequencies in other ethnic populations.
Methods
Genotyping was carried out in a total of 200 unrelated Egyptian subjects. TPMT*2 was detected using an allele-specific polymerase chain reaction (PCR) assay. TPMT*3C and NAT2 variants (*5,*6 and *7) were detected using an allele-specific real-time PCR assay. Detection of GSTM1 and GSTT1 null alleles was performed simultaneously using a multiplex PCR assay. Finally, a PCR-restriction fragment length polymorphism assay was applied for the determination of TPMT*3A (*3B), SULT1A1*2 and MDR-1 (3435T) variants.
Results
Genotyping of TPMT revealed frequencies of 0.003 and 0.013 for TPMT*3A and TPMT*3C, respectively. No TPMT*2 or *3B was detected in the analysed samples. The frequencies of specific NAT2 alleles were 0.215, 0.497, 0.260 and 0.028 for *4 (wild-type), *5 (341C), *6 (590A) and *7 (857A), respectively. GSTM1 and GSTT1 null alleles were detected in 55.5% and 29.5% of the subjects, respectively. SULT1A1*2 was detected at a frequency of 0.135. Finally, the frequencies of the wild-type allele (3435C) and the 3435T variant in the MDR-1 gene were found to be 0.6 and 0.4, respectively.
Conclusions
We found that Egyptians resemble other Caucasians with regard to allelic frequencies of the tested variants of NAT2, GST and MDR-1. By contrast, this Egyptian population more closely resemble Africans with respect to the TPMT*3C allele, and shows a distinctly different frequency with regard to the SULT1A1*2 variant. The predominance of the slow acetylator genotype in the present study (60.50%) could not confirm a previously reported higher frequency of the slow acetylator phenotype in Egyptians (92.00%), indicating the possibility of the presence of other mutations not detectable as T341C, G590A and G857A. The purpose of our future studies is to investigate for new polymorphisms, which could be relatively unique to the Egyptian population.
Keywords: drug-metabolizing enzymes, Egyptians, MDR-1, pharmacogenetics
Introduction
Cross-ethnic differences in response to drugs have been related to genotypic variants (polymorphisms) of key enzymes and proteins that affect the safety and efficacy of a drug in the individual patient [1]. For thiopurine S-methyltransferase (TPMT), four alleles have been associated with low or absent enzyme activity. The four prevalent alleles, namely TPMT*2 (G238C), TPMT*3A (G460A and A719G), TPMT*3B (only G460A) and TPMT*3C (only A719G), account for more than 80% of the defective phenotypes [2]. TPMT deficiency is associated with severe haematopoietic toxicity when patients are treated with standard doses of thiopurine drugs [2]. In contrast, TPMT-deficient patients with acute lymphocytic leukaemia could be successfully treated with 5–15% of the conventional dose of mercaptopurine [3]. Recently, the genetic basis for this inherited trait has been elucidated in different ethnic populations; approximately 10% of the population have intermediate activity due to heterozygosity at the TPMT locus, and about 0.33% are TPMT deficient [4].
Similarly, N-acetyltransferase 2 (NAT2) activity is controlled by genetic polymorphisms, and the individual phenotypes can be classified as rapid, intermediate, or slow acetylators according to their acetylation activity [5]. NAT2 metabolizes a range of drugs including isoniazid, procainamide, and some polycyclic amines such as sulphonamides and hydralazines [6]. The relationship between polymorphic acetylation of isoniazid and procainamide by NAT2 and idiosyncratic drug toxicity has been well documented [7]. Polymorphisms at positions 341, 580, and 857 of the NAT2 gene have been observed in several human populations and characterize the major NAT2 defective alleles (NAT2*5, NAT2*6 and NAT2*7, respectively). The impact of ethnicity is well known, with more than 90% being slow acetylators in some Mediterranean populations, with only 10% in Japan (reviewed in [8]).
Large differences between racial groups are also seen for the glutathione S-transferases (GSTs). GSTs are a superfamily of enzymes that catalyse the conjugation of xenobiotics and endogenous substrates with glutathione, and thereby play a significant role in the inactivation and occasionally the activation of many drugs and xenobiotics [9]. In humans, one member of the mu class gene family (GSTM1) has been shown to be polymorphic and is absent (null) in 35–60% of individuals. Similarly, GSTT1, a member of the theta class gene family, is also polymorphic and absent in 10–65% of human populations (reviewed in [10]).
Similarly, human sulfotransferases (SULTs) are a superfamily of multifunctional enzymes. Six cytosolic SULTs have been identified in human tissues and are involved in the metabolism of many drugs, xenobiotics, neurotransmitters and hormones [11]. Previous biochemical pharmacogenetic studies have demonstrated a large individual variation (about 50-fold in some studies) in the activity of platelet SULTs in humans [11–14]. It was reported recently that a large portion of this variability could be explained by a newly identified common polymorphism (a G to A transition) in the coding region of the SULT1A1 gene (SULT1A1*2) [14]. This base change results in an arginine to histidine substitution at codon 213, and individuals homozygous for the His allele had only about 15% of the SULT activity in platelets compared with those with other genotypes [14].
P-glycoprotein (PGP), the product of the multidrug resistance (MDR-1) gene also plays an important role in the bioavailability of a wide variety of drugs, including the cardiac glycoside digoxin and anthracycline antibiotics, vinblastine, daunomycin, and cyclosporin A [15]. Recently, a C to T transition (C3435T) has been described in exon 26 of the MDR-1 gene [16]. Individuals who are homozygous for the 3435T variant have a significant decrease in intestinal PGP expression, and increased plasma digoxin levels after oral administration [16].
The frequencies of the important allelic variants in the TPMT, NAT2, GST, SULT1A1 and MDR-1 genes have been extensively studied in many ethnic groups, and the accumulated data show striking interethnic variation in the distribution of these variants. However, no information is available for the Egyptian population (except for GST[17, 18]). In the present study, we have therefore investigated the frequencies of the TPMT (*2, *3A,*3B and *3C), NAT2 (*5, *6 and*7), GST (M1 and T1 null alleles), SULT1A1 (SULT1A1*2) and MDR-1 (C3435T) polymorphisms in Egyptian individuals (200 subjects), providing a basis for future clinical studies concerning variability in the response and/or toxicity to drugs known to be substrates for TPMT, NAT2, GST, SULT1A1 and MDR-1.
Methods
Subjects
Two hundred unrelated Egyptian subjects participated in this study. The Egyptian population is divided into several cultural groups: Bedouins, Nubians, Berbers, Peasants and Urbanites. The subjects who participated in our study were students and staff at Cairo University, thereby considered as Urbanites living in Cairo or other surrounding cities. Each subject gave a sample of approximately 1 mL saliva after detailed explanation of the purpose of the study; a signed written consent was also obtained from each subject. Genomic DNA was isolated from the saliva using a QIAamp DNA Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's recommendations. Sample collection and DNA isolation were performed under the supervision and approval of the Dean of the Faculty of Pharmacy of Cairo University. The isolated DNA samples were sent to our laboratory in Japan, and the genotyping protocol was approved by the institutional ethics committee of Tohoku University School of Medicine, Sendai, Japan, and Faculty of Pharmacy, Cairo University, Cairo, Egypt.
Oligonucleotides
The primers were synthesized by Nihon Gene Research Laboratories, Inc. (Sendai, Japan). The TaqMan probes were synthesized by Applied Biosystems (Foster City, California, USA) and contained 6-carboxyfluorescein (FAM) at the 5′ end and 6-carboxytetramethylrhodamine (TAMRA) with a phosphate molecule at the 3′ end.
Genotyping
TPMT*2 (G238C)
The genotyping of each individual for the G238C mutation was performed using an allele-specific polymerase chain reaction (PCR) assay as previously described by Yates et al.[19].
TPMT*3A (*3B) (G460A)
The genotyping of each individual for the G460A mutation was performed using a previously described PCR-restriction fragment length polymorphism assay (RFLP) [19]. In brief, a 694-bp fragment containing nucleotide 460 was amplified and digested with the restriction enzyme MwoI. The wild-type allele, but not the mutant allele, contains a MwoI restriction site allowing RFLP analysis of the digested products after their separation on a 3% agarose gel. Digestion of the 694-bp fragment at the MwoI site yielded fragments of 443 and 251 bp.
TPMT*3C (A719G), NAT2 variants (*5 (T341C), *6 (G590A) and *7 (G857A))
TPMT*3C (A719G), NAT2*6 (G590A) and NAT2*7 (G857A) were detected using an allele-specific real-time PCR assay as previously described by Hiratsuka et al.[20]. However, in that report the assay was designed for the determination of NAT2*5B (C481T mutation). In the present study and in order to give a collective frequency of the NAT2*5 variants (*5A, *5B and *5C), we have developed another allele-specific real-time PCR assay and have applied it for the determination of the T341C mutation, which is common in all NAT2*5 variants. Details concerning the primers and the probes are given in Table 1.
Table 1.
Summary of primer pairs [wild-type (WT) or mutant (MT) and common (CM) primers] and TaqMan probe (TM) sequences (5’−3’).
| TPMT*3C (A719G) | |
| WT: | TATGTCTCATTTACTTTTCTGTAAGTAGTT |
| MT: | TATGTCTCATTTACTTTTCTGTAAGTAGTC |
| TM: | AGACAGTCAATTCCCCAACTTTTATGTCGTTCTT |
| CM: | TTAACATGTTACTCTTTCTTGTTTCA |
| NAT2*5 (T341C) | |
| WT: | CCTTCTCCTGCAGGTGACCTT |
| MT: | CCTTCTCCTGCAGGTGACCTC |
| TM: | TTACATTGTCGATGCTGGGTCTGGAAGCTC |
| CM: | AGGCTGCCACATCTGGGAG |
| NAT2*6 (G590A) | |
| WT: | GTATTCATAGACTCAAAATCTTCAATTGTCC |
| MT: | GTATTCATAGACTCAAAATCTTCAATTGTCT |
| TM: | TTCTGTCAAGCAGAAAATGCAAGGCACCTG |
| CM: | CCAGATGTGGCAGCCTCTAGAA |
| NAT2*7 (G857A) | |
| WT: | TTTTGTTCCTTATTCTAAATAGTAAGGGACC |
| MT: | TTTTGTTCCTTATTCTAAATAGTAAGGGACT |
| TM: | TCACCAGGTTTGGGCACGAGATTTCT |
| CM: | AACTCTCACTGAGGAAGAGGTTGAAG |
The mismatched nucleotide sites at position −2 are underlined.
GST (M1 and T1 null alleles)
The determination of GSTM1, GSTT1 null alleles was done simultaneously in a single assay using a multiplex PCR approach as described by Abdel-Rahman et al.[17]. The presence or absence of GSTM1 and GSTT1 genes was detected by the presence or absence of a band at 215 bp (corresponding to GSTM1) and a band at 480 bp (corresponding to GSTT1). A band at 312 bp (corresponding to CYP1A1 gene) was always present and was used as an internal control to document successful PCR amplification.
SULT1A1 (G638A)
The SULT1A1 gene is one of three very closely related sulfotransferase genes located on chromosome 16; the open reading frames derived from SULT1A1 and its neighbours SULT1A2 and SULT1A3 share more than 94% identity. Thus the primer pair was chosen specifically to amplify the appropriate region from SULT1A1 using intron sequences flanking exon VII where sequence identity was lower, as described in the method of Engelke et al.[21]. After specific amplification of a 281-bp fragment of DNA including exon VII of the SULT1A1 gene, PCR products were digested with HaeII. Fragments were then resolved on 3% agarose gel. Digestion of the amplified sequence resulted in the formation of two fragments with lengths of 104 and 177 bp. Complete and partial digestion indicated the genotypes SULT1A1*1/*1 and SULT1A1*1/*2, respectively. Lack of digestion indicated the genotype SULT1A1*2/*2.
MDR-1 (C3435T)
In the present study, we have designed a PCR-RFLP assay and successfully applied it for the analysis of the C3435T mutation of the MDR-1 gene. A 231-bp fragment containing nucleotide 3435 was amplified with 0.67 µM MDR-1F (5′-ACTCT TGTTTTCAGCTGCTTG - 3′) and MDR - 1R (5′ -AGAGACTTACATTAGGCAGTGACTC - 3′). PCR amplification consisted of an initial denaturation step at 94 °C for 5 min followed by 33 cycles of denaturation at 94 °C for 30 s, annealing at 56 °C for 20 s, and extension at 72 °C for 30 s. The final extension step was performed at 72 °C for 5 min. All these steps were carried out using a Perkin-Elmer (Shelton, Connecticut, USA) thermocycler. The PCR products were digested with the restriction enzyme Sau3AI at 37 °C overnight. The digested products were then separated on a 3% agarose gel. The wild-type allele, but not the mutant allele contains a Sau3AI restriction site allowing RFLP analysis of the digested products. Digestion of the 231-bp fragment at the Sau3AI site yielded two fragments of 163 and 68 bp.
Throughout the genotyping assays, positive controls (samples with known genotypes) were not included. Instead, all the subjects were genotyped twice for all the tested mutations, which makes the possibility of genotyping error less likely.
Statistical analysis
Data were compiled according to the genotype and allele frequencies estimated from the observed numbers of each specific allele. The frequency of each allele in our subjects is given together with the 95% confidence interval (CI). Differences in allele frequencies between Egyptians and other ethnic populations were measured using the χ2 test and Fisher's exact test. A P-value < 0.05 was considered to be statistically significant throughout the population comparisons.
Results
Tpmt
The presence of the three inactivating mutations (G238C, G460A and A719G) that characterize the most common defective alleles of the TPMT gene was examined in our subjects. A total of 194 subjects (97.00%) was apparently homozygous for the wild-type allele (TPMT*1), i.e. they did not carry any of the tested mutations. Six individuals (3.00%) were heterozygous for one of the mutant alleles. One subject was TPMT*1/TPMT*3A and five subjects were TPMT*1/TPMT*3C, giving allele frequencies of 0.003 (95% CI 0, 0.007) and 0.013 (95% CI, 0.003, 0.023) for TPMT*3A and TPMT*3C, respectively (Table 2). Neither G238C (TPMT*2), G460A alone (TPMT*3B) nor the homozygous form of any mutant allele was detected in Egyptian individuals. In genotype assignment, when both the mutations G460A and A719G were detected in the same DNA sample, a heterozygous genotype TPMT*1/TPMT*3A was assumed. In fact, the possible alternative genotype, i.e. a compound heterozygous genotype TPMT*3B/TPMT*3C, was reasonably excluded, since the TPMT*3B allele (only G460A mutation) was not detected in any of our subjects.
Table 2.
The observed and expected genotype distribution of the tested variants among the 200 Egyptian subjects according to Hardy–Weinberg equilibrium.
| Tested genes | n | Observed frequency (%) | Predicted frequency (%) by Hardy–Weinberg law |
|---|---|---|---|
| TPMT | |||
| * 1/* 1 | 194 | 97.00 | 96.82 |
| * 1/* 2 | 0 | 0 | 0 |
| * 1/* 3A | 1 | 0.50 | 0.59 |
| * 1/* 3C | 5 | 2.50 | 2.56 |
| Mut/mut† | 0 | 0 | 0.03 |
| NAT2‡ | |||
| * 4/* 4 | 7 | 3.50 | 4.62 |
| * 4/* 5 | 49 | 24.50 | 21.37 |
| * 4/* 6 | 21 | 10.50 | 11.18 |
| * 4/* 7 | 2 | 1.00 | 1.20 |
| * 5/* 5 | 45 | 22.50 | 24.70 |
| * 5/* 6 | 56 | 28.00 | 25.84 |
| * 5/* 7 | 4 | 2.00 | 2.78 |
| * 6/* 6 | 11 | 5.50 | 6.76 |
| * 6/* 7 | 5 | 2.50 | 1.46 |
| * 7/* 7 | 0 | 0 | 0.09 |
| SULT1A1 | |||
| * 1/* 1 | 149 | 74.50 | 74.84 |
| * 1/* 2 | 48 | 24.00 | 23.36 |
| * 2/* 2 | 3 | 1.50 | 1.80 |
| MDR-1 | |||
| C/C | 68 | 34.00 | 36.00 |
| C/T | 103 | 51.50 | 48.00 |
| T/T | 29 | 14.50 | 16.00 |
N, Number of subjects.
Include TPMT*2, *3A (*3B) and *3C.
Because of failure of the polymerase chain reaction amplification of one sample, only 199 subjects could be analysed.
Nat2
The allele-specific real-time PCR assay used in this study provided a simple and efficient method for the analysis of the three major nucleotide substitutions in the NAT2 gene (T341C, G590A and G857A) amongst the Egyptian individuals. Throughout the study and in population comparisons, since NAT2*5A, *5B and *5C all contain the T341C substitution, these alleles comprise the group NAT2*5. Similarly, NAT2*6 and NAT2*7 represent the sum of NAT2*6A and*6B and NAT2*7A and*7B, respectively. By contrast, NAT2*4 was assigned to the allele which did not carry any of the three mutations analysed in our study.
The genotype frequencies obtained from all individuals are summarized in Table 2. Because of failure of PCR amplification of one sample, only 199 subjects could be analysed. A total of four fast acetylator genotypes, amounting to 39.50%, were observed. Slow acetylators accounted for 60.50% and were distributed among the five different genotypes. Calculation of the allele frequencies revealed that the most common allele was NAT2*5 (0.497, 95% CI 0.451, 0.549), followed by NAT2*6 (0.260, 95% CI 0.218, 0.304) and the wild-type allele NAT2*4 (0.215, 95% CI 0.175, 0.256). NAT2*7 was found to be the least common variant with a frequency of 0.028 (95% CI 0.011, 0.043).
Gst
A multiplex PCR approach was applied in a total of 200 Egyptian subjects. This method cannot differentiate between the wild type and heterozygous state. It determines only the percentages of the homozygous deletion of both GSTM1 and GSTT1 genes. The numbers of individuals homozygous for the null alleles of the GSTM1 and GSTT1 were 111 (55.50%) and 59 subjects (29.50%), respectively.
Sult1a1
Among the 200 subjects who were genotyped for SULT1A1, the genotype distribution was (SULT1A1*1/*1, *1/*2, *2/*2: 74.50%, 24.00%, 1.50%) (Table 2), giving allele frequencies of 0.865 (95% CI 0.831, 0.898) and 0.135 (95% CI 0.101, 0.168) for SULT1A1*1 and SULT1A1*2, respectively. It should be noted that our study was not designed to detect the rare alleles SULT1A1*3 and *4, so carriers of these alleles may be scored as carriers of SULT1A1*1 or SULT1A1*2.
Mdr-1
Genotyping of our subjects for the C3435T mutation revealed a genotype distribution of (C/C, C/T, T/T: 34.00%, 51.50%, 14.50%) (Table 2). The frequencies of the wild-type allele (3435C) and the 3435T variant were found to be 0.600 (95% CI 0.549, 0.645) and 0.400 (95% CI 0.355, 0.450), respectively.
Our results (Table 2) were in good accordance with the expected genotype distributions of the tested genes, calculated by the Hardy–Weinberg law. The frequencies of the tested alleles in our Egyptian subjects are given in Tables 3–6, with comparison with other data reported in various other ethnic populations.
Table 3.
Allele frequencies of TPMT in various ethnic groups.
| Allele frequency | |||||
|---|---|---|---|---|---|
| Population | n | TPMT*2 | TPMT*3A | TPMT*3C | Reference |
| Egyptians | 200 | 0 | 0.003 | 0.013 | Present study |
| Caucasians | |||||
| American | 282 | 0.002 | 0.032 | 0.002 | [22] |
| British | 199 | 0.005 | 0.045 | 0.003 | [23] |
| French | 191 | 0.005 | 0.057 | 0.008 | [23] |
| Italian | 206 | 0.005 | 0.039 | 0.010 | [24] |
| Saami-Norwegian | 194 | 0 | 0 | 0.033 | [25] |
| Norwegian | 66 | 0 | 0.034 | 0.003 | [25] |
| Asians | |||||
| Japanese | 192 | 0 | 0 | 0.015 | [26] |
| Chinese | 192 | 0 | 0 | 0.023 | [27] |
| South West Asians† | 99 | 0 | 0.01 | 0 | [27] |
| Africans | |||||
| Kenyan | 101 | 0 | 0 | 0.054 | [23] |
| Ghanaian | 217 | 0 | 0 | 0.076 | [28] |
| African-Americans | 248 | 0.004 | 0.008 | 0.024 | [22] |
n, Number of subjects.
South West Asians included people from India, Pakistan, Sri Lanka and Nepal.
Table 6.
Genotype percentages and allele frequencies of MDR-1 (C3435T) polymorphism in various ethnic groups.
| Genotype % | Allele frequency | P | ||||||
|---|---|---|---|---|---|---|---|---|
| Population | n | C/C | C/T | T/T | C | T | (vs. Egyptians) | Reference |
| Egyptians | 200 | 34.00 | 51.50 | 14.50 | 0.600 | 0.400 | Present study | |
| Caucasians | ||||||||
| British | 190 | 24.00 | 48.00 | 28.00 | 0.480 | 0.520 | 0.0005 | [42] |
| Portuguese | 100 | 22.00 | 42.00 | 36.00 | 0.430 | 0.570 | <0.0001 | [42] |
| German | 188 | 28.00 | 48.00 | 24.00 | 0.520 | 0.480 | <0.0001 | [16] |
| Saudi | 96 | 37.00 | 38.00 | 26.00 | 0.550 | 0.450 | NS | [42] |
| Asians | ||||||||
| Japanese | 50 | 34.00 | 46.00 | 20.00 | 0.570 | 0.430 | NS | [43] |
| Chinese | 132 | 32.00 | 42.00 | 26.00 | 0.530 | 0.470 | NS | [42] |
| Filipino | 60 | 38.00 | 42.00 | 20.00 | 0.590 | 0.410 | NS | [42] |
| South-west Asian | 89 | 15.00 | 38.00 | 47.00 | 0.340 | 0.660 | <0.0001 | [42] |
| Africans | ||||||||
| Sudanese | 51 | 52.00 | 43.00 | 6.00 | 0.730 | 0.270 | <0.0001 | [42] |
| Kenyan | 80 | 70.00 | 26.00 | 4.00 | 0.830 | 0.170 | <0.0001 | [42] |
| Ghanaian | 206 | 66.00 | 34.00 | 0 | 0.830 | 0.170 | <0.0001 | [42] |
| African-Americans | 88 | 68.00 | 31.00 | 1.00 | 0.840 | 0.160 | <0.0001 | [42] |
n, Number of subjects. Differences in allele frequencies were measured using Fisher's exact test. NS, There were no significant differences (P > 0.05).
Discussion
Generally, human populations are divided into three major races, namely, the Caucasoid, Mongoloid and Negroid groups. However, some anthropologists regarded Arabs, Jews, Latinos and Spaniards as ‘distinct races’, probably because of the considerable genetic admixture in these populations. Among the Arabs, the Egyptian population was the point of our interest. Egypt is unique geographically, as it is located centrally to the three continents of Africa, Europe and Asia, so its population is highly affected by the rapid pace of intercontinental transportation and large-scale immigration. Throughout history, the Greeks, Romans, Arabs, Turks, French and British have all ruled Egypt and mixed with its people, so that modern Egypt now is an amalgam of all these legacies. In the present study, we thought it worthwhile to attempt to investigate the prevalence of important allelic variants of TPMT, NAT2, GST, SULT1A1 and MDR-1 genes in the Egyptian population, and compare our results with other data previously reported for various ethnic groups.
Tpmt
Population studies [22–28] have demonstrated significant ethnic differences in the distribution of TPMT variant alleles among various ethnic groups (Table 3). TPMT*3A accounts for more than 80% of the variant alleles in Caucasians, but for only approximately 17% of the variant alleles in African-Americans. However, TPMT*3C accounts for only 5% of the variant alleles in Caucasians, 70% in African-Americans and 100% in the Japanese and Chinese. In the present study, we found that TPMT*3C is the ancestral TPMT variant allele in the Egyptian population, accounting for 86% of the variant alleles detected. TPMT*3A is the second most recurrent variant and accounts for the remaining 14% of the TPMT variant alleles in Egyptian individuals.
The frequency of TPMT*3C found in the present study (0.013) is similar (P > 0.05) to the frequencies reported for Caucasians (0.002–0.010) [22–25], Saami-Norwegian (0.033) [25] and Asian populations (0.015–0.023) [26, 27], but significantly lower than the frequencies reported for Kenyan (0.054) [23] (P < 0.005) and Ghanaian (0.076) [28] (P < 0.0001) populations. In vivo studies [19] indicate that homozygosity for TPMT*3C impairs metabolism of thiopurine drugs, possibly due to the intrinsic instability of the enzyme compared with that of TPMT*1[29]. Therefore, the six TPMT*3C heterozygote individuals found in the present study may have a decreased capacity to metabolize thiopurine drugs.
TPMT*3A, which causes the largest decrease in enzyme activity [29], was detected in only one Egyptian individual (heterozygote of TPMT*1/TPMT*3A) with an allele frequency of 0.003. Similar low frequencies of TPMT*3A (P > 0.05) were reported for South-west Asians (0.010) [27] and African-Americans (0.008) [22]. However, TPMT*3A was found in significantly higher frequencies (P < 0.0001) in Caucasian populations, including Americans (0.032) [22], British (0.057) [23], French (0.057) [23], Italians (0.039) [24] and Norwegians (0.034) [25].
In conclusion, the present study showed that the Egyptians have a relatively low frequency of TPMT mutant alleles. Only six out of 200 Egyptian individuals (3.00%) carried a variant TPMT allele (TPMT*3A or TPMT*3C). The low frequency of variant TPMT alleles in the Egyptian population infers that the Egyptians may have higher TPMT activity than other Caucasian or African-American populations. This may contribute to both reduced response and also low incidence of toxicity following thiopurine treatment.
Nat2
According to the rich literature regarding the ethnic variation in the distribution of defective NAT2 alleles all over the world [30–36], two major groups could clearly be distinguished according to the incidence of the NAT2*5 and NAT2*7 variants. Caucasians, Indians and Africans are very similar (> 0.290 and < 0.050, respectively). Asiatic and Pacific groups also appear to make up a homogeneous group (< 0.070 and> 0.090, respectively). However, the frequency of the NAT2*6 variant is only slightly different among various populations.
In the present study, we found that NAT2 allele frequencies among the Egyptians were similar to those reported for other Caucasian populations (Table 4). In Egyptians, as in Caucasians, the majority of NAT2 alleles are composed of NAT2*4 (wild type), NAT2*5 and NAT2*6, which were found in our study in frequencies of 0.215, 0.497 and 0.260, respectively. We also found the NAT2*7 variant had a frequency of 0.028. This frequency is in the range of that of the Caucasian-African group (0.003–0.045) and significantly lower (P < 0.0001) than that of the Asiatic group (0.095–0.180) (Table 4).
Table 4.
Allele frequencies of NAT2 in various ethnic groups.
| Allele frequency† | ||||||
|---|---|---|---|---|---|---|
| Population | n | NAT2*4 | NAT2*5 | NAT2*6 | NAT2*7 | Reference |
| Egyptians | 199 | 0.215 | 0.497 | 0.260 | 0.028 | Present study |
| Caucasians | ||||||
| American | 266 | 0.220 | 0.470 | 0.280 | 0.003 | [30, 31] |
| German | 844 | 0.244 | 0.465 | 0.278 | 0.013 | [32] |
| Portuguese | 128 | 0.212 | 0.433 | 0.328 | 0.027 | [33] |
| Danish | 242 | 0.254 | 0.473 | 0.250 | 0.023 | [34] |
| Scottish | 96 | 0.203 | 0.490 | 0.271 | 0.036 | [35] |
| Swedish | 70 | 0.194 | 0.507 | 0.278 | 0.021 | [35] |
| Asians | ||||||
| Japanese | 79 | 0.641 | 0.019 | 0.230 | 0.110 | [31] |
| Hong Kong Chinese | 70 | 0.473 | 0.057 | 0.310 | 0.160 | [31] |
| Korean | 85 | 0.692 | 0.018 | 0.180 | 0.110 | [31] |
| Filipino | 100 | 0.395 | 0.065 | 0.360 | 0.180 | [31] |
| Taiwanese | 100 | 0.515 | 0.025 | 0.310 | 0.150 | [31] |
| Indians | 61 | 0.257 | 0.330 | 0.380 | 0.033 | [31] |
| Polynesians | 25 | 0.600 | 0.040 | 0.340 | 0.020 | [31] |
| Native Africans | ||||||
| Gabonese | 52 | 0.356 | 0.404 | 0.221 | 0.019 | [36] |
| Dogons | 65 | 0.300 | 0.300 | 0.370 | 0.030 | |
| Hispanic-Americans | 65 | 0.390 | 0.320 | 0.190 | 0.100 | [31] |
| African-Americans | 214 | 0.430 | 0.295 | 0.230 | 0.045 | [30, 31] |
n, Number of subjects.
NAT2*4 represent the allele that did not contain any of the mutations analysed in our study, while NAT2*5, NAT2*6 and NAT2*7 represent the alleles that contained 341C, 590A and 857A mutations, respectively.
The predominance of the slow acetylator genotype in Egyptians (60.50%) conforms to findings amongst other populations: 52.60% in Caucasian-Americans, 60.00% in Germans [37], and 63.40% among Polish children [38]. In contrast, in the Japanese, Chinese, Koreans and Filipinos, the fast genotype is largely over-represented (up to 90.00%) [31]. It was reported previously that Egyptians have the highest incidence on record of the slow-acetylator phenotype (92.00%) [39]. However, our results could not confirm this finding, indicating either a difference in the populations studied or the presence of other mutations not detectable as T341C, G590A and G857A.
Gst
The frequency of the GSTM1 null genotype was previously reported in the Egyptian population (44.00% among 34 subjects [17] and 48.00% among 21 subjects [18]). The frequency of the GSTT1 null genotype was also previously reported in the Egyptian population (15.00% among 34 subjects [17]). In the present study we report relatively higher frequencies of both null genotypes (55.50% and 29.50%) for GSTM1 and GSTT1, respectively. This difference may be explained by the larger number of subjects examined in our study (200) compared with the small number of subjects analysed in the other two studies (34 [17] and 21 [18]).
According to our results, the frequency of the GSTM1 null genotype (55.50%) was in the range of Europeans (39.00–62.00%) and White Americans (35.00–62.00%), higher than that of African-Americans (23.00–41.00%), and Japanese (41.00–51.00%). Although the frequency of the GSTT1 null genotype (29.50%) was a little higher than the range of Europeans (10.00–21.00%) and Africans (15.00–26.00%), it was within the range of Caucasian-Americans (10.00–36.00%), and considerably lower than the frequency reported for the Japanese (44.00%). Our data confirmed that Egyptians are similar to other Caucasian populations in the frequency distribution of both GSTM1 and GSTT1 null alleles.
Sult1a1
Fifteen different alleles have been described for the SULT1A1 gene, including four that resulted in alterations in encoded amino acids (the wild-type allele (SULT1A1*1) and SULT1A1*2–*4 variants) [14]. A comparison of the distribution of SULT1A1 alleles between various ethnic groups has been reported previously [40, 41]. The results of those studies showed striking ethnic differences in allele frequencies, with a SULT1A1*1 frequency that was highest in Chinese (0.914) and lowest in African-American subjects (0.477). Conversely, the frequency of the SULT1A1*3 allele was highest in African-Americans (0.299) and lowest in Chinese subjects (0.006). The frequency of the SULT1A1*2 allele did not differ significantly between Caucasians (0.332) and African-Americans (0.294), but it was much lower in Chinese (0.080) than in the other two ethnic groups [41]. The rare allele SULT1A1*4 was only detected in a sample of 150 Caucasian Americans with a frequency of 0.003 [14].
According to our results, the frequency of SULT1A1*2 was 0.135 in Egyptian individuals. Interestingly, this frequency is significantly lower than other frequencies reported in other Caucasian (0.310–0.370) [14, 21, 40, 41], African (0.270) [40] and African-American (0.290) [41] subjects. However, this frequency is significantly higher than that in the Chinese group (0.080) [41] (P-values are listed in Table 5). Our data support the need for further investigation about this different pattern in the frequencies of the SULT1A1*2 variant in the Egyptian population.
Table 5.
Allele frequencies of SULT1A1 in various ethnic groups.
| Allele frequency | |||||
|---|---|---|---|---|---|
| Population | n | *Arg | *His | P vs. Egyptian | Reference |
| Egyptians† | 200 | 0.865 | 0.135 | Present study | |
| Caucasians | |||||
| American‡ | 150 | 0.690 | 0.310 | <0.0001 | [14] |
| American‡ | 245 | 0.670 | 0.330 | <0.0001 | [41] |
| German† | 300 | 0.630 | 0.370 | <0.0001 | [21] |
| British† | 106 | 0.680 | 0.320 | <0.0001 | [40] |
| Scottish† | 187 | 0.680 | 0.320 | <0.0001 | [40] |
| Asians | |||||
| Chinese‡ | 290 | 0.914 | 0.080 | 0.0018 | [41] |
| Africans | |||||
| Nigerian† | 52 | 0.730 | 0.270 | 0.0031 | [40] |
| African-Americans‡ | 70 | 0.710 | 0.290 | <0.0001 | [41] |
n, Number of subjects. (Differences in allele frequencies were measured using Fisher's exact test.)
These studies were designed to detect only SULT1A1*2, so carriers of *3 or *4 alleles may be scored as carriers of SULT1A1*1 or *2.
These studies were designed to detect either *2 and *3 or *2,*3and*4. For this table, the common allele SULT1A1*1 and the rare alleles *3 and *4 were combined with the allele SULT1A1*1 and assigned as *Arg.
Mdr-1
Although PGP expression is highly variable between subjects, the molecular basis for this variation was not clear until recently, when a functional single nucleotide polymorphism (SNP) resulting in a C to T transition (C3435T) was described in exon 26 of the MDR-1 gene [16]. Strikingly, there was a significant relationship of this silent SNP with intestinal PGP expression levels and oral bioavailability of digoxin. Individuals who were homozygous for the 3435T variant had significantly decreased intestinal PGP expression and increased digoxin plasma levels after oral administration [16].
Our result from genotyping of 200 subjects for the C3435T mutation showed genotype frequencies of 34.00%, 51.50%, and 14.50% for C/C, C/T and T/T, respectively. The frequencies of the C-allele (0.600) and the wild-type C/C (34.00%) in Egyptian subjects were similar (P > 0.05) to Saudi Arabians (0.550 and 32.00%, respectively) [42], possibly due to the common Arabic origin of the two populations. However, the frequency of the C-allele in Egyptian subjects (0.600) was significantly different from in Caucasian populations, including the British (0.480), Portuguese (0.430) and Germans (0.520) [42]. It was also different from the South Asian population (0.340), Africans (0.170–0.270) and African-Americans (0.160) [42] (P-values are listed in Table 6). Interestingly, the frequency of the C-allele in Egyptian subjects (0.600) did not differ from that reported in Oriental Asian populations including Japanese (0.570) [43], Chinese (0.530) and Filipinos (0.590) [42].
In conclusion, our results of genotyping Egyptian individuals for important allelic variants of TPMT, NAT2, GST, SULT1A1 and MDR-1 provide further evidence for racial heterogeneity in drug metabolism and disposition. It is hoped that our results will aid in understanding the ethnic diversity of the Egyptian population, and offer a preliminary basis for more rational use of drugs that are substrates for TPMT, NAT2, GST, SULT1A1 and MDR-1 in this population.
It should be noted that in the present study we have focused on genotyping Egyptian individuals for important allelic variants previously reported in other ethnic groups, providing the first description of these alleles in the Egyptian population. This does not exclude the possibility of the presence of new SNPs relatively unique to the Egyptian population, which is exemplified by the discordance between NAT2 phenotype and genotype in this population, and which will be the main focus of our future studies.
References
- 1.Evans WE, Relling MV. Pharmacogenomics: translating functional genomics into rational therapeutics. Science. 1999;286:487–491. doi: 10.1126/science.286.5439.487. [DOI] [PubMed] [Google Scholar]
- 2.Krynetski EY, Tai HL, Yates CR, et al. Genetic polymorphism of thiopurine S-methyltransferase: clinical importance and molecular mechanisms. Pharmacogenetics. 1996;6:279–290. doi: 10.1097/00008571-199608000-00001. [DOI] [PubMed] [Google Scholar]
- 3.Evans WE, Horner M, Chu YQ, Kalwinsky D, Roberts WM. Altered mercaptopurine metabolism, toxic effects, and dosage requirement in a thiopurine methyltransferase-deficient child with acute lymphoblastic leukemia. J Pediatr. 1991;119:985–989. doi: 10.1016/s0022-3476(05)83063-x. [DOI] [PubMed] [Google Scholar]
- 4.McLeod HL, Lin JS, Scott EP, Pui CH, Evans WE. Thiopurine methyltransferase activity in American white subjects and black subjects. Clin Pharmacol Ther. 1994;55:15–20. doi: 10.1038/clpt.1994.4. [DOI] [PubMed] [Google Scholar]
- 5.Evans DAP. N-Acetyltransferase. Pharmacol Ther. 1989;42:157–234. doi: 10.1016/0163-7258(89)90036-3. [DOI] [PubMed] [Google Scholar]
- 6.Evans DAP, White TA. Human acetylation polymorphism. J Lab Clin Med. 1964;63:394–403. [PubMed] [Google Scholar]
- 7.Weber WW, Hein DW. N-acetylation pharmacogenetics. Pharmacol Rev. 1985;37:25–79. [PubMed] [Google Scholar]
- 8.Nebert DW, Weber WW. Pharmacogenetics. In: Pratt WB, Taylor PW, editors. Principles of drug actions: the basis of pharmacology. 3. New York: Churchill Livingstone Inc.; 1990. pp. 469–531. , eds. [Google Scholar]
- 9.Ketterer B, Chirstodoulides LG. Enzymology of cystolic glutathione S-transferase. Adv Pharmacol. 1994;27:37. doi: 10.1016/s1054-3589(08)61029-7. [DOI] [PubMed] [Google Scholar]
- 10.Cotton SC, Sharp L, Little J, Brockton N. Glutathione S-transferase polymorphisms and colorectal cancer: a huge review. Am J Epidemiol. 2000;151:7–32. doi: 10.1093/oxfordjournals.aje.a010124. [DOI] [PubMed] [Google Scholar]
- 11.Falany CN. Enzymology of human cystolic sulfotransferases. FASEB J. 1997;11:206–216. doi: 10.1096/fasebj.11.4.9068609. [DOI] [PubMed] [Google Scholar]
- 12.Price RA, Spielman RS, Lucena AL, Van Loon JA, Weinshilboum RM. Genetic polymorphism for human platelet thermostable phenol sulfotransferase (TS PST) activity. Genetics. 1989;122:905–914. doi: 10.1093/genetics/122.4.905. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Weinshilboum RM, Otterness DM, Akosy IA, Wood TC, Her C, Raftogianis RB. Sulfation and sulfotransferases I. Sulfotransferase molecular biology: cDNAs and genes. FASEB J. 1997;11:3–14. [PubMed] [Google Scholar]
- 14.Raftogianis RB, Wood TC, Otterness DM, Van Loon JA, Weinshilboum RM. Phenol sulfotransferase pharmacogenetics in humans: association of common SULT1A1 alleles with TS PST phenotype. Biochem Biophys Res Commun. 1997;239:298–304. doi: 10.1006/bbrc.1997.7466. [DOI] [PubMed] [Google Scholar]
- 15.Gottesman MM, Hrycyna CA, Schoenlein PV, German UA, Pastan I. Genetic analysis of the multidrug transporter. AM Rev Genet. 1995;29:607–649. doi: 10.1146/annurev.ge.29.120195.003135. [DOI] [PubMed] [Google Scholar]
- 16.Hoffmeyer S, Burk O, von Richter O, et al. Functional polymorphisms of the human multidrug-resistance gene: multiple sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo. Proc Natl Acad Sci USA. 2000;97:3473–3478. doi: 10.1073/pnas.050585397. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Abdel-Rahman SZ, El-Zein RA, Anwar WA, et al. A multiplex PCR procedure for polymorphic analysis of GSTM1 and GSTT1 genes in population studies. Cancer Lett. 1996;107:229–233. doi: 10.1016/0304-3835(96)04832-x. [DOI] [PubMed] [Google Scholar]
- 18.Anwar WA, Abdel-Rahman SZ, El-Zein RA, Mostafa HM, Au WW. Genetic polymorphism of GSTM1, CYP2E1 and CYP2D6 in Egyptian bladder cancer patients. Carcinogenesis. 1996;17:1923–1929. doi: 10.1093/carcin/17.9.1923. [DOI] [PubMed] [Google Scholar]
- 19.Yates CR, Krynetski EY, Loennechen T, et al. Molecular diagnosis of thiopurine methyltransferase deficiency: genetic basis for azathioprine and mercaptopurine intolerance. Ann Intern Med. 1997;126:608–614. doi: 10.7326/0003-4819-126-8-199704150-00003. [DOI] [PubMed] [Google Scholar]
- 20.Hiratsuka M, Agatsuma Y, Omori F, et al. High throughput detection of drug-metabolizing enzyme polymorphisms by allele-specific fluorogenic 5′ nuclease chain reaction assay. Biol Pharm Bull. 2000;23:1131–1135. doi: 10.1248/bpb.23.1131. [DOI] [PubMed] [Google Scholar]
- 21.Engelke CEH, Meinl W, Boeing H, Glatt H. Association between functional genetic polymorphisms of human sulfotransferases 1A1 and 1A2. Pharmacogenetics. 2000;10:163–169. doi: 10.1097/00008571-200003000-00008. [DOI] [PubMed] [Google Scholar]
- 22.Hon YY, Fessing MY, Pui C-H, Relling MV, Krynetski EY, Evans WE. Polymorphism of the thiopurine S-methyltransferase gene in African-Americans. Hum Mol Genet. 1999;8:371–376. doi: 10.1093/hmg/8.2.371. [DOI] [PubMed] [Google Scholar]
- 23.Mcleod HL, Prichard SC, Githang’a J, et al. Ethnic differences in thiopurine methyltranseferase pharmacogenetics: evidence for allele specificity in Caucasian and Kenyan individuals. Pharmacogenetics. 1999;9:773–776. doi: 10.1097/00008571-199912000-00012. [DOI] [PubMed] [Google Scholar]
- 24.Rossi AM, Bianchi M, Guarnieri C, Barale R, Pacifici GM. Genotype–phenotype correlation for thiopurine S-methyltransferase in healthy Italian subjects. Eur J Clin Pharmacol. 2001;57:51–54. doi: 10.1007/s002280000246. [DOI] [PubMed] [Google Scholar]
- 25.Loennechen T, Utsi E, Hartz I, Lysaa R, Kildalsen H, Aarabakke J. Detection of one single mutation predicts thiopurine S-methyltransferase activity in a population of Saami in northern Norway. Clin Pharmacol Ther. 2001;70:183–188. doi: 10.1067/mcp.2001.117445. [DOI] [PubMed] [Google Scholar]
- 26.Hiratsuka M, Inoue T, Omori F, Agatsuma Y, Mizugaki M. Genetic analysis of thiopurine methyltransferase in a Japanese population. Mutat Res. 2000;448:91–95. doi: 10.1016/s0027-5107(00)00004-x. [DOI] [PubMed] [Google Scholar]
- 27.Collie-Dugguid ESR, Prichard SC, Powrie RH, et al. The frequency and distribution of thiopurine methyltransferase alleles in Caucasian and Asian populations. Pharmacogenetics. 1999;9:37–42. doi: 10.1097/00008571-199902000-00006. [DOI] [PubMed] [Google Scholar]
- 28.Ameyaw MM, Collie-Dugguid ESR, Powrie RH, Ofori-Adjei D, Mcleod HL. Thiopurinemethyltransferase alleles in British and Ghanaian populations. Hum Mol Genet. 1999;8:367–370. doi: 10.1093/hmg/8.2.367. [DOI] [PubMed] [Google Scholar]
- 29.Tai HL, Krynetski EY, Yates CR, et al. Thiopurine S-methyltransferase deficiency: two nucleotide transitions defines the most prevalent mutant allele associated with loss of catalytic activity in Caucasians. Am J Hum Genet. 1996;58:694–702. [PMC free article] [PubMed] [Google Scholar]
- 30.Bell DA, Taylor JA, Butler MA, et al. Genotype/phenotype discordance for human arylamine N-acetyltransferase (NAT2) reveals a new slow-acetylator allele common in African-Americans. Carcinogenesis. 1993;14:1689–1692. doi: 10.1093/carcin/14.8.1689. [DOI] [PubMed] [Google Scholar]
- 31.Lin HJ, Han CY, Lin BK, Hardy S. Ethnic distribution of slow-acetylator mutations in the polymorphic N-acetyltransferase (NAT2) gene. Pharmacogenetics. 1994;4:125–134. doi: 10.1097/00008571-199406000-00003. [DOI] [PubMed] [Google Scholar]
- 32.Cascorbi I, Drakoulis N, Brockmöller J, Maurer A, Sperling K, Roots I. Arylamine N-acetyltransferase (NAT2) mutations and their allelic linkage in unrelated Caucasian individuals: correlation with phenotypic activity. Am J Hum Genet. 1995;57:581–592. [PMC free article] [PubMed] [Google Scholar]
- 33.Lemos MC, Regateiro FJ. N-acetyltransferase genotypes in the Portuguese population. Pharmacogenetics. 1998;8:125–134. doi: 10.1097/00008571-199812000-00013. [DOI] [PubMed] [Google Scholar]
- 34.Okkels H, Sigsgaard T, Wolf H, Autrup H. Aryl N-acetyltransferase1 (NAT1) and 2 (NAT2) polymorphisms in susceptibility to bladder cancer: the influence of smoking. Cancer Epidemiol Biomarker Prev. 1997;6:225–231. [PubMed] [Google Scholar]
- 35.Smith CAD, Wadelius M, Gough AC, Harrison DJ, Wolf CR, Rane A. A simplified assay for the arylamine N-acetyltransferase 2 polymorphism validated by phenotyping with isoniazid. J Med Genet. 1997;34:758–760. doi: 10.1136/jmg.34.9.758. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Delomenie C, Sica L, Grant DM, Krishnamoorthy R, Dupret J-M. Genotyping of the polymorphic N-acetyltransferase (NAT2*) gene locus in two native African populations. Pharmacogenetics. 1996;6:177–185. doi: 10.1097/00008571-199604000-00004. [DOI] [PubMed] [Google Scholar]
- 37.Lin HJ, Han C-Y, Lin BK, Hardy S. Slow acetylator mutations in the human polymorphic N-acetyltransferase gene in 786 Asians, blacks, Hispanics and whites: application to metabolic epidemiology. Am J Hum Genet. 1993;52:827–834. [PMC free article] [PubMed] [Google Scholar]
- 38.Mrozikiewicz PM, Drakoulis N, Roots I. Polymorphic arylamine N-acetyltransferase (NAT2) genes in children with insulin-dependent diabetes mellitus. Clin Pharma Ther. 1994;56:626–634. doi: 10.1038/clpt.1994.187. [DOI] [PubMed] [Google Scholar]
- 39.Hashem N, Khalifa S, Nour A. The frequency of isoniazid acetylase enzyme deficiency among Egyptians. Am J Phys Anthrop. 1969;31:97–102. doi: 10.1002/ajpa.1330310114. [DOI] [PubMed] [Google Scholar]
- 40.Coughtrie MWH, Glissen RAHJ, Shek B, et al. Phenol sulfotransferase SULT1A1 polymorphism: molecular diagnosis and allele frequencies in Caucasian and African populations. Biochem J. 1999;337:45–49. [PMC free article] [PubMed] [Google Scholar]
- 41.Carlini EJ, Raftogianis RB, Wood TC, et al. Sulfation pharmacogenetics: SULT1A1 and SULT1A2 allele frequencies in Caucasian, Chinese and African-American subjects. Pharmacogenetics. 2001;11:57–68. doi: 10.1097/00008571-200102000-00007. [DOI] [PubMed] [Google Scholar]
- 42.Ameyaw M, Regateiro F, Li T, et al. MDR1 pharmacogenetics: frequency of the C3435T mutation in exon 26 is significantly influenced by ethnicity. Pharmacogenetics. 2001;11:217–221. doi: 10.1097/00008571-200104000-00005. [DOI] [PubMed] [Google Scholar]
- 43.Schaeffeler E, Eichelbaum M, Brinkmann U, et al. Frequency of C3435T polymorphism of MDR1 gene in African people. Lancet. 2001;358:383–384. doi: 10.1016/S0140-6736(01)05579-9. [DOI] [PubMed] [Google Scholar]