Abstract
Clinical isolates of Acinetobacter baumannii (n = 470) were collected during a 7-year period and investigated for the genetic determinants of resistance to expanded-spectrum β-lactams. Thirty-one isolates produced the TEM-92 extended-spectrum β-lactamase (ESBL) and were clonally related. This is the first report of A. baumannii producing a TEM-type ESBL.
Acinetobacter baumannii has emerged as a significant opportunistic pathogen responsible of nosocomial infections (11). Treatment of infections due to this organism is becoming a serious clinical concern, primarily because A. baumannii is frequently resistant to multiple classes of antibiotics (18, 25). Expression of chromosomal Acinetobacter-derived cephalosporinases (ADC) and production of other β-lactamases, especially of class D, can confer resistance to expanded-spectrum β-lactams and β-lactam β-lactamase inhibitor combinations (1, 9, 25). Isolates of A. baumannii producing different extended-spectrum β-lactamases (ESBLs) have been reported worldwide: PER-1 in Belgium, France, Turkey, and Korea (13, 20, 24, 26); PER-2 in Argentina (17); VEB-1 in Belgium, Argentina, and France (2, 13, 17, 21); SHV-12 in China (8); and CTX-M-type enzymes in Bolivia and Japan (3, 14). To our knowledge, TEM-type ESBLs have not yet been reported in A. baumannii (1, 25).
This study was initiated to investigate ESBL genes in clinical isolates of A. baumannii obtained at the Ospedale di Circolo (Varese, Italy) during a 7-year period (1999 to 2005). From 1999 to 2002, identification and antimicrobial susceptibility tests were performed with the Sceptor System (Becton Dickinson Diagnostic Systems, Sparks, MD); from 2003 onward, the Phoenix System (Becton Dickinson) was used. As shown in Table 1, 470 nonreplicated isolates of A. baumannii (286 from inpatients and 184 from outpatients) were collected. Isolates were frequently derived from the urinary (37.7%) and lower respiratory (30.0%) tracts. Hospital isolates were obtained from medical (50.7%), surgical (18.9%), and intensive care unit patients (30.4%). On the whole, 119/470 isolates (25.3%) exhibited a MIC of ≥16 μg/ml for ceftazidime and/or cefotaxime. The latter isolates were stored at −80°C, and their identifications were confirmed using ID32GN strips (bioMérieux, Marcy L'Étoile, France).
TABLE 1.
Epidemiology of Acinetobacter baumannii isolates from 1999 to 2005 from both inpatients and outpatients
| Source or characteristic of isolates | No. of isolates (%) from yr:
|
||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1999
|
2000
|
2001
|
2002
|
2003
|
2004
|
2005
|
Total 7-yr period
|
||||||||||
| INPa | OUTPb | INP | OUTP | INP | OUTP | INP | OUTP | INP | OUTP | INP | OUTP | INP | OUTP | INP | OUTP | Total | |
| A. baumannii isolates | 60 | 16 | 35 | 20 | 49 | 35 | 50 | 33 | 35 | 38 | 30 | 29 | 27 | 13 | 286 | 184 | 470 |
| Urinary tract infection | 25 (41.7) | 10 (62.5) | 9 (25.7) | 10 (50.0) | 18 (36.7) | 19 (54.3) | 12 (24.0) | 16 (48.5) | 6 (17.1) | 21 (55.3) | 4 (13.3) | 13 (44.8) | 6 (22.2) | 8 (61.5) | 80 (30.0) | 97 (52.7) | 177 (37.7) |
| Lower respiratory tract infection | 22 (36.7) | 1 (6.3) | 17 (48.6) | 6 (30.0) | 16 (32.7) | 4 (11.4) | 24 (48.0) | 2 (6.1) | 17 (48.6) | 4 (10.5) | 9 (30.0) | 3 (10.3) | 15 (55.6) | 1 (7.7) | 120 (42.0) | 21 (11.4) | 141 (30.0) |
| Soft tissue infection | 4 (6.7) | 3 (18.8) | 1 (2.9) | 1 (5.0) | 3 (6.1) | 9 (25.7) | 3 (6.0) | 10 (30.3) | 2 (5.7) | 11 (28.9) | 5 (16.7) | 11 (37.9) | 1 (3.7) | 4 (30.8) | 19 (6.6) | 49 (26.6) | 68 (14.5) |
| Wound infection | 1 (1.7) | 0 (0.0) | 4 (11.4) | 0 (0.0) | 8 (16.3) | 0 (0.0) | 4 (8.0) | 0 (0.0) | 6 (17.1) | 0 (0.0) | 4 (13.3) | 0 (0.0) | 1 (3.7) | 0 (0.0) | 28 (9.8) | 0 (0.0) | 28 (6.0) |
| Bloodstream infection | 2 (3.3) | 0 (0.0) | 1 (2.9) | 0 (0.0) | 1 (2.0) | 0 (0.0) | 3 (6.0) | 0 (0.0) | 2 (5.7) | 0 (0.0) | 1 (3.3) | 0 (0.0) | 1 (3.7) | 0 (0.0) | 11 (3.8) | 0 (0.0) | 11 (2.3) |
| Vascular catheter colonization | 4 (6.7) | 0 (0.0) | 1 (2.9) | 0 (0.0) | 1 (2.0) | 0 (0.0) | 1 (2.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 7 (2.4) | 0 (0.0) | 7 (1.5) |
| Other | 4 (6.7) | 2 (12.5) | 2 (5.7) | 3 (15.0) | 2 (2.0) | 3 (8.6) | 3 (6.0) | 5 (15.2) | 2 (5.7) | 2 (5.3) | 7 (23.3) | 2 (6.9) | 3 (11.1) | 0 (0.0) | 21 (7.3) | 17 (9.2) | 38 (8.1) |
| CAZ- and/or CTX-resistantc isolates | 19 (31.7) | 1 (6.3) | 10 (28.6) | 1 (5.0) | 13 (26.5) | 1 (2.9) | 19 (38.0) | 7 (21.2) | 12 (34.3) | 6 (15.8) | 4 (13.3) | 5 (17.2) | 17 (63.0) | 4 (30.8) | 94 (32.9) | 25 (13.6) | 119 (25.3) |
| ESBL-TEM-92-positive isolates | 8 (13.3) | 0 (0.0) | 2 (5.7) | 0 (0.0) | 6 (12.2) | 1 (2.9) | 9 (18.0) | 2 (6.1) | 1 (2.9) | 1 (2.6) | 0 (0.0) | 1 (5.0) | 0 (0.0) | 0 (0.0) | 26 (9.1) | 5 (2.7) | 31 (6.6) |
| Imipenem-resistantd isolates | 1 (1.7) | 0 (0.0) | 2 (5.7) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 7 (20.0) | 0 (0.0) | 0 (0.0) | 1 (3.4) | 6 (22.2) | 0 (0.0) | 16 (5.6) | 1 (0.5) | 17 (3.6) |
The following assays used to evaluate ESBL production in enterobacteria were performed: (i) the double-disk synergy test (10) on Mueller-Hinton agar plates with disks containing 30 μg of aztreonam, ceftazidime, cefotaxime, or cefepime and placed at a 20-mm distance (center to center) from a disk containing amoxicillin (20 μg) plus clavulanate (10 μg); (ii) the disk diffusion test on Mueller-Hinton agar plates with disks containing 30 μg of ceftazidime, cefotaxime, cefpodoxime, or cefpirome alone and in combination with clavulanate. A ≥5 mm increase of a zone diameter for either antimicrobial agent tested in combination with clavulanate versus its zone when tested alone was considered positive (4).
Synergistic activity between expanded-spectrum β-lactams and clavulanate was shown by both methods in 31/119 isolates. Of these, 26/31 were obtained from hospitalized patients (medical [n = 14], surgical [n = 7], and intensive care unit [n = 5] wards], and 5/31 were from outpatients who had been hospitalized at our institution during the preceding 12 months. The 31 investigated A. baumannii isolates showed a similar resistance phenotype (Etest; AB Biodisk, Solna, Sweden). MICs are shown in Table 2.
TABLE 2.
MICs of 31 Acinetobacter baumannii isolates producing the TEM-92 ESBL
| Drug | Susceptibilitya | MIC (μg/ml) (range) |
|---|---|---|
| Amikacin | S | ≤8 (4-8) |
| Gentamicin | R | >128 |
| Tobramycin | R | >32 |
| Ciprofloxacin | R | >32 |
| Levofloxacin | R | >32 |
| Piperacillin | R | >128 |
| Piperacillin-tazobactam | S | ≤2/4 (1/4-2/4) |
| Ampicillin-sulbactam | S | ≤2/1 (1/0.5-2/1) |
| Ceftriaxone | R | >128 |
| Ceftazidime | R | >128 |
| Cefotaxime | R | >128 |
| Cefepime | R | >128 |
| Aztreonam | R | >128 |
| Imipenem | S | ≤1 (0.5-1) |
| Meropenem | S | ≤2 (1-2) |
S, susceptible; R, resistant (according to CLSI methods [4]).
The 31 isolates demonstrating an ESBL phenotype were further studied by biochemical and molecular assays. Isoelectric focusing, performed as described previously (15), showed two β-lactamase bands common to all 31 isolates: the first at a pI of ∼9.0, generally associated with the expression of the chromosomal ADC enzymes, the second at a pI of 5.9, consistent with the expression of a TEM-type enzyme. The presence of the blaADC gene was confirmed by PCR amplification (9). Genes encoding ESBLs (TEM, SHV, PER, VEB, and CTX-M type) were searched for by PCR as described previously (13, 16, 19). All isolates yielded a blaTEM amplification product. Sequencing on both strands of the PCR product (6) revealed that all isolates carried a blaTEM allele encoding the TEM-92 ESBL (5).
By pulsed-field gel electrophoresis analysis using the ApaI restriction enzyme (23), the profiles of all TEM-92-positive isolates were identical. Investigated strains were different from the TEM-92-negative Acinetobacter strains isolated at our hospital during the same period (Fig. 1 and data not shown). The genetic context of the blaTEM-92 gene was investigated by PCR mapping experiments, using the primers designed on the Tn3 transposon sequence (Table 3). Results of experiments carried out with the index isolate (VA-239/99) and with additional isolates collected at later stages of the investigated period (VA-234/02 and VA-157/03) showed that the blaTEM-92 gene was always associated with a Tn3-like transposon. Interestingly, an IS26 sequence was inserted into the tnpR gene of the transposon (named Tn6004) from the index isolate. This IS26 was absent from the transposons collected at a later stage (Fig. 2). Based on these findings, it is speculated that blaTEM-92 was initially acquired by the Acinetobacter strain as part of Tn6004, from which IS26 could have subsequently been excised. However, an independent acquisition of the two types of Tn3-like elements carrying blaTEM-92 cannot be excluded.
FIG. 1.
Macrorestriction profile of ApaI-digested chromosomal DNA of the Acinetobacter baumannii index isolate VA-239/99 (lane 4). Profiles of TEM-92-negative A. baumannii isolates obtained during the investigated period are shown for comparison (lane 2, VA-804/03; lane 3, VA-817/05; lane 5, VA-834/03).
TABLE 3.
Oligonucleotide primers used for PCR mapping and sequencing of the Tn3-like elements carrying the blaTEM-92 gene
| Primer no. | Primer name | Sequence (5′-3′) |
|---|---|---|
| 1 | IR tn1-3 | TGACGCTCAGTGGAACGAA |
| 2 | tnpA-tn3/F | GCATGTTCGTACCTGCTGA |
| 3 | tnpA-tn3/R | TCAGCAGGTACGAACATGC |
| 4 | tnpR-tn3/F | CCAGTCAGCAGTCTCTTGA |
| 5 | tnpR-tn3/R | GGCAATACTGAGCTGATGAG |
| 6 | IS15/26 | CCACCATCAAAGGTATTGAG |
| 7 | pFOR-TEM | ATAAAATTCTTGAAGACGAA |
| 8 | Rev-TEM | ATATGAGTAAGCTTGGTCTGACAG |
FIG. 2.
(A) Structure of the Tn3-like elements carrying the blaTEM-92 ESBL gene and PCR mapping strategy. The locations of primers (numbered as reported in Table 3) are shown by arrows. PCR products generated to map the elements are indicated by thin lines. (B) Detail of the insertion site of IS26 into the tnpR gene in Tn6004. Numbering refers to tnpR. The 8-bp target site duplication is underlined.
Matings between A. baumannii VA-239/99 and Escherichia coli J53-2 (Rifr) were carried out overnight at 37°C in LB broth (22). The conjugation experiments failed to result in the transfer of the ESBL determinant when ceftazidime (10 μg/ml) was used for selection. The negative transfer result suggests that the TEM-92 ESBL gene carried by the A. baumannii strain was either inserted in the chromosome or carried by a nonconjugative plasmid.
This is the first report of A. baumannii isolates producing a TEM-type ESBL. The TEM-92 determinant was possibly acquired from TEM-92-producing Enterobacteriaceae which has been shown to be prevalent at our institution since the late 1990s (6, 12).
As reported with regard to clonally related PER-1- and VEB-1-positive A. baumannii isolates (2, 21, 24, 26), the investigated TEM-92-producing strains were shown to persist at our institution over a long period of time (1999 to 2004). The results obtained with genotyping methods suggested the genetic stability of these A. baumannii isolates that showed a classical multidrug-resistant pattern (18). Only amikacin, ampicillin-sulbactam, piperacillin-tazobactam, and carbapenems maintained their in vitro activity. Though ESBL-positive isolates were not observed during 2005 (Table 1), detection of ceftazidime- and/or cefotaxime-resistant A. baumannii strains increased during the study period (from 31.7% in 1999 to 63% in 2005 [inpatients]). Imipenem-resistant isolates also increased from 1.7% in 1999 to 22.2% in 2005.
The detection of A. baumannii possessing TEM-92 in the hospital setting is of interest due to the increasing relevance of this multidrug-resistant pathogen (7, 11). It will be important to determine if ESBL production in A. baumannii has an impact on clinical outcome.
Acknowledgments
This work was supported by a Merit Review Award and NIH grant R01AI063517-01 (to R.A.B.) and by FAR and PRIN-2004 grants (to A.T.) and a PRIN-2005 grant (to G.M.R.) from the Ministry of Education and University (MIUR, Rome, Italy).
Footnotes
Published ahead of print on 2 April 2007.
REFERENCES
- 1.Bonomo, R. A., and D. Szabo. 2006. Mechanisms of multidrug-resistance in Acinetobacter species and Pseudomonas aeruginosa. Clin. Infect. Dis. 43:S49-S56. [DOI] [PubMed] [Google Scholar]
- 2.Carbonne, A., T. Naas, K. Blanckaert, C. Couzigou, C. Cattoen, J.-L. Chagnon, P. Nordmann, and P. Astagneau. 2005. Investigation of a nosocomial outbreak of extended-spectrum β-lactamase in a hospital setting. J. Hosp. Infect. 60:14-18. [DOI] [PubMed] [Google Scholar]
- 3.Celenza, G., C. Pellegrini, M. Caccamo, B. Segatore, G. Amicosante, and M. Perilli. 2006. Spread of blaCTX-M-type and blaPER-2 β-lactamase genes in clinical isolates from Bolivian hospitals. J. Antimicrob. Chemother. 57:975-978. [DOI] [PubMed] [Google Scholar]
- 4.Clinical and Laboratory Standards Institute. 2006. Performance standards for antimicrobial susceptibility testing; 16th informational supplement. CLSI document M100-S16. Clinical and Laboratory Standards Institute, Wayne, PA.
- 5.de Champs, C., C. Monne, R. Bonne, W. Sougakoff, D. Sirot, C. Chanal, and J. Sirot. 2001. New TEM variant (TEM-92) produced by Proteus mirabilis and Providencia stuartii isolates. Antimicrob. Agents Chemother. 45:1278-1280. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Endimiani, A., F. Luzzaro, G. Brigante, M. Perilli, G. Lombardi, G. Amicosante, G. M. Rossolini, and A. Toniolo. 2005. Proteus mirabilis bloodstream infection: risk factors and treatment outcome related to the expression of extended-spectrum β-lactamases. Antimicrob. Agents Chemother. 49:2598-2605. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Falagas, M. E., I. A. Bliziotis, and I. I. Siempos. 2006. Attributable mortality of Acinetobacter baumannii in critically ill patients: a systematic review of matched cohort and case-control studies. Crit. Care 10:R48. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Huang, Z. M., P. H. Mao, Y. Chen, L. Wu, and J. Wu. 2004. Study on the molecular epidemiology of SHV type β-lactamase-encoding genes of multiple-drug-resistant Acinetobacter baumannii. Zhonghua Liu Xing Bing Xue Za Zhi 25:425-427. [PubMed] [Google Scholar]
- 9.Hujer, K. M., N. S. Hamza, A. M. Hujer, F. Perez, M. S. Helfand, C. R. Bethel, J. M. Thomson, V. E. Anderson, M. Barlow, L. B. Rice, F. C. Tenover, and R. A. Bonomo. 2005. Identification of a new allelic variant of the Acinetobacter baumannii cephalosporinase, ADC-7 β-lactamase: defining a unique family of class C enzymes. Antimicrob. Agents Chemother. 49:2941-2948. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Jarlier, V., M. H. Nicolas, G. Fournier, and A. Philippon. 1988. Extended broad-spectrum β-lactamases conferring transferable resistance to newer β-lactam agents in Enterobacteriaceae: hospital prevalence and susceptibility patterns. Rev. Infect. Dis. 10:867-878. [DOI] [PubMed] [Google Scholar]
- 11.Joly-Guillou, M. L. 2005. Clinical impact and pathogenicity of Acinetobacter. Clin. Microbiol. Infect. 11:868-873. [DOI] [PubMed] [Google Scholar]
- 12.Luzzaro, F., M. Perilli, G. Amicosante, G. Lombardi, R. Belloni, A. Zollo, C. Bianchi, and A. Toniolo. 2001. Properties of multidrug-resistant, ESBL-producing Proteus mirabilis isolates and possible role of β-lactam/β-lactamase inhibitor combinations. Int. J. Antimicrob. Agents 17:131-135. [DOI] [PubMed] [Google Scholar]
- 13.Naas, T., P. Bogaerts, C. Bauraing, Y. Degheldre, Y. Glupczynski, and P. Nordmann. 2006. Emergence of PER and VEB extended-spectrum β-lactamases in Acinetobacter baumannii in Belgium. J. Antimicrob. Chemother. 58:172-182. [DOI] [PubMed] [Google Scholar]
- 14.Nagano, N., Y. Nagano, C. Cordevant, N. Shibata, and Y. Arakawa. 2004. Nosocomial transmission of CTX-M-2 β-lactamase-producing Acinetobacter baumannii in a neurosurgery ward. J. Clin. Microbiol. 42:3978-3984. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Pagani, L., F. Luzzaro, P. Ronza, A. Rossi, P. Micheletti, F. Porta, and E. Romero. 1994. Outbreak of extended-spectrum β-lactamase producing Serratia marcescens in an intensive care unit. FEMS Immunol. Med. Microbiol. 10:39-46. [DOI] [PubMed] [Google Scholar]
- 16.Pagani, L., E. Dell'Amico, R. Migliavacca, M. M. D'Andrea, E. Giacobone, G. Amicosante, E. Romero, and G. M. Rossolini. 2003. Multiple CTX-M-type extended-spectrum β-lactamases in nosocomial isolates of Enterobacteriaceae from a hospital in Northern Italy. J. Clin. Microbiol. 41:4264-4269. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Pasterán, F., M. Rapoport, A. Petroni, D. Faccone, A. Corso, and M. Galas. 2006. Emergence of PER-2 and VEB-1a in Acinetobacter baumannii strains in the Americas. Antimicrob. Agents Chemother. 50:3222-3224. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Paterson, D. L. 2006. The epidemiological profile of infections with multidrug-resistant Pseudomonas aeruginosa and Acinetobacter species. Clin. Infect. Dis. 43:S43-S48. [DOI] [PubMed] [Google Scholar]
- 19.Perilli, M., E. Dell'Amico, B. Segatore, M. R. De Massis, C. Bianchi, F. Luzzaro, G. M. Rossolini, A. Toniolo, G. Nicoletti, and G. Amicosante. 2002. Molecular characterization of extended-spectrum β-lactamases produced by nosocomial isolates of Enterobacteriaceae from an Italian nationwide survey. J. Clin. Microbiol. 40:611-614. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Poirel, L., A. Karim, A. Mercat, I. Le Thomas, H. Vahaboglu, C. Richard, and P. Nordmann. 1999. Extended-spectrum β-lactamase-producing strain of Acinetobacter baumannii isolates from a patient in France. J. Antimicrob. Chemother. 43:157-158. [PubMed] [Google Scholar]
- 21.Poirel, L., O. Menuteau, N. Agoli, C. Cattoen, and P. Nordmann. 2003. Outbreak of extended-spectrum β-lactamase VEB-1-producing isolates of Acinetobacter baumannii in a French hospital. J. Clin. Microbiol. 41:3542-3547. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Rice, L. B., and R. A. Bonomo. 2005. Genetic and biochemical mechanisms of bacterial resistance to antimicrobial agents, p. 441. In V. Lorian (ed.), Antibiotics in laboratory medicine, 5th ed. Lippincott Williams and Wilkins, Philadelphia, PA.
- 23.Seifert, H., L. Dolzani, R. Bressan, T. van der Reijden, B. van Strijen, D. Stefanik, H. Heersma, and L. Dijkshoorn. 2005. Standardization and interlaboratory reproducibility assessment of pulsed-field gel electrophoresis-generated fingerprints of Acinetobacter baumannii. J. Clin. Microbiol. 43:4328-4335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Vahaboglu, H., R. Öztürk, G. Aygün, F. Coskunkan, A. Yaman, A. Kaygusuz, H. Leblebicioglu, I. Balik, K. Aydin, and M. Otkun. 1997. Widespread detection of PER-1-type extended-spectrum β-lactamase among nosocomial Acinetobacter and Pseudomonas aeruginosa isolates in Turkey: a nationwide multicenter study. Antimicrob. Agents Chemother. 41:2265-2269. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Van Looveren, M., H. Goossens, and the ARPAC Stering Group. 2004. Antimicrobial resistance in Acinetobacter spp. in Europe. Clin. Microbiol. Infect. 10:684-704. [DOI] [PubMed] [Google Scholar]
- 26.Yong, D., J. H. Shin, S. Kim, Y. Lim, J. H. Jum, K. Lee, Y. Chong, and A. Bauernfeind. 2003. High prevalence of PER-1 extended-spectrum β-lactamase-producing Acinetobacter spp. in Korea. Antimicrob. Agents Chemother. 47:1749-1751. [DOI] [PMC free article] [PubMed] [Google Scholar]