Skip to main content
Molecular and Cellular Biology logoLink to Molecular and Cellular Biology
. 2007 Apr 2;27(11):4093–4104. doi: 10.1128/MCB.01978-06

Ptf1a Binds to and Activates Area III, a Highly Conserved Region of the Pdx1 Promoter That Mediates Early Pancreas-Wide Pdx1 Expression▿

Peter O Wiebe 2, Jay D Kormish 4, Venus T Roper 1, Yoshio Fujitani 3, Ninche I Alston 1, Kenneth S Zaret 4, Christopher V E Wright 3, Roland W Stein 2, Maureen Gannon 1,2,*
PMCID: PMC1900007  PMID: 17403901

Abstract

The critical pancreatic transcription factor Pdx1 is expressed throughout the pancreas early but enriched in insulin-producing β cells postnatally. Previous studies showed that the 5′ conserved promoter regions areas I and II (Pdx1PB) direct endocrine cell expression, while an adjacent region (Pdx1XB) containing conserved area III directs transient β-cell expression. In this study, we used Cre-mediated lineage tracing to track cells that activated these regions. Pdx1PBCre mediated only endocrine cell recombination, while Pdx1XBCre directed broad and early recombination in the developing pancreas. Also, a reporter transgene containing areas I, II, and III was expressed throughout the embryonic day 10.5 (E10.5) pancreas and gradually became β cell enriched, similar to endogenous Pdx1. These data suggested that sequences within area III mediate early pancreas-wide Pdx1 expression. Area III contains a binding site for PTF1, a transcription factor complex essential for pancreas development. This site contributed to area III-dependent reporter gene expression in the acinar AR42J cell line, while PTF1 specifically trans-activated area III-containing reporter expression in a nonpancreatic cell line. Importantly, Ptf1a occupied sequences spanning the endogenous PTF1 site in area III of E11.5 pancreatic buds. These data strongly suggest that PTF1 is an important early activator of Pdx1 in acinar and endocrine progenitor cells during pancreas development.


The characterization of genetic regulatory elements and the transcription factors operating through these elements during pancreas development contributes to our understanding of insulin-producing β-cell formation. Perturbations in the transcription factors that bind important regulatory control elements can lead to defective pancreatic function and diabetes (2, 19, 41, 48). Proper development of the endocrine and exocrine compartments of the pancreas requires several characterized transcription factors, including pancreas transcription factor 1a (Ptf1a) and the homeodomain transcription factor pancreas and duodenum homeobox 1 (Pdx1).

The pancreas transcription factor 1 complex (PTF1) was first identified as an activator of exocrine-specific genes (35) and is comprised of an acinar-cell-enriched basic helix loop helix protein (bHLH), Ptf1a (p48); a ubiquitous bHLH protein (24), HEB; and the distinct mammalian Suppressor of Hairless (RBP-Jκ) (28) or its paralogue (RBP-L) (2). Ptf1a is expressed as early as embryonic day 9.5 (E9.5) throughout the developing pancreas and is essential for pancreas formation and function in both mouse and human (23, 25, 28, 42). Ptf1a null mice lack a ventral pancreatic bud and show an early arrest in dorsal bud outgrowth (23). Exocrine cells do not develop and there is limited endocrine development. The endocrine cells that do form are mislocalized to the spleen (25). Pdx1 is also expressed very early in pancreas development throughout both the dorsal and ventral pancreatic buds (13, 18, 27). After birth, Pdx1 is expressed at high levels in the insulin-producing β cells within the islets, in some somatostatin-producing δ cells, and at lower levels in subpopulations of exocrine cells (18, 30, 51). Null mutations in Pdx1 (and its human homologue, Ipf1) result in an apancreatic phenotype (22, 30, 48). Mutations in Pdx1 have also been identified in a subset of patients with a monogenic dominant form of diabetes, maturity onset diabetes of the young (MODY4) (46). In mice, Pdx1 haploinsufficiency results in decreased β-cell function, and loss of Pdx1 specifically from adult β cells leads to diabetes (1, 5, 8). Taken together, these studies demonstrate that Pdx1 functions both early in pancreas development and later in mature islets. The characterization of Pdx1 regulatory regions and the factors that bind to these regions should lead to a better understanding of how the pancreatic program is initiated and how Pdx1 expression is regulated in mature islets in order to maintain β-cell function and glucose homeostasis.

Previous analysis of Pdx1 noncoding regulatory regions identified four areas of highly conserved sequence (termed areas I through IV; each ∼300 bp) within 7 kb upstream of the promoter (Fig. 1) (14, 15, 44). Areas I (bp −2852 to −2547), III (bp −1973 to −1694), and IV (bp −6422 to −5931) are conserved among humans, rodents, and chickens, while area II (bp −2247 to −2071) has only been identified within the mammalian orthologs (14, 15). A β-galactosidase (β-Gal) reporter transgene driven by a 4.6-kb (bp −4617 to −33) or a 4.3-kb (bp −4617 to −320) promoter fragment, containing areas I, II, and III, but not area IV (Fig. 1), recapitulates the endogenous Pdx1 expression pattern (11, 47). Transgene-based complementation experiments on Pdx1 null mice reveal that the proximal promoter/enhancer region, excluding area IV, rescues the pancreatic defects caused by Pdx1 deficiency (4). Thus, area IV does not appear to be essential for the appropriate temporal control of pancreatic Pdx1 expression. In cell lines, areas I and II are each capable of driving β-cell-specific reporter gene expression independently, while together their β-cell-specific activity is greatly enhanced, suggesting that synergistic interactions between the two regions mediate high-level Pdx1 gene expression in islets (14, 49). Area III does not drive β-cell-selective activity in cell lines (14).

FIG. 1.

FIG. 1.

Diagram of highly conserved areas within the Pdx1 promoter/enhancer region. Area I (bp −2852 to −2547), area II (bp −2247 to −2071), area III (bp −1973 to −1694), and area IV (bp −6422 to −5931) are conserved regions among species (14). Labeled horizontal lines below the Pdx1 promoter indicate regions of relevance in this investigation. PstI (−3007), XhoI (−2046), BstEII (−2011), and BglII (−994) are relevant restriction sites. The numbering is relative to the mouse Pdx1 gene translation start site.

Transgenic analysis of the Pdx1 upstream region identified modules that were capable of driving endocrine expression in vivo (Fig. 1) (11, 51). The 1-kb PstI-BstEII fragment (Pdx1PB; bp −3007 to −2011), which contains areas I and II (and none of area III), drives the expression of a β-Gal reporter transgene exclusively in endocrine cells of embryonic and adult pancreas (11). In contrast, the adjacent 3′ 1-kb XhoI-BglII fragment (Pdx1XB; bp −2046 to −994) drives β-Gal expression to β cells of the late embryonic and neonatal pancreata only, but is not active in the mature adult organ. Of the four conserved regions, only area II showed islet-specific activity in transgenic reporter assays when analyzed individually, although this activity was detected in only a subset of β cells (11, 38, 49). Thus, as observed in cell lines, areas I and II seem to act together in vivo for optimal Pdx1 expression in β cells.

Combined cell line and transgenic analyses have so far not revealed a role for the highly conserved area III in Pdx1 gene regulation, although in one of four transgenic lines, area III alone drove transient reporter gene expression in developing endocrine cells and drove expression in scattered cells throughout the pancreas in adults (11). Interestingly, deletion of these conserved cis regulatory regions, areas I, II, and III, from the endogenous Pdx1 locus, results in a dramatic impairment in endocrine as well as exocrine tissue development at early stages of pancreatic outgrowth (9). Otherwise, prior to the current study there had been no evidence for a role for any of these regions in the regulation of Pdx1 expression outside of the pancreatic endocrine lineage. Using a combination of biochemical and in vivo lineage-tracing approaches, we uncovered a role for area III in Pdx1 expression, identified a critical site within this region that binds a Ptf1a-containing complex, and provided evidence to establish the relevance of this activator for proper pancreatic development.

MATERIALS AND METHODS

Transgenic constructs and generation of transgenic mice.

(i) Pdx1I-II-IIIlacZ.

Areas I, II, and III of mouse Pdx1 (Pdx1I-II-III), encompassing nucleotides −3030 through −1696 relative to the start of translation (+1), were PCR amplified from a 9-kb XbaI genomic fragment (30) and directionally subcloned into a modified hsp68 lacZpA vector which contains the heat shock protein minimal promoter and lacZ expression cassette (39). Lowercase letters indicate base changes introduced to produce 5′ HindIII or 3′ PstI restriction enzyme sites for directional cloning: upstream primer, 5′-GTAATCCaAgCTTTGCCTGCcG-3′; downstream primer, 5′-GTCTCTGcagTCTTCAGGGAAAAGAGCCAC-3′. Of six Pdx1I-I-IIIlacZ lines, two lines had detectable lacZ expression and were propagated for further analysis (see below). The generation of an additional eight transient transgenic mice, collected and analyzed at embryonic stages, yielded two more individuals with detectable lacZ expression, which was similar to that in the established lines.

(ii) Pdx1XBCre.

The 1-kb XhoI to BglII Pdx1 fragment contains area III and an additional 700 bp of 3′ nonconserved sequence encompassing nucleotides −2046 to −994 relative to the start of translation (+1) in the mouse gene (Pdx1XB) (11). The XB fragment was subcloned upstream of the hsp68 minimal promoter and a Cre recombinase expression cassette (34). Pdx1XBCre-mediated R26R recombination was similar in all four lines generated.

(iii) Pdx1PBCre.

The Cre recombinase/human growth hormone fusion cDNA (34) was subcloned into the Pdx1PB-HNF6 plasmid vector (12) by using EcoRI digestion to replace the HNF6 cDNA such that the Pdx1PB gene was positioned upstream of the hsp68 minimal promoter and a Cre recombinase expression cassette.

Pronuclei of 1-cell embryos from B6D2F1 (Charles River) females were injected with 1 to 5 pl DNA (3 ng/ml) and implanted into pseudopregnant CD-1 (Charles River) females (20). Some F0 founders were sacrificed at embryonic stages to analyze the Pdx1I-II-III-driven β-Gal expression pattern; transgenic lines were also generated. Genotyping was performed by Southern blot analysis of genomic DNA from brain (embryos and neonates) or tail (adults) tissues. Pdx1I-II-IIIlacZ transgenic mice were identified from EcoRI-digested DNA by using a lacZ cDNA probe. Cre transgenic mice were identified from EcoRI-digested DNA by using a Cre cDNA probe.

Characterization of transgenic mice.

The morning of vaginal plug appearance was considered to be E0.5. Dissected internal organs were fixed, stained with 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-Gal) to detect β-Gal, embedded, and sectioned (12, 54). Immunohistochemical staining for glucagon and insulin was as described previously (12). The Pdx1 expression level was analyzed using a 1:1,000 dilution of rabbit anti-Pdx1 (32) and Vectastain ABC and DAB kits (Vector Labs). Whole-mount images of dissected digestive organs and embryos were taken using an Olympus XZS9 bifocal dissecting microscope with a Nikon Coolpix 4300 digital camera and a Nikon UR-E4 eyepiece adaptor. Images of sections were taken under brightfield illumination using an Olympus BX41 microscope and digital camera with Magnafire software (Optronics). The image brightness, contrast, and color variations were minimally adjusted using Adobe Photoshop 6.0 or PowerPoint (37). The adjustments were equivalent for all samples that were directly compared.

TRANSFAC analysis.

The highly conserved region of the mouse Pdx1 fragment ranging from nucleotide −3030 to −1694 was examined in silico by using a default setting for putative transcription factor binding sites using the TRANSFAC matrix table and Tfsearch software version 1.3 (http://www.cbrc.jp/htbin/nph-tfsearch).

Electrophoretic mobility shift assays.

Nuclear extracts were prepared from 8-week-old male B6D2F1/J (Jackson Labs) mouse pancreata as described in references 29 and 43, modified for use with whole tissue (35). Briefly, whole pancreata were homogenized with a Tissuemiser homogenizer in ice-cold lysis buffer (10 mM Tris-HCl [pH 7.4], 0.1 M NaCl, 3 mM MgCl2, 0.5% NP-40, 0.5 mM dithiothreitol [DTT], 0.5 mM phenylmethylsulfonyl fluoride [PMSF], 0.5 mg/liter N-α-p-tosyl-l-phenyl chloromethyl ketone [TPCK], 0.5 mg/liter N-α-p-tosyl-l-lysine chloromethyl ketone [TLCK], 0.6 μM leupeptin, and 2 μM pepstatin). The homogenate was centrifuged (1,000 × g, 2 min, 4°C), and the pellets were resuspended in ice-cold lysis buffer and centrifuged (1,000 × g, 1 min, 4°C). The pellet was resuspended in ice-cold nuclear extraction buffer (20 mM HEPES [pH 7.9], 0.4 M NaCl, 0.90 mM spermidine, 0.2 mM EDTA, 2 mM EGTA, 25% glycerol, 2 mM DTT, 1 mM PMSF, 0.5 mg/liter TPCK, 0.5 mg/liter TLCK, 0.6 μM leupeptin, and 2 μM lepstatin). The nuclear extract was centrifuged (16,000 × g, 1 min, 4°C), and the supernatant was collected and stored at −80°C.

Electrophoretic mobility shift assays including antibody supershifts were performed as described previously (36, 40). The PTF1 control (PTF1 Ela1; bp −115 to −96 of the rat elastase 1 promoter) sequences were as follows: upper, 5′-gatcGTCACCTGTGCTTTTCCCTGC-3′, and lower, 5′-gatcGCAGGGAAAAGCACAGGTGAC-3′. The putative area III PTF1 binding site (AIII PTF1; bp −1730 to −1709 of the Pdx1 promoter) sequences were as follows: upper, 5′-gatcCACAGGTGGCTCTTTTCCCTG-3′, and lower, 5′-gatcCAGGGAAAAGAGCCACCTGTG-3′. Lowercase letters indicate 5′ overhangs for radioactive fill-in labeling. Other oligonucleotides are described in Fig. 6C. Mobility shift binding reaction mixtures, 20 μl in volume, were prepared on ice and contained 10 mM HEPES (pH 8.0), 90 mM NaCl, 1 mM EDTA, 0.1 M DTT, 6 μg bovine serum albumin, 2 μg poly(dI-dC), and 40 fmol of labeled probe. When specified, 5 μg of pancreatic nuclear extract, 5 μg of MIN-6 nuclear extract (gift from Jennifer Van Velkinburgh, Vanderbilt University), 1 μl of anti-Ptf1a (36), or a specified quantity ranging from 0.4 to 40 pmol of nonradioactive competitor oligonucleotides was added to the binding reaction mixture (see Fig. 6). The reaction mixtures were incubated for 15 min at 30°C. Totals of 20 μl of each reaction mixture were loaded and resolved at 4°C on a 4.0% nondenaturing polyacrylamide gel (40:1) in ice-cold Littman running buffer (50 mM Tris, 0.38 M glycine, 2 mM EDTA [pH 8.0]).

FIG. 6.

FIG. 6.

Ptf1a-containing complex binds area III and requires both the E and TC boxes. (A) Gel shift using the putative PTF1 binding site from area III or the PTF1 binding site from the elastase (Ela1) promoter as a control (closed arrowhead refers to specific complex). The addition of Ptf1a antibody (Ab) results in a complete supershift of the PTF1 complex bound to both the AIII probe and Ela1 PTF1 control probe (open arrowhead). The triangles depict increasing amounts of cold competitor: 10-, 50-, and 100-fold. The rectangle represents 100-fold competitor. Panc nuc, pancreatic nuclear extract; Min6 nuc, MIN-6 nuclear extract. (B) Gel shift competition experiment using indicated E box- or TC box-mutant cold competitors. The triangle depicts increasing amounts of cold competitor: 10-, 100-, and 1,000-fold. The rectangles represent 1,000-fold cold competitor. (C) Sequences of oligonucleotides used in the gel shift experiments. Dashes indicate gaps, periods indicate homology to AIII PTF1 probe, and capital letters indicate conserved nucleotides. Dup, duplication of spacer sequence.

Transfection plasmids.

The following were the generous gift of Ray MacDonald (University of Texas, Southwestern Medical Center) and have been described previously (2): rat elastase 1 minimal promoter, bp −92 to +8 in the pGL3 basic vector (−92rEla1p/pGL3; Promega); a six-copy rat Elastase 1 PTF1 site (A element) and elastase 1 minimal promoter (A26/pGL3); HEB expressed under the control of cytomegalovirus (CMV) promoter (HEB/pcDNA1.1); mouse Ptf1a expressed under the control of CMV (pCMV-mp48); human RBP-Jκ expressed under the control of CMV (Myc-hRbpsuh/pcDNA3); and mouse RBP-L expressed under the control of CMV (CMV.RBbpsuh-L).

Oligonucleotides annealing in the pBluescript II (Stratagene) vector (ATTAACCCTCACTAAAG) and to the 3′ end of area III (GTCTCTGATTTCTTCAGttAAAAGAGCCACCTtTGCCCGTCAAGGGGCC) (11) were used to generate an E box and TC box mutant of the PTF1 binding site (bp −1730 to −1709); the lowercase nucleotides correspond to those targeted in other PTF1 binding mutants (2, 21, 36). Wild-type and area III mutant (Pdx1mIII) sequences were subcloned into the HindIII site just upstream of the herpes simplex virus thymidine kinase (TK) minimal promoter driving the firefly luciferase expression cassette (TK-Luc) in pGL3 (Promega) (31). Wild-type and mutant Pdx1I-II-III TK-Luc were generated by subcloning area I- to II-spanning sequences from the Pdx1I-II-III transgene into either Pdx1III TK-Luc or Pdx1mIII TK-Luc. The correctness of the plasmids was verified by restriction digestion and partial DNA sequencing.

Transient transfections.

The Rattus norvegicus exocrine-derived cell line (AR42J) was obtained from ATCC and propagated according to the specifications provided. Cells were transiently transfected with Lipofectamine 2000 (Invitrogen) in 24-well plates at 2 × 105 cells/well (0.8 μg DNA/well), according to the manufacturer's instructions. The data were analyzed for significance by one-way analysis of variance and Tukey's posttest.

The Homo sapiens embryonic-kidney-derived cell line (HEK 293) was propagated in Dulbecco modified Eagle medium with 10% fetal bovine serum according to specifications provided by ATCC. The cells were transiently transfected with Lipofectamine in 24-well plates, 1.5 × 105 cells/well (0.5 μg DNA per well). Equimolar amounts of the wild-type and area III-mutant TK-Luc plasmids were used at a 1:1 molar ratio with the CMV-driven expression plasmids. The data were analyzed for significance by two-way analysis of variance and Bonferroni's posttest.

The TK-driven Renilla luciferase expression plasmid phRL-TK (10 ng; Promega) was cointroduced into AR42J and HEK 293 cells to control for transfection efficiency. Renilla and firefly luciferase activities were measured by using the dual luciferase assay (Promega) on cell extracts prepared 40 to 48 h after transfection. Each transfection condition was performed on at least four independent occasions. Statistical analysis and graph generation were performed using PRISM software (GraphPad).

Embryonic dorsal pancreas and gut tube dissections.

Dorsal pancreas bud dissections were performed as illustrated in Fig. 8, panels A to F. Gut tube dissections were performed as previously described (3). Tissue purity was assayed by detection of Ptf1a or alb1 mRNA isolated from dissected tissues. mRNA from dissected tissues was isolated by using an RNeasy micro kit (QIAGEN) and cDNA was synthesized by using an iScript cDNA synthesis kit (Bio-Rad). PCR analysis was performed using iQ SYBR green supermix (Bio-Rad) according to the manufacturer's instructions. The following primers were used at a concentration of 0.3 μM in 25-μl reaction mixtures: Ptf1a, GGTTATCATCTGCCATCGAGG and GCTGTTTTTCATCAGTCCAGGA; alb1, AGCACACAAGAGTGAGATCGCC and TGGCATGCTCATCGTATGAGC; and Hprt, GCTTGCTGGTGAAAAGGACCT and TGCGCTCATCTTAGGCTTTGTA. The iCycler iQ and optical system software version 3.1 (Bio-Rad) were used to define the threshold cycle (CT) value for each PCR. The CT values of the Hprt amplification were subtracted from the CT values of Ptf1a or alb1 for normalization. The relative expression was calculated as 2(−ΔCT).

FIG. 8.

FIG. 8.

Ptf1a protein is specifically enriched at area III and area IV of the Pdx1 promoter. (A to F) The midgut region (A, B) was isolated from E11.5 embryos. The region containing the dorsal pancreas was removed (C, D) and separated from contaminating tissue (E). Several dissected pancreatic buds were pooled and processed for chromatin cross-linking and chromatin isolation at one time (F). (G) Tissue purity was assayed by determining Ptf1a or alb1 expression level. mRNA isolated from dissected organs was subjected to real-time reverse transcriptase-PCR analysis and normalized to hypoxanthine phosphoribosyltransferase (HPRT) mRNA (see Materials and Methods). (H) Ptf1a ChIP was performed on chromatin isolated from E11.5 dorsal pancreas and gut tube. Detection of enrichment for the elastase 1 promoter serves as a positive control for Ptf1a binding and failure of Ptf1a to precipitate chromatin from the gut tube demonstrates tissue specificity. The data represent the averages of two Bioanalyzer runs per primer pair set amplified in parallel from single ChIP reactions (IgG or Ptf1a) from designated embryonic tissues. The diagram refers to the location of the amplified regions in relation to the transcription start site.

Ptf1a ChIP.

Chromatin isolation and chromatin immunoprecipitation (ChIP) for embryo tissues were modified from established protocols (6, 50). Crude chromatin preparations were pooled from 163 dissected dorsal pancreatic buds and 77 gut tubes of E11.5 embryos. Dissected material was fixed for 10 min at 25°C in 1% formaldehyde in phosphate-buffered saline, pelleted, transferred to 125 mM glycine in phosphate-buffered saline, and incubated on ice for 5 to 10 min. Fixed cells were pelleted, resuspended in radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl [pH 8.0], 0.15 M NaCl, 0.5% deoxycholic acid, 0.1% sodium dodecyl sulfate [SDS], 1% IgePal CA-630, 5 mM EDTA, 0.5 mM PMSF, 1 mM benzamidine, 5 μg/ml antipain, 5 μg/ml leupeptin, 5 μg/ml trypsin inhibitor), and disrupted in a tissue homogenizer to liberate the nuclei. The nuclei were pelleted; resuspended in 50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 0.5 mM PMSF, 1 mM benzamidine, 5 μg/ml antipain, 5 μg/ml leupeptin, 5 μg/ml trypsin inhibitor; and incubated on ice for 10 min prior to being flash-frozen and stored at −80°C. Nuclear isolates were pooled and sonicated to an average size of 150 to 400 bp. Equal amounts of chromatin (1 μg as estimated by DNA concentration) were diluted in RIPA (modified to 1 mM EDTA) and precipitated by using normal rabbit immunoglobulin G (IgG) (Santa Cruz) or anti-Ptf1a rabbit IgG (gift from Ray MacDonald, UT Southwestern). Chromatin-antibody complexes were precipitated with protein A-Sepharose (protein A-Sepharose CL-4B; catalogue no. 17-0780-01, Amersham). Protein A beads were washed with RIPA (modified to 0.5 M NaCl) and eluted with 10 mM Tris-HCl (pH 8.0), 1% SDS, 1 mM EDTA for 20 min at 42°C. The cross-links were reversed by incubation at 68°C overnight, and the DNA was digested in 10 mM Tris-HCl (pH 8.0), 0.1 M NaCl, 1 mM EDTA, 1% SDS, 0.1 mg/ml proteinase K and phenol chloroform extracted prior to PCR. Material assayed by ChIP and input material were analyzed by PCR with the following primers: Pdx1 area I, CTGGGACAGAGTCTCAGCAGAAG and CGTCCTGATAGTCCTCCCTGAT; Pdx1 area II, AGCAGCGAGCTTGTTTTTCTG and CACTTCTGGTCTAATTGCATGCA; Pdx1 area III, TGCCCCGGCCTTTCA and GGGAGAGTGTCTCTGATTTCTTCAG; Pdx1 area IV, GCTCCAATGCCATTTGTCAA and TGGATCCTGACTGCGTCTTG; and elastase 1 promoter, TTGACTTAAAATTTGTTCATTTGT and ACCCTCTTTATACGGCTCTT. PCRs were analyzed by using a 2100 bioanalyzer and dsDNA 1000 lab chips (Agilent Technologies). The PCR product concentration and molarity were calculated using 2100 Bioanalyzer Expert software (Agilent Technologies).

RESULTS

Lineage tracing reveals that areas I and II drive expression in pancreatic endocrine but not exocrine tissue.

We previously reported that the 1-kb PstI-BstEII fragment (Pdx1PB; bp −3007 to −2011), which contains areas I and II from the Pdx1 locus (and none of area III), drives the expression of a β-Gal reporter transgene exclusively in endocrine cells as early as E11.5 and continuing into adulthood (11, 12, 49). A specific role for areas I and II in regulating endocrine expression is supported here by lineage-tracing analysis using Pdx1PBCre mice. Pdx1PBCre transgenic mice were crossed with the lineage-independent Gt(ROSA)26Sortm1sor (R26R) reporter strain (45) to determine whether Pdx1PB was activated at an earlier stage of pancreatic development within a common endocrine/exocrine pancreatic progenitor. In this case, we should observe β-Gal activity in all pancreatic-bud derivatives (acini, ducts, and islets). As shown in Fig. 2, Pdx1PBCre-mediated recombination within the pancreas was detected only in islet endocrine cells at postnatal day 1 (P1). Recombination was also observed in a few scattered cells within the stomach and duodenum (sites of endogenous Pdx1 expression) (Fig. 2) and ectopically in dorsal root ganglia (data not shown). When X-Gal staining was observed in the duodenal lumen, it was present in both transgenic and nontransgenic neonatal littermates and is most likely due to endogenous intestinal β-Gal activity (11). Within the islets, there was recombination throughout the insulin-expressing β-cell core and in some glucagon-expressing cells (Fig. 2B). Despite the generation of only one Pdx1PBCre transgenic line, our findings are consistent with our previously published results regarding the Pdx1PBhsplacZ transgenic mice, the Pdx1PBCre-ER; R26R bigenic mice (11, 54), and the expression of endogenous Pdx1 in islets after birth (18). Thus, our combined analyses indicate that areas I and II are not sufficient to direct expression to early pancreatic progenitors or differentiated pancreatic exocrine tissue.

FIG. 2.

FIG. 2.

Lineage tracing of a region that contains the conserved area I and II (Pdx1PBCre)-mediated recombination only in islet endocrine cells of the pancreas at P1. (A) Whole mount of X-Gal-stained (blue) P1 digestive organs from a Pdx1PBCre; R26R mouse showing high levels of expression in islets and some cells within the stomach. The arrows indicate different regions of the pancreas containing X-Gal-stained cells consistent with normal islet distribution. X-Gal staining was sometimes observed in the duodenal lumen of transgenic and nontransgenic neonatal littermates. p, pancreas; s, stomach; I, intestine. (B) Cross-section of X-Gal-stained P1 pancreas tissue labeled with antibodies to glucagon (Gluc) in brown. The arrowheads point to cells positive for both glucagon and β-Gal. a, acinar tissue. The diagram shows a schematic of the Pdx1PBCre transgene and R26R reporter construct for lineage tracing of Cre-expressing cells (not to scale).

Addition of area III to areas I and II is sufficient to drive early pancreas-wide expression.

Four independent Pdx1I-II-IIIlacZ transgenic mice with detectable expression were generated in which lacZ was under the control of Pdx1PB (containing areas I and II) plus area III (Fig. 1). Pdx1I-II-IIIlacZ transgenic mice showed high levels of β-cell-enriched expression in the mature pancreas but at earlier stages showed pancreas-wide expression at apparently equivalent levels throughout the endodermally derived tissue (Fig. 3 and 4).

FIG. 3.

FIG. 3.

Expression is restricted to β cells in Pdx1I-II-IIIlacZ adults. (A, B) Whole-mount pictures of X-Gal-stained (blue) adult pancreata from two independent transgenic lines showing an islet-enriched expression pattern. (C, D) Representative cross-sections of X-Gal-stained adult pancreata, counterstained with eosin, which was typically detected throughout the β cells (C), but sometimes appeared variegated (D). Glucagon-expressing cells are labeled with an antibody in brown (Gluc). The original magnification is given for each panel. The diagram refers to the transgene used to create the mice analyzed in this figure (not to scale).

FIG. 4.

FIG. 4.

Pdx1I-II-IIIlacZ is expressed in both endocrine and acinar cells during development. (A, B) X-Gal-stained (blue) embryos at E11.5 showing expression in pancreas and ectopic expression in the neural tube. (C) Section from an X-Gal-stained E10.5 embryo labeled for Pdx1 protein (brown). (D, E) X-Gal staining in the developing pancreas at E10.5 (D) and E11.5 (E). (F, G, H) Whole-mount pictures of X-Gal-stained dissected digestive organs at E16.5 (F), E18.5 (G), and P1 (H). The pictures are representative of expression observed in four of four independent transgenic mice. Luminal X-Gal staining was observed in the duodenum of some transgenic and nontransgenic littermates at late gestation and in neonates (G). p, pancreas; sp, spleen; s, stomach; I, rostral duodenal portion of the intestine; db, pancreatic dorsal bud; vb, ventral bud. The diagram refers to the transgene used to create the mice analyzed in this figure (not to scale).

Two Pdx1I-II-IIIlacZ lines were propagated and characterized. Adult pancreata from both Pdx1I-II-IIIlacZ lines were X-Gal stained to assess the mature-organ expression specificity of the transgene. Both in whole mount and in sections, a pattern of β-Gal activity consistent with islet-specific expression in the pancreas was observed, preferentially in β cells (Fig. 3). The two Pdx1I-II-IIIlacZ lines showed differing levels of expression in the adult (Fig. 3A and B), and the expression pattern within islets was sometimes variegated (Fig. 3C), but both lines showed expression within the same cell types. Exocrine expression was not detectable in adult pancreata (Fig. 3C and D). The expression pattern at this stage was similar to that seen in Pdx1PBCre; R26R mice (Fig. 2) and to that previously reported for the Pdx1PBhsplacZ (11, 51) and Pdx1PBCre-ER; R26R transgenic mice (54).

Pdx1I-II-IIIlacZ transgenic embryos were examined at E9.5, E10.5, and E11.5, the time during which pancreatic buds first become visible and outgrowth begins. Pdx1I-II-IIIlacZ expression was undetectable at E9.5 (data not shown) but was detected broadly and robustly at both E10.5 and E11.5 within the dorsal and ventral pancreatic buds, but not in the adjoining gut tube (Fig. 4D and E). Consistent with the lack of transgene expression in the antral stomach and rostral duodenum, X-Gal staining colocalized with Pdx1 protein in the pancreatic region at E10.5, but was absent from the Pdx1-labeled stomach (Fig. 4C). At E14.5 and E16.5, whole-mount β-Gal expression was observed throughout the pancreas at relatively equal levels (Fig. 4F and data not shown). In contrast, whole-mount analysis at E18.5 and P1 revealed an expression pattern more consistent with forming islet clusters (Fig. 4G and H). Examination of sections at these time points showed β-Gal expression in both exocrine and endocrine cells; however, the level of β-Gal expression observed in endocrine cells was more intense than that observed in exocrine cells, and expression in exocrine cells was variegated (data not shown). We collected, at late embryonic stages, two independent F0 transgenic Pdx1I-II-IIIlacZ mice which had patterns of expression consistent with our propagated Pdx1I-II-IIIlacZ transgenic lines. Thus, the expression of Pdx1I-II-IIIlacZ gradually increases within endocrine cells and diminishes from exocrine cells between E14.5 and P1, eventually becoming restricted to β cells in adult tissue, similar to endogenous Pdx1 expression within the pancreas.

Pdx1I-II-IIIlacZ mice exhibited β-Gal activity beginning at E10.5 in the dorsal neural tube caudal to the midbrain/hindbrain junction (Fig. 4A and B), which was observed in all four transgenic animals generated, suggesting that this ectopic expression was inherent to the transgene. In the two lines characterized at adult stages, Pdx1I-II-IIIlacZ mice also had low levels of ectopic expression in the kidneys and hair follicles (data not shown), similar to the levels in Pdx1PBCre-ER; R26R bigenic mice (54). Expression was not observed in other sites of endogenous Pdx1 expression, such as the antral stomach or rostral duodenum (30), at any time point analyzed.

The area III-containing XhoI-BglII fragment drives expression early throughout the Pdx1 domain.

The Pdx1XB fragment drives reporter gene expression transiently in β cells; this expression was observed at E14.5 and P1 but not in the adult (Fig. 1). Earlier embryonic stages were not examined in these transgenic lines (11). To trace the cumulative effect of the activity of this fragment throughout development, we generated four independent Pdx1XBCre transgenic mouse lines. All four lines shared the same overall pattern of recombination (Fig. 5), although in one line, recombination was not as robust (data not shown). We identified cells and their progeny that expressed Cre at high enough levels to cause recombination of the R26R reporter (45), even after Pdx1XB activity ceased. In all Pdx1XBCre; R26R transgenic mice, we observed recombination throughout the endogenous Pdx1 domain at both E14.5 and P1 (Fig. 5F and G). The pattern of recombination observed in whole mounts included pancreas, duodenum, antral stomach, and bile duct, which are all tissues that arise from cells expressing endogenous Pdx1 (30). Analysis of sections from P1 Pdx1XBCre; R26R animals revealed complete recombination throughout both the endocrine and exocrine pancreas (Fig. 5C), suggesting an early recombination event. Indeed, examination of earlier embryonic stages revealed that the Pdx1XBCre transgene is active in the posterior foregut region as early as E9.5 (data not shown). At E10.5, R26R recombination was observed in the entire dorsal and ventral pancreatic buds of the dissected digestive organs and was also detectable in the adjoining gut tube (Fig. 5A and B). By E11.5, R26R recombination was also apparent in the bile duct (Fig. 5D), consistent with later stages. Occasionally, whole mice underwent ubiquitous recombination (data not shown), but otherwise, no ectopic expression was observed; recombination was consistently restricted to the endogenous Pdx1 expression domain.

FIG. 5.

FIG. 5.

Lineage tracing of area III-containing, Pdx1XBCre-mediated recombination throughout the endogenous Pdx1 domain. Whole-mount pictures of X-Gal-stained E10.5 (B) and E11.5 (E) embryos and dissected digestive organs at E10.5 (A), E11.5 (D), E14.5 (F), and P1 (G). (C) Cross-section of X-Gal-stained P1 pancreas labeled with antibodies to glucagon (Gluc; brown). The pictures are representative of expression observed in four of four independent transgenic mice. L, liver; s, stomach; I, rostral duodenal portion of the intestine; b, bile duct; i, pancreatic islet; a, acinus; d, duct; db, dorsal bud; vb, ventral bud. The diagram refers to the transgene used to create the mice analyzed in this figure and the R26R reporter construct for lineage tracing of Cre-expressing cells (not to scale).

Ptf1a binds to area III in vitro.

Collectively, the data demonstrate that area III is involved in directing early, pancreas-wide Pdx1 expression. Area III sequences were thus analyzed in silico using Tfsearch and the TRANSFAC database to identify a potential transcription factor(s) responsible for controlling this expression. A PTF1-like binding site was found at the 3′ end (nucleotides −1730 to −1709) of area III, which was highly relevant since Ptf1a is coexpressed with Pdx1 throughout the pancreatic buds at E10.5 (23). This site had high identity within both the E and TC boxes that define Ptf1a-HEB-RBP-Jκ/L (PTF1) activator binding (Fig. 6C) (2, 7, 36), whereas a PTF1-like site was not found in area I or II.

Gel shift analyses were performed using the PTF1-like binding site from area III and the well-characterized PTF1-binding site from the elastase 1 gene (Ela1) (Fig. 6) (36). Nuclear extracts enriched in PTF1 from adult mouse pancreata illustrated that the area III site formed a complex with mobility similar to that of the Ela1 PTF1 element (Fig. 6A, lanes 9 and 12), suggesting that the putative area III PTF1 site bound to the same protein component(s) as the Ela1 PTF1 control. Furthermore, the Ptf1a antibody completely retarded the mobility of the comigrating complex of both the area III and Ela1 PTF1 probes (Fig. 6A, lanes 10 and 13). In contrast, a complex of quite different mobility, which was insensitive to the Ptf1a antibody, was formed with extracts from the MIN-6 mouse β-cell line, which does not produce Ptf1a (24) (Fig. 6A, lanes 14 and 15). These results suggested that a complex containing PTF1a was capable of binding to the bp −1730 to −1709 element of area III.

A PTF1 complex binding site contains both a bHLH E box (CANNTG) for Ptf1a-HEB binding and a contiguous TC box (TTTCCC) (the invariant nucleotides are underlined) for the binding of RBP-J or RBP-L (Fig. 6C) (2, 7, 36). At one or two helical turns apart center to center, the spacing between these elements is critical for PTF1 binding (36). Gel shift competition experiments were next performed to determine if each of these binding site components was necessary for the formation of the Ptf1a-containing complex on the bp −1730 to −1709 probe. The mutation(s) introduced within each competitor oligonucleotide(s) is known to impact Ptf1a-HEB and/or RBP-Jκ/L binding in other contexts (2, 21, 36). The competition pattern demonstrated that the Ptf1a-HEB-RBP-Jκ/L complex is present in the area III Ptf1a-containing binding complex.

PTF1 is important for area III-mediated activation.

To determine if the PTF1 site in area III was involved in Pdx1 promoter activation, the activity of a binding-defective mutant constructed in the context of either a Pdx1III or Pdx1I-II-III reporter was compared to its wild-type version in transfected AR42J cells. This pancreatic acinar cell line produces both PTF1 (7, 53) and Pdx1 (52). The PTF1 site mutation significantly reduced Pdx1I-II-III TK-Luc and Pdx1III TK-Luc activity (Fig. 7A). Moreover, Pdx1III activity was stimulated in a PTF1 site-dependent manner upon cotransfection of Ptf1a, HEB, and RBP-Jκ/L in HEK 293 cells, a nonpancreatic cell line that does not produce PTF1 (Fig. 7B) (2). Experiments performed with a reporter driven by six copies of the elastase 1 PTF1 binding site verified the PTF1-dependent activity in both AR42J and HEK 293 cell lines (data not shown). Collectively, these results demonstrate that PTF1 is capable of specifically binding to and stimulating activity through area III.

FIG. 7.

FIG. 7.

Pdx1 area III activity is dependent on PTF1. (A) Wild-type (wt) and mutated (mutant) PTF1 binding site TK-Luc reporters were transfected into AR42J cells. Activity is expressed as percent Pdx1I-II-III activation ± standard error of the mean. (B) Expression plasmids of Ptf1a, HEB, and RBP-Jκ or -L were cotransfected into HEK 293 cells with the area III-containing TK-Luc plasmids. The data are expressed as fold activation ± standard error of the mean over the respective area III-containing TK-Luc cotransfected with empty expression plasmids. The asterisks indicate significance upon comparing the mutant to the wild type: *, P < 0.01, **, P < 0.001. The diagrams at the bottom of each panel refer to enhancer fragments used to drive reporter expression.

Endogenous Ptf1a binds the Pdx1 promoter in vivo.

To investigate whether Ptf1a bound Pdx1 upstream regulatory sequences during pancreatic organogenesis, we developed conditions for performing a ChIP assay from tissues that were microdissected from E11.5 mouse embryos. Similarly staged embryos from Pdx1lacZ/+ knock-in mice (30) stained for β-Gal served as controls for developing a protocol to dissect wild-type dorsal pancreatic buds from the gut tube (Fig. 8, panels A to E). Real-time reverse transcriptase-PCR analysis of the RNA revealed that the microdissected buds expressed the Ptf1a gene, whereas RNA, from the gut tube, heart, and liver bud were negative for this gene, as expected (Fig. 8, panel G). Conversely, the Ptf1a-positive buds were negative for the liver gene, albumin 1 (alb1) (Fig. 8, panel G), also as expected. We pooled 163 such pancreatic buds, cross-linked the chromatin in the tissues, and performed ChIP with a Ptf1a-specific antibody. Pooled gut tubes served as negative controls. The scaled-down ChIP reactions required analysis of the PCR products on a microfluidics workstation; the data depict the results of two analytical runs per PCR. PCR analysis of the ChIP products with primers to the elastase 1 gene promoter yielded markedly higher signals from the dorsal pancreatic buds than from the gut tube control (Fig. 8, panel H). These data confirm the validity and specificity of the embryonic ChIP assay for Ptf1a.

Using primers specific for amplification of each of the previously identified highly conserved regions within the Pdx1 promoter (areas I to IV), we next analyzed whether Ptf1a interacted specifically with area III or any of the other known regulatory regions. Strikingly, both area IV and III exhibited strong binding by Ptf1a in E11.5 embryonic pancreatic buds compared to its binding in the gut tube controls. By contrast, the islet-specific areas I and II did not exhibit binding to Ptf1a. These data further support a role for PTF1 in the expression of Pdx1 in early exocrine and endocrine progenitors.

DISCUSSION

The present study provides further insight into the dynamics of Pdx1 regulation during pancreatic development by illustrating that the early pancreatic developmental regulator, PTF1, serves in area III-mediated activation. Prior to the current study, a role for area III in Pdx1 gene regulation had not been established, despite the high degree of sequence conservation within this region among vertebrates (human, mouse, and chicken). In cell lines, area III and the larger XhoI-BglII fragment (Pdx1XB) in which it is located were incapable of directing β-cell-selective reporter gene activation (14, 51), suggesting that these sequences might participate in other aspects of Pdx1 gene expression. In transgenic analyses, however, Pdx1XB drove lacZ expression exclusively to β cells at E14.5 and P1, leading us to conclude that sequences within this fragment did indeed participate in β-cell-specific regulation of Pdx1, although this activity was transient (11). Here we provide evidence for area III facilitating the early and broad expression of Pdx1 in pancreatic buds.

Sequences within Pdx1I-II-III direct dynamic Pdx1 expression in the pancreas.

The Pdx1I-II-IIIlacZ transgene differs from the previously published endocrine-specific Pdx1PBhsplacZ only in the addition of area III. Pdx1I-II-IIIlacZ was expressed throughout the pancreatic buds in precursors to all cell types at E10.5; as development proceeded, expression was gradually diminished in acinar cells and intensified in endocrine cells. Thus, sequences within area III likely confer early pancreas-wide expression to the islet endocrine-specific Pdx1PB fragment. Pdx1I-II-III was unable to drive expression within the Pdx1 domain outside the pancreas (the antral stomach, rostral duodenum, or common bile duct). These expression data are consistent with the phenotype of mice containing a global deletion of Pdx1I-II-III (Pdx1ΔI-II-III) in which Pdx1 expression is dramatically reduced in pancreatic buds but is essentially normal in stomach and duodenum (9). Consequently, Pdx1I-II-III deletion resulted in limited pancreatic bud outgrowth and differentiation with little effect on stomach and duodenum, in contrast to the results of the global Pdx1 deletion (26, 30).

Sequences in Pdx1 area III mediate embryonic pancreas-wide expression.

Similar to Pdx1I-II-III reporter expression, the Pdx1XB fragment drove Cre recombinase activity throughout the pancreatic buds early in pancreatogenesis. The extent of recombination observed in Pdx1XBCre; R26R mice is reminiscent of that mediated by Pdx1Cre (17), in which Cre is driven by a 5.5-kb Pdx1 promoter fragment which contains sufficient sequence to recapitulate the endogenous Pdx1 expression pattern (11, 47). In contrast to the expression driven by Pdx1I-II-III, Pdx1XBCre-mediated recombination was also detected at high levels in other areas of endogenous Pdx1 expression (antral stomach, common bile duct, and rostral duodenum). The conserved region in common between the Pdx1I-II-III and Pdx1XB fragments is area III (Fig. 1), suggesting that sequences within this region are responsible for the early, broad expression of Pdx1 within the pancreas. The region 3′ to area III within the Pdx1XB fragment shows no significant sequence conservation between species and is incapable of driving robust lacZ expression to Pdx1-producing cell types in vivo (11, 14). It is possible that antral stomach and duodenal expression are normally driven by area III in vivo but are repressed by sequences within the Pdx1PB fragment in the Pdx1I-II-III transgene. This seems unlikely, however, given the phenotype of the Pdx1ΔI-II-III mice, where in the stomach and duodenum, only the enteroendocrine cells are affected, with, specifically, a 50% reduction in stomach gastrin cells and duodenal GIP cells. Alternatively, sequences 3′ to area III within the Pdx1XB fragment may mediate extrapancreatic expression of Pdx1 but require interaction with factors binding area III to stabilize, or enhance, their activity. To date, a duodenal or gastric regulatory element has not been identified in the Pdx1 gene. Our in vivo transgenic analysis supports a role for area III in the regulation of early, broad expression of Pdx1 throughout the pancreatic bud epithelium.

Area III mediates acinar expression of Pdx1.

Acinar expression of β-Gal has not been observed in any mouse line carrying transgenes driven by the Pdx1PB fragment containing areas I and II (Pdx1PBhsplacZ [11, 49, 51], Pdx1PBCre [this study], or Pdx1PBCre-ER [54]), suggesting that elements within area III are responsible for endogenous Pdx1 acinar expression. Since Ptf1a expression is initially expressed broadly throughout the pancreatic buds but becomes restricted to acinar tissue and is capable of binding to sequences upon which area III activity is dependent, we hypothesize that the dynamic changes in Pdx1 expression within acinar tissue are mediated, at least in part, by PTF1. Recent studies indicate that the expression of another component of the PTF1 complex, the mammalian Suppressor of Hairless orthologue RBP-Jκ/L, is also developmentally regulated. RBP-Jκ is more highly expressed during embryonic pancreas development, while RBP-L is exclusively found in adult pancreata (2). As RBP-Jκ and RBP-L differ in their transcriptional activity (2), this developmental switch in the TC box binding factor may explain the change in acinar Pdx1 expression.

PTF1 activates area III and binds to this control region in embryonic pancreas.

PTF1 was a likely candidate for early, broad regulation of Pdx1, since its pancreas-specific component, Ptf1a, is expressed pancreas-wide as early as E9.5 (23, 28), correlating well with the early pancreatic pattern of β-Gal expression that we observed in the Pdx1I-II-IIlacZ (Fig. 4D and E) and the Pdx1XBCre; R26R mice (Fig. 5A and B). Also, the ectopic β-Gal activity exhibited by the Pdx1I-II-IIIlacZ mice in the dorsal neural tube at E10.5 is identical to the β-Gal expression in the Ptf1aCre/+; R26R mouse in those regions (16, 23). Analysis of area III in silico revealed a putative PTF1 site: a conserved CANNTG (E box) and TTTCCC (TC box) separated center to center by one turn of DNA (36). Ptf1a present in nuclear extracts from adult mouse pancreata bound the putative PTF1 site in area III with relatively high affinity (Fig. 6), and activity mediated by area III was dependent on this site (Fig. 7). The in vivo relevance of the PTF1 site within area III is demonstrated by the binding of endogenous Ptf1a to area III within the endogenous Pdx1 promoter in developing pancreatic buds at E11.5 (Fig. 8). Our data do not exclude the possibility that other transcription factors affect transcription of Pdx1 during early pancreatic bud formation and outgrowth (4, 33), but they suggest that PTF1 activates, at least in part, early pancreas-wide expression of Pdx1 through area III.

The significance of Ptf1a binding to area IV remains to be determined. The role of area IV in the regulation of Pdx1 gene expression is only now beginning to be addressed. Pdx1 upstream regulatory sequences lacking area IV are capable of driving reporter transgene expression in a pattern temporally and spatially indistinguishable from endogenous Pdx1 (11, 47). Transgene-based complementation experiments on Pdx1 null mice suggest, however, that area IV is required for appropriate levels of Pdx1 expression in the postnatal stomach and duodenum, although it is not required to rescue the pancreatic defects caused by Pdx1 deficiency (4, 10).

In vivo relevance of Ptf1a binding area III.

In vivo deletion of areas I, II, and III from the Pdx1 promoter results in a dramatic arrest in pancreas development, similar to that observed in globally Pdx1 null mice (9, 30). Since we show that areas I and II are only active in endocrine tissue within the pancreas (Fig. 2), the failure of the pancreas to develop in the Pdx1ΔI-II-III/− mice is most likely due to the loss of area III, suggesting that sequences within area III, in particular the PTF1 site, are important for expression in the developing pancreas. Pdx1 expression precedes and is in a broader domain within the posterior foregut than Ptf1a expression. In Ptf1a null mice, Pdx1 expression is maintained in the dorsal pancreas (23). Taken together, these data suggest Ptf1a is not necessary to initiate Pdx1 expression in the pancreas but is involved in maintaining or augmenting Pdx1 expression within the developing pancreatic buds. We would predict that removal of area III containing the PTF1 binding site in vivo would result in an apancreatic phenotype without affecting the development of other tissues and cell types in which Pdx1 is expressed, similar to the phenotype observed with deletion of areas I, II, and III.

Acknowledgments

We thank David Lowe, Elizabeth Tweedie Ables, Laura Crawford, and Hongjie Zhang for providing technical assistance, and the members of the Gannon lab for critical reading of the manuscript. We thank Ray MacDonald for generously providing reagents, including plasmids and antibodies, as well as expert advice which facilitated this investigation. We thank Roger Colbran for HEK 293 cells. We thank Eva Henderson, Jon Backstrom, Amanda Vanhoose, and Jenny Van Velkinburgh for expert technical advice.

Transgenic animal models were generated by the Vanderbilt Transgenic Mouse/Embryonic Stem Cell Shared Resource supported by the Vanderbilt Cancer, Diabetes, Kennedy, Molecular Neuroscience, and Vision Centers (CA68485, DK20593, HD15052, EY08126). P.O.W. was supported in part by the Vanderbilt Molecular Endocrinology Training Program (5T32 DK07563). This work was supported by a Career Development Award from the Juvenile Diabetes Research Foundation International (JDRFI; grant number 2-2002-583) to M.G.; National Institutes of Health/National Institute of Diabetes and Digestive and Kidney Diseases grants RO1 DK65131-01 to M.G., U01 DK72503 to K.S.Z., DK042502 to C.V.E.W., and RO1 DK-50203 to R.W.S.; and a JDRFI postdoctoral fellowship and a Research Fellowship from the Japan Society for Promotion of Science to Y.F.

Footnotes

▿

Published ahead of print on 2 April 2007.

REFERENCES

  • 1.Ahlgren, U., J. Jonsson, L. Jonsson, K. Simu, and H. Edlund. 1998. Beta-cell-specific inactivation of the mouse Ipf1/Pdx1 gene results in loss of the beta-cell phenotype and maturity onset diabetes. Genes Dev. 12:1763-1768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Beres, T. M., T. Masui, G. H. Swift, L. Shi, R. M. Henke, and R. J. MacDonald. 2006. PTF1 is an organ-specific and Notch-independent basic helix-loop-helix complex containing the mammalian suppressor of hairless (RBP-J) or its paralogue, RBP-L. Mol. Cell. Biol. 26:117-130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bossard, P., and K. S. Zaret. 2000. Repressive and restrictive mesodermal interactions with gut endoderm: possible relation to Meckel's diverticulum. Development 127:4915-4923. [DOI] [PubMed] [Google Scholar]
  • 4.Boyer, D. F., Y. Fujitani, M. Gannon, A. C. Powers, R. W. Stein, and C. V. Wright. 2006. Complementation rescue of Pdx1 null phenotype demonstrates distinct roles of proximal and distal cis-regulatory sequences in pancreatic and duodenal expression. Dev. Biol. 298:616-631. [DOI] [PubMed] [Google Scholar]
  • 5.Brissova, M., M. Shiota, W. E. Nicholson, M. Gannon, S. M. Knobel, D. W. Piston, C. V. Wright, and A. C. Powers. 2002. Reduction in pancreatic transcription factor PDX-1 impairs glucose-stimulated insulin secretion. J. Biol. Chem. 277:11225-11232. [DOI] [PubMed] [Google Scholar]
  • 6.Chaya, D., and K. S. Zaret. 2004. Sequential chromatin immunoprecipitation from animal tissues. Methods Enzymol. 376:361-372. [DOI] [PubMed] [Google Scholar]
  • 7.Cockell, M., B. J. Stevenson, M. Strubin, O. Hagenbuchle, and P. K. Wellauer. 1989. Identification of a cell-specific DNA-binding activity that interacts with a transcriptional activator of genes expressed in the acinar pancreas. Mol. Cell. Biol. 9:2464-2476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Dutta, S., S. Bonner-Weir, M. Montminy, and C. Wright. 1998. Regulatory factor linked to late-onset diabetes? Nature 392:560. [DOI] [PubMed] [Google Scholar]
  • 9.Fujitani, Y., S. Fujitani, D. F. Boyer, M. Gannon, Y. Kawaguchi, M. Ray, M. Shiota, R. W. Stein, M. A. Magnuson, and C. V. Wright. 2006. Targeted deletion of a cis-regulatory region reveals differential gene dosage requirements for Pdx1 in foregut organ differentiation and pancreas formation. Genes Dev. 20:253-266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gannon, M. 2001. Molecular genetic analysis of diabetes in mice. Trends Genet. 17:S23-S28. [DOI] [PubMed] [Google Scholar]
  • 11.Gannon, M., L. W. Gamer, and C. V. Wright. 2001. Regulatory regions driving developmental and tissue-specific expression of the essential pancreatic gene pdx1. Dev. Biol. 238:185-201. [DOI] [PubMed] [Google Scholar]
  • 12.Gannon, M., M. K. Ray, K. Van Zee, F. Rausa, R. H. Costa, and C. V. Wright. 2000. Persistent expression of HNF6 in islet endocrine cells causes disrupted islet architecture and loss of beta cell function. Development 127:2883-2895. [DOI] [PubMed] [Google Scholar]
  • 13.Gannon, M., and C. V. E. Wright. 1999. Endodermal patterning and organogenesis, p. 583-615. In S. A. Moody (ed.), Cell lineage and fate determination. Academic Press, San Diego, CA.
  • 14.Gerrish, K., M. Gannon, D. Shih, E. Henderson, M. Stoffel, C. V. Wright, and R. Stein. 2000. Pancreatic beta cell-specific transcription of the pdx-1 gene. The role of conserved upstream control regions and their hepatic nuclear factor 3beta sites. J. Biol. Chem. 275:3485-3492. [DOI] [PubMed] [Google Scholar]
  • 15.Gerrish, K., J. C. Van Velkinburgh, and R. Stein. 2004. Conserved transcriptional regulatory domains of the pdx-1 gene. Mol. Endocrinol. 18:533-548. [DOI] [PubMed] [Google Scholar]
  • 16.Glasgow, S. M., R. M. Henke, R. J. Macdonald, C. V. Wright, and J. E. Johnson. 2005. Ptf1a determines GABAergic over glutamatergic neuronal cell fate in the spinal cord dorsal horn. Development 132:5461-5469. [DOI] [PubMed] [Google Scholar]
  • 17.Gu, G., J. Dubauskaite, and D. A. Melton. 2002. Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors. Development 129:2447-2457. [DOI] [PubMed] [Google Scholar]
  • 18.Guz, Y., M. R. Montminy, R. Stein, J. Leonard, L. W. Gamer, C. V. Wright, and G. Teitelman. 1995. Expression of murine STF-1, a putative insulin gene transcription factor, in beta cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121:11-18. [DOI] [PubMed] [Google Scholar]
  • 19.Hansen, S. K., M. Parrizas, M. L. Jensen, S. Pruhova, J. Ek, S. F. Boj, A. Johansen, M. A. Maestro, F. Rivera, H. Eiberg, M. Andel, J. Lebl, O. Pedersen, J. Ferrer, and T. Hansen. 2002. Genetic evidence that HNF-1alpha-dependent transcriptional control of HNF-4alpha is essential for human pancreatic beta cell function. J. Clin. Investig. 110:827-833. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hogan, B., R. Beddington, F. Costantini, and E. Lacy. 1994. Manipulating the mouse embryo, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
  • 21.Hsieh, J. J., T. Henkel, P. Salmon, E. Robey, M. G. Peterson, and S. D. Hayward. 1996. Truncated mammalian Notch1 activates CBF1/RBPJk-repressed genes by a mechanism resembling that of Epstein-Barr virus EBNA2. Mol. Cell. Biol. 16:952-959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Jonsson, J., L. Carlsson, T. Edlund, and H. Edlund. 1994. Insulin-promoter-factor 1 is required for pancreas development in mice. Nature 371:606-609. [DOI] [PubMed] [Google Scholar]
  • 23.Kawaguchi, Y., B. Cooper, M. Gannon, M. Ray, R. J. MacDonald, and C. V. Wright. 2002. The role of the transcriptional regulator Ptf1a in converting intestinal to pancreatic progenitors. Nat. Genet. 32:128-134. [DOI] [PubMed] [Google Scholar]
  • 24.Krapp, A., M. Knofler, S. Frutiger, G. J. Hughes, O. Hagenbuchle, and P. K. Wellauer. 1996. The p48 DNA-binding subunit of transcription factor PTF1 is a new exocrine pancreas-specific basic helix-loop-helix protein. EMBO J. 15:4317-4329. [PMC free article] [PubMed] [Google Scholar]
  • 25.Krapp, A., M. Knofler, B. Ledermann, K. Burki, C. Berney, N. Zoerkler, O. Hagenbuchle, and P. K. Wellauer. 1998. The bHLH protein PTF1-p48 is essential for the formation of the exocrine and the correct spatial organization of the endocrine pancreas. Genes Dev. 12:3752-3763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Larsson, L. I., O. D. Madsen, P. Serup, J. Jonsson, and H. Edlund. 1996. Pancreatic-duodenal homeobox 1—role in gastric endocrine patterning. Mech. Dev. 60:175-184. [DOI] [PubMed] [Google Scholar]
  • 27.Li, H., S. Arber, T. M. Jessell, and H. Edlund. 1999. Selective agenesis of the dorsal pancreas in mice lacking homeobox gene Hlxb9. Nat. Genet. 23:67-70. [DOI] [PubMed] [Google Scholar]
  • 28.Obata, J., M. Yano, H. Mimura, T. Goto, R. Nakayama, Y. Mibu, C. Oka, and M. Kawaichi. 2001. p48 subunit of mouse PTF1 binds to RBP-Jkappa/CBF-1, the intracellular mediator of Notch signalling, and is expressed in the neural tube of early stage embryos. Genes Cells 6:345-360. [DOI] [PubMed] [Google Scholar]
  • 29.O'Brien, R. M., E. L. Noisin, A. Suwanichkul, T. Yamasaki, P. C. Lucas, J. C. Wang, D. R. Powell, and D. K. Granner. 1995. Hepatic nuclear factor 3- and hormone-regulated expression of the phosphoenolpyruvate carboxykinase and insulin-like growth factor-binding protein 1 genes. Mol. Cell. Biol. 15:1747-1758. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Offield, M. F., T. L. Jetton, P. A. Labosky, M. Ray, R. W. Stein, M. A. Magnuson, B. L. Hogan, and C. V. Wright. 1996. PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 122:983-995. [DOI] [PubMed] [Google Scholar]
  • 31.Onuma, H., B. T. Vander Kooi, J. N. Boustead, J. K. Oeser, and R. M. O'Brien. 2006. Correlation between FOXO1a (FKHR) and FOXO3a (FKHRL1) binding and the inhibition of basal glucose-6-phosphatase catalytic subunit gene transcription by insulin. Mol. Endocrinol. 20:2831-2847. [DOI] [PubMed] [Google Scholar]
  • 32.Peshavaria, M., L. Gamer, E. Henderson, G. Teitelman, C. V. Wright, and R. Stein. 1994. XIHbox 8, an endoderm-specific Xenopus homeodomain protein, is closely related to a mammalian insulin gene transcription factor. Mol. Endocrinol. 8:806-816. [DOI] [PubMed] [Google Scholar]
  • 33.Poll, A. V., C. E. Pierreux, L. Lokmane, C. Haumaitre, Y. Achouri, P. Jacquemin, G. G. Rousseau, S. Cereghini, and F. P. Lemaigre. 2006. A vHNF1/TCF2-HNF6 cascade regulates the transcription factor network that controls generation of pancreatic precursor cells. Diabetes 55:61-69. [PubMed] [Google Scholar]
  • 34.Postic, C., M. Shiota, K. D. Niswender, T. L. Jetton, Y. Chen, J. M. Moates, K. D. Shelton, J. Lindner, A. D. Cherrington, and M. A. Magnuson. 1999. Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell-specific gene knock-outs using Cre recombinase. J. Biol. Chem. 274:305-315. [DOI] [PubMed] [Google Scholar]
  • 35.Rose, S. D., F. Kruse, G. H. Swift, R. J. MacDonald, and R. E. Hammer. 1994. A single element of the elastase I enhancer is sufficient to direct transcription selectively to the pancreas and gut. Mol. Cell. Biol. 14:2048-2057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Rose, S. D., G. H. Swift, M. J. Peyton, R. E. Hammer, and R. J. MacDonald. 2001. The role of PTF1-P48 in pancreatic acinar gene expression. J. Biol. Chem. 276:44018-44026. [DOI] [PubMed] [Google Scholar]
  • 37.Rossner, M., and K. M. Yamada. 2004. What's in a picture? The temptation of image manipulation. J. Cell Biol. 166:11-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Samaras, S. E., M. A. Cissell, K. Gerrish, C. V. Wright, M. Gannon, and R. Stein. 2002. Conserved sequences in a tissue-specific regulatory region of the pdx-1 gene mediate transcription in pancreatic β cells: role for hepatocyte nuclear factor 3 β and Pax6. Mol. Cell. Biol. 22:4702-4713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Sasaki, H., and B. L. Hogan. 1996. Enhancer analysis of the mouse HNF-3 beta gene: regulatory elements for node/notochord and floor plate are independent and consist of multiple sub-elements. Genes Cells 1:59-72. [DOI] [PubMed] [Google Scholar]
  • 40.Sawada, S., and D. R. Littman. 1993. A heterodimer of HEB and an E12-related protein interacts with the CD4 enhancer and regulates its activity in T-cell lines. Mol. Cell. Biol. 13:5620-5628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Schwitzgebel, V. M., A. Mamin, T. Brun, B. Ritz-Laser, M. Zaiko, A. Maret, F. R. Jornayvaz, G. E. Theintz, O. Michielin, D. Melloul, and J. Philippe. 2003. Agenesis of human pancreas due to decreased half-life of insulin promoter factor 1. J. Clin. Endocrinol. Metab. 88:4398-4406. [DOI] [PubMed] [Google Scholar]
  • 42.Sellick, G. S., K. T. Barker, I. Stolte-Dijkstra, C. Fleischmann, R. J. Coleman, C. Garrett, A. L. Gloyn, E. L. Edghill, A. T. Hattersley, P. K. Wellauer, G. Goodwin, and R. S. Houlston. 2004. Mutations in PTF1A cause pancreatic and cerebellar agenesis. Nat. Genet. 36:1301-1305. [DOI] [PubMed] [Google Scholar]
  • 43.Shapiro, D. J., P. A. Sharp, W. W. Wahli, and M. J. Keller. 1988. A high-efficiency HeLa cell nuclear transcription extract. DNA 7:47-55. [DOI] [PubMed] [Google Scholar]
  • 44.Sharma, S., J. Leonard, S. Lee, H. D. Chapman, E. H. Leiter, and M. R. Montminy. 1996. Pancreatic islet expression of the homeobox factor STF-1 relies on an E-box motif that binds USF. J. Biol. Chem. 271:2294-2299. [DOI] [PubMed] [Google Scholar]
  • 45.Soriano, P. 1999. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21:70-71. [DOI] [PubMed] [Google Scholar]
  • 46.Stoffers, D. A., J. Ferrer, W. L. Clarke, and J. F. Habener. 1997. Early-onset type-II diabetes mellitus (MODY4) linked to IPF1. Nat. Genet. 17:138-139. [DOI] [PubMed] [Google Scholar]
  • 47.Stoffers, D. A., R. S. Heller, C. P. Miller, and J. F. Habener. 1999. Developmental expression of the homeodomain protein IDX-1 in mice transgenic for an IDX-1 promoter/lacZ transcriptional reporter. Endocrinology 140:5374-5381. [DOI] [PubMed] [Google Scholar]
  • 48.Stoffers, D. A., N. T. Zinkin, V. Stanojevic, W. L. Clarke, and J. F. Habener. 1997. Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 gene coding sequence. Nat. Genet. 15:106-110. [DOI] [PubMed] [Google Scholar]
  • 49.Van Velkinburgh, J. C., S. E. Samaras, K. Gerrish, I. Artner, and R. Stein. 2005. Interactions between areas I and II direct pdx-1 expression specifically to islet cell types of the mature and developing pancreas. J. Biol. Chem. 280:38438-38444. [DOI] [PubMed] [Google Scholar]
  • 50.Weinmann, A. S., S. M. Bartley, T. Zhang, M. Q. Zhang, and P. J. Farnham. 2001. Use of chromatin immunoprecipitation to clone novel E2F target promoters. Mol. Cell. Biol. 21:6820-6832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Wu, K. L., M. Gannon, M. Peshavaria, M. F. Offield, E. Henderson, M. Ray, A. Marks, L. W. Gamer, C. V. Wright, and R. Stein. 1997. Hepatocyte nuclear factor 3β is involved in pancreatic β-cell-specific transcription of the pdx-1 gene. Mol. Cell. Biol. 17:6002-6013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Yamagata, K., T. Nammo, M. Moriwaki, A. Ihara, K. Iizuka, Q. Yang, T. Satoh, M. Li, R. Uenaka, K. Okita, H. Iwahashi, Q. Zhu, Y. Cao, A. Imagawa, Y. Tochino, T. Hanafusa, J. Miyagawa, and Y. Matsuzawa. 2002. Overexpression of dominant-negative mutant hepatocyte nuclear factor-1 alpha in pancreatic beta-cells causes abnormal islet architecture with decreased expression of E-cadherin, reduced beta-cell proliferation, and diabetes. Diabetes 51:114-123. [DOI] [PubMed] [Google Scholar]
  • 53.Yasuda, T., Y. Kajimoto, Y. Fujitani, H. Watada, S. Yamamoto, T. Watarai, Y. Umayahara, M. Matsuhisa, S. Gorogawa, Y. Kuwayama, Y. Tano, Y. Yamasaki, and M. Hori. 2002. PAX6 mutation as a genetic factor common to aniridia and glucose intolerance. Diabetes 51:224-230. [DOI] [PubMed] [Google Scholar]
  • 54.Zhang, H., Y. Fujitani, C. V. E. Wright, and M. Gannon. 2005. Efficient recombination in pancreatic islets by a tamoxifen-inducible Cre-recombinase. Genesis 42:210-217. [DOI] [PubMed] [Google Scholar]

Articles from Molecular and Cellular Biology are provided here courtesy of Taylor & Francis

RESOURCES