Skip to main content
PMC home page
Journal of Virology logoLink to Journal of Virology
. 1996 Jun;70(6):3416–3422. doi: 10.1128/jvi.70.6.3416-3422.1996

Identification of Simian virus 40 promoter DNA sequences capable of conferring restriction endonuclease hypersensitivity.

R Hermansen 1, M A Sierra 1, J Johnson 1, M Friez 1, B Milavetz 1
PMCID: PMC190214  PMID: 8648673

Abstract

The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.

Full Text

The Full Text of this article is available as a PDF (335.8 KB).

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Almer A., Rudolph H., Hinnen A., Hörz W. Removal of positioned nucleosomes from the yeast PHO5 promoter upon PHO5 induction releases additional upstream activating DNA elements. EMBO J. 1986 Oct;5(10):2689–2696. doi: 10.1002/j.1460-2075.1986.tb04552.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ambrose C., Blasquez V., Bina M. A block in initiation of simian virus 40 assembly results in the accumulation of minichromosomes containing an exposed regulatory region. Proc Natl Acad Sci U S A. 1986 May;83(10):3287–3291. doi: 10.1073/pnas.83.10.3287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Baumruker T., Sturm R., Herr W. OBP100 binds remarkably degenerate octamer motifs through specific interactions with flanking sequences. Genes Dev. 1988 Nov;2(11):1400–1413. doi: 10.1101/gad.2.11.1400. [DOI] [PubMed] [Google Scholar]
  4. Carlson M., Laurent B. C. The SNF/SWI family of global transcriptional activators. Curr Opin Cell Biol. 1994 Jun;6(3):396–402. doi: 10.1016/0955-0674(94)90032-9. [DOI] [PubMed] [Google Scholar]
  5. Chasman D. I., Lue N. F., Buchman A. R., LaPointe J. W., Lorch Y., Kornberg R. D. A yeast protein that influences the chromatin structure of UASG and functions as a powerful auxiliary gene activator. Genes Dev. 1990 Apr;4(4):503–514. doi: 10.1101/gad.4.4.503. [DOI] [PubMed] [Google Scholar]
  6. Cremisi C. The appearance of DNase I hypersensitive sites at the 5' end of the late SV40 genes is correlated with the transcriptional switch. Nucleic Acids Res. 1981 Nov 25;9(22):5949–5964. doi: 10.1093/nar/9.22.5949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Gerard R. D., Woodworth-Gutai M., Scott W. A. Deletion mutants which affect the nuclease-sensitive site in simian virus 40 chromatin. Mol Cell Biol. 1982 Jul;2(7):782–788. doi: 10.1128/mcb.2.7.782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Gross D. S., Garrard W. T. Nuclease hypersensitive sites in chromatin. Annu Rev Biochem. 1988;57:159–197. doi: 10.1146/annurev.bi.57.070188.001111. [DOI] [PubMed] [Google Scholar]
  9. Guo Z. S., DePamphilis M. L. Specific transcription factors stimulate simian virus 40 and polyomavirus origins of DNA replication. Mol Cell Biol. 1992 Jun;12(6):2514–2524. doi: 10.1128/mcb.12.6.2514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Harrington R. E. DNA curving and bending in protein-DNA recognition. Mol Microbiol. 1992 Sep;6(18):2549–2555. doi: 10.1111/j.1365-2958.1992.tb01431.x. [DOI] [PubMed] [Google Scholar]
  11. Innis J. W., Scott W. A. DNA replication and chromatin structure of simian virus 40 insertion mutants. Mol Cell Biol. 1984 Aug;4(8):1499–1507. doi: 10.1128/mcb.4.8.1499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Jakobovits E. B., Bratosin S., Aloni Y. A nucleosome-free region in SV40 minichromosomes. Nature. 1980 May 22;285(5762):263–265. doi: 10.1038/285263a0. [DOI] [PubMed] [Google Scholar]
  13. Jakobovits E. B., Bratosin S., Aloni Y. Formation of a nucleosome-free region in SV40 minichromosomes is dependent upon a restricted segment of DNA. Virology. 1982 Jul 30;120(2):340–348. doi: 10.1016/0042-6822(82)90035-6. [DOI] [PubMed] [Google Scholar]
  14. Jantzen H. M., Strähle U., Gloss B., Stewart F., Schmid W., Boshart M., Miksicek R., Schütz G. Cooperativity of glucocorticoid response elements located far upstream of the tyrosine aminotransferase gene. Cell. 1987 Apr 10;49(1):29–38. doi: 10.1016/0092-8674(87)90752-5. [DOI] [PubMed] [Google Scholar]
  15. Jongstra J., Reudelhuber T. L., Oudet P., Benoist C., Chae C. B., Jeltsch J. M., Mathis D. J., Chambon P. Induction of altered chromatin structures by simian virus 40 enhancer and promoter elements. Nature. 1984 Feb 23;307(5953):708–714. doi: 10.1038/307708a0. [DOI] [PubMed] [Google Scholar]
  16. Kerppola T. K., Curran T. Fos-Jun heterodimers and Jun homodimers bend DNA in opposite orientations: implications for transcription factor cooperativity. Cell. 1991 Jul 26;66(2):317–326. doi: 10.1016/0092-8674(91)90621-5. [DOI] [PubMed] [Google Scholar]
  17. Kube D., Milavetz B. Generation of a nucleosome-free promoter region in SV40 does not require T-antigen binding to site I. Virology. 1989 Sep;172(1):100–105. doi: 10.1016/0042-6822(89)90111-6. [DOI] [PubMed] [Google Scholar]
  18. Laundon C. H., Griffith J. D. Curved helix segments can uniquely orient the topology of supertwisted DNA. Cell. 1988 Feb 26;52(4):545–549. doi: 10.1016/0092-8674(88)90467-9. [DOI] [PubMed] [Google Scholar]
  19. Milavetz B. Analysis of the origin-specific nucleosome-free region in SV40 encapsidation intermediates. Virology. 1986 Sep;153(2):310–313. doi: 10.1016/0042-6822(86)90034-6. [DOI] [PubMed] [Google Scholar]
  20. Milavetz B., Hopkins T. Simian virus 40 encapsidation: characterization of early intermediates. J Virol. 1982 Sep;43(3):830–839. doi: 10.1128/jvi.43.3.830-839.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Milavetz B. Oligonucleotide-directed restriction endonuclease digestion. Nucleic Acids Res. 1989 Apr 25;17(8):3322–3322. doi: 10.1093/nar/17.8.3322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Ostrander E. A., Karty R. A., Hallick L. M. High resolution psoralen mapping reveals an altered DNA helical structure in the SV40 regulatory region. Nucleic Acids Res. 1988 Jan 11;16(1):213–227. doi: 10.1093/nar/16.1.213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Peterson C. L., Tamkun J. W. The SWI-SNF complex: a chromatin remodeling machine? Trends Biochem Sci. 1995 Apr;20(4):143–146. doi: 10.1016/s0968-0004(00)88990-2. [DOI] [PubMed] [Google Scholar]
  24. Piña B., Brüggemeier U., Beato M. Nucleosome positioning modulates accessibility of regulatory proteins to the mouse mammary tumor virus promoter. Cell. 1990 Mar 9;60(5):719–731. doi: 10.1016/0092-8674(90)90087-u. [DOI] [PubMed] [Google Scholar]
  25. Reik A., Schütz G., Stewart A. F. Glucocorticoids are required for establishment and maintenance of an alteration in chromatin structure: induction leads to a reversible disruption of nucleosomes over an enhancer. EMBO J. 1991 Sep;10(9):2569–2576. doi: 10.1002/j.1460-2075.1991.tb07797.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Richard-Foy H., Hager G. L. Sequence-specific positioning of nucleosomes over the steroid-inducible MMTV promoter. EMBO J. 1987 Aug;6(8):2321–2328. doi: 10.1002/j.1460-2075.1987.tb02507.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Richard-Foy H. Transcriptional activation. A way into the packaging. Nature. 1994 Aug 11;370(6489):417–418. doi: 10.1038/370417a0. [DOI] [PubMed] [Google Scholar]
  28. Sanger F., Nicklen S., Coulson A. R. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A. 1977 Dec;74(12):5463–5467. doi: 10.1073/pnas.74.12.5463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Saragosti S., Cereghini S., Yaniv M. Fine structure of the regulatory region of simian virus 40 minichromosomes revealed by DNAase I digestion. J Mol Biol. 1982 Sep 15;160(2):133–146. doi: 10.1016/0022-2836(82)90171-1. [DOI] [PubMed] [Google Scholar]
  30. Saragosti S., Moyne G., Yaniv M. Absence of nucleosomes in a fraction of SV40 chromatin between the origin of replication and the region coding for the late leader RNA. Cell. 1980 May;20(1):65–73. doi: 10.1016/0092-8674(80)90235-4. [DOI] [PubMed] [Google Scholar]
  31. Scott W. A., Walter C. F., Cryer B. L. Barriers to nuclease Bal31 digestion across specific sites in simian virus 40 chromatin. Mol Cell Biol. 1984 Apr;4(4):604–610. doi: 10.1128/mcb.4.4.604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Scott W. A., Wigmore D. J. Sites in simian virus 40 chromatin which are preferentially cleaved by endonucleases. Cell. 1978 Dec;15(4):1511–1518. doi: 10.1016/0092-8674(78)90073-9. [DOI] [PubMed] [Google Scholar]
  33. Shelton E. R., Wassarman P. M., DePamphilis M. L. Structure, spacing, and phasing of nucleosomes on isolated forms of mature simian virus 40 chromosomes. J Biol Chem. 1980 Jan 25;255(2):771–782. [PubMed] [Google Scholar]
  34. Shenk T. Construction of a viable SV40 variant containing two functional origins of DNA replication. Cell. 1978 Apr;13(4):791–798. doi: 10.1016/0092-8674(78)90229-5. [DOI] [PubMed] [Google Scholar]
  35. Shrader T. E., Crothers D. M. Artificial nucleosome positioning sequences. Proc Natl Acad Sci U S A. 1989 Oct;86(19):7418–7422. doi: 10.1073/pnas.86.19.7418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Tack L. C., Wassarman P. M., DePamphilis M. L. Chromatin assembly. Relationship of chromatin structure to DNA sequence during simian virus 40 replication. J Biol Chem. 1981 Aug 25;256(16):8821–8828. [PubMed] [Google Scholar]
  37. Travers A. A. Why bend DNA? Cell. 1990 Jan 26;60(2):177–180. doi: 10.1016/0092-8674(90)90729-x. [DOI] [PubMed] [Google Scholar]
  38. Varshavsky A. J., Sundin O. H., Bohn M. J. SV40 viral minichromosome: preferential exposure of the origin of replication as probed by restriction endonucleases. Nucleic Acids Res. 1978 Oct;5(10):3469–3477. doi: 10.1093/nar/5.10.3469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Vogel K., Hörz W., Hinnen A. The two positively acting regulatory proteins PHO2 and PHO4 physically interact with PHO5 upstream activation regions. Mol Cell Biol. 1989 May;9(5):2050–2057. doi: 10.1128/mcb.9.5.2050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Wigmore D. J., Eaton R. W., Scott W. A. Endonuclease-sensitive regions in SV40 chromatin from cells infected with duplicated mutants. Virology. 1980 Jul 30;104(2):462–473. doi: 10.1016/0042-6822(80)90348-7. [DOI] [PubMed] [Google Scholar]
  41. Wildeman A. G. Regulation of SV40 early gene expression. Biochem Cell Biol. 1988 Jun;66(6):567–577. doi: 10.1139/o88-067. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES