Skip to main content
NCBI home page
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 1998 Apr;112(1):152–158. doi: 10.1046/j.1365-2249.1998.00558.x

The value of synthetic linear epitope analogues of La/SSB for the detection of autoantibodies to La/SSB; specificity, sensitivity and comparison of methods

E E Yiannaki *, A G Tzioufas *, M Bachmann *, J Hantoumi *, V Tsikaris †, M Sakarellos-Daitsiotis †, C Sakarellos †, H M Moutsopoulos *
PMCID: PMC1904932  PMID: 9566804

Abstract

In a previous study it was shown that La/SSB contains four linear epitopes, p147–154, p291–302, p301–318 and p349–364. The aim of the present study was to investigate the value of the synthetic epitope analogues of the La/SSB autoantigen for the detection of antibodies to La/SSB, in comparison with recombinant La and fragments of this protein. A total of 122 sera with anti-La/SSB activity, from patients with primary Sjögren's syndrome (pSS) or systemic lupus erythematosus (SLE), were tested in various peptide-based assays. In addition, 62 sera from pSS or SLE patients with other autoantibody specificities and 95 sera from healthy individuals were used as controls. The autoantibody specificity was identified by counter immunoelectrophoresis and immunoblot. The peptide-based ELISA assays presented sensitivities ranging from 78% to 88.8% and specificities from 69% to 94.3%. Dot blot assays exhibited sensitivities ranging from 93.6% to 97%, but remarkably lower specificities from 56% to 88%. The most sensitive and specific peptide 349GSGKGKVQFQGKKTKF364 was synthesized and attached on a tetramer sequential oligopeptide carrier SOC4 and used for immunoassay development. Assays based on the recombinant native La protein, the La-C terminal (215 aa), and the N-terminal of La with a mutation at base pair 640 (nine adenines instead of eight) were also developed and compared with the SOC4 peptide-based assay. Of anti-La-positive sera, 88.1% were reactive with both the synthetic peptide SOC4-(349–364aa) and the recombinant La protein. Eighty-three percent of sera were reactive with the La N-terminus and 67.8% of sera were reactive with the La C-terminus. Using sera that were anti-Ro-positive but anti-La-negative, 37% were reactive with the recombinant protein, 26% with the La N-terminus, 33% with the La C-terminus and only 11% with the synthetic peptide. Our results suggest that the synthetic peptide epitopes exhibit high sensitivity and specificity for the detection of anti-La/SSB antibodies in ELISA and dot blot techniques. The peptide SOC4-(349–364aa) has the same sensitivity for the detection of anti-La/SSB antibodies as the recombinant protein.

Keywords: B cell epitopes, La/SSB, Sjögren's syndrome, systemic lupus erythematosus, diagnostic value

INTRODUCTION

Anti-La/SSB antibodies belong to a clinically important group of antinuclear antibodies that recognize ribonucleoprotein autoantigens [1]. These autoantibodies are detected in 40–87% of sera of patients with primary Sjögren's syndrome (pSS) [2,3] and in 10–15% of sera of systemic lupus erythematosus (SLE) patients [4].

Anti-La/SSB antibodies can be detected by several assays. These antibodies give nuclear immunofluorescence patterns identical to the patterns of some other antinuclear antibodies [5]; immunodiffusion (ID) and counter immunoelectrophoresis (CIE) are rather specific methods for the detection of anti-La/SSB antibodies [6]. Immunoblotting, an efficient and sensitive method for the detection of anti-La/SSB antibodies, is technically laborious and difficult to interpret, since La/SSB co-migrates with one of the Ro/SSA proteins (Ro52). Immunoprecipitation is a specific and sensitive method but needs a specific armamentarium and can not be used as a method for routine clinical practice. ELISA using recombinant or affinity-purified protein is an easy method but gives low specificity.

Recently, four linear distinct B cell epitopes of the La/SSB autoantigen have been detected, using overlapping synthetic peptides. These epitopes were recognized by anti-La/SSB-positive sera from pSS and SLE patients [7] (HKAFKGSI (147–154), NGNLQLRNKEVT (291–302), VTWEVLEGEVEKEALKKI (301–318) and GSGKGKVQFQGKKTKF (349–364)). Preliminary studies showed that soluble free peptides could be used as substrates for the detection of anti-La/SSB antibodies in tests exhibiting high sensitivity and specificity. This observation prompted us to investigate whether larger synthetic peptide analogues can be used in simple, easy to perform assays. Using these antigenic peptide analogues as well as peptides attached on sequential oligopeptide carriers (SOC) [8–10] as substrates we have developed a peptide-based ELISA and dot blot for the detection of anti-La/SSB antibodies. These assays were compared with ELISA using recombinant La/SSB.

PATIENTS AND METHODS

Sera

A hundred and eighty-four patients with pSS [11] and SLE [12] with anti-La/SSB reactivity were tested. Anti-La/SSB reactivity was determined using CIE and Western blot, as previously described [7]. Sixty-three sera were tested against the soluble free peptides, which were immobilized in the ELISA and dot blot techniques [7]. Fifty-nine sera were tested against the recombinant La/SSB protein, parts of this protein and the most sensitive epitope for anti-La/SSB antibody detection, the peptide 349–364aa, attached on SOC4. Fourteen sera also contained anti-Ro60-kD and anti-Ro52-kD antibodies, 26 sera had anti-Ro60-kD antibodies, 11 sera had antibodies against Ro52-kD and eight had anti-La/SSB reactivity alone. Sixty-two sera of pSS and SLE patients negative for anti-La/SSB antibodies were used as disease controls. These sera contained various autoantibodies, as follows: 43 had antibodies to Ro60-kD, 16 had antibodies to Ro52-kD, eight had antibodies to dsDNA, 12 had antibodies to U1RNP, and eight sera had antibodies to Sm. A total of 95 normal sera were used in different assays to define the cut off point.

Peptide synthesis and purification

Eight peptides were synthesized by the solid-phase synthetic method [13] using benzydrylamine resin as an anchor bond and Nα-t-Boc/benzyl-side chain protection. Amino acid couplings were performed by the dicyclohexyl carbodiimide (DCC)/hydroxybenzotriazole (HOBt) procedure using a molar ratio of amino acid/DCC/HOBt/resin 3:3.3:3:1, and by the benzotriazolyloxytris (dimethylamino) phosphonium hexafluorophosphate (BOP reagent) [14] using a ratio of amino acid/BOP/di-isopropylethylamine (DIEA)/resin 2:2:6:1 for difficult couplings. Deprotection of the a-amino groups from the Nα-t-Boc protecting groups was performed using trifluoroacetic acid (TFA) followed by DIEA for neutralization. Acetylation, in some cases, was carried out using 30 equiv. of (CH3CO)2O in pyridine for 25 min. The peptides were cleaved from the resin with anhydrous hydrogen fluoride (HF) in the presence of anisol and phenol (10% v/v) as scavengers and ethanedithiol (EDT) when Trp was present in the amino acid sequence [15] at −8°C for 30 min and 0°C for 1 h. The peptides were extracted from the resin using 2 m acetic acid and after lyophilization they were subjected to partition chromatographic purification using a Sephadex G-25 column equilibrated with 2 m aqueous acetic acid. Elution of the peptides was performed using a homogeneous mixture of n-butanol/pyridine/acetic acid/H2O (BPyAW) in a ratio 4:1:1:2 v/v. The peptides were subjected to high performance liquid chromatographic purification (HPLC). Elution of the peptide was performed using a gradient mixture of distilled H2O and acetonitrile spanning from 95:5 v/v d.H2O:CH3CN to 40:60 v/v d.H2O:CH3CN containing 0.1% v/v TFA. The purity of the peptides was confirmed by analytical HPLC, 1-D and 2-D H-NMR spectroscopy.

The Boc-Gly OCH2-Pam resin was used for the synthesis of the sequential oligopeptide carrier. Amino acid couplings were performed by the 2-(1H-benzotriazole-1-yl)-1,1,3,3-tetramethyluronium tetrafluoroborate TBTU/HOBt/DIEA procedure using a ratio of amino acid/TBTU/HOBt/DIEA/resin 3:2.9:3:6:1 [16]. The Na-Boc-L-Lys (Nε-Fmoc)-OH was used for lysine coupling. After cleavage of the Nε-Fmoc groups, using 20% v/v piperidine in DMF, the antigenic peptide was built simultaneously, step by step with attachment to the SOC4 by the Lys-NεH2 groups. The following steps of synthesis and cleavage from the resin were the same as above. The SOC4 peptide was dialysed against water using dialysis tubes with molecular mass cut off of ≈ 1500 and lyophilized.

All peptides were also synthesized in biotinylated form. Biotinylation occurred after the addition of a four amino acid spacer (-Gly-Ser-Gly-Ser-) [17], using d-biotin to the N-terminus and after Boc deprotection, following the standard solid-phase procedure. All peptides were subjected to amino analysis, which confirmed their purity and identity.

La recombinant peptides

Three recombinant La peptides were prepared as previously described [18,19]. The La protein reading frames of the La peptides were originally isolated and prepared from a La cDNA containing a single (A)-nucleotide residue insert (Dr Stahnke, ELIAS, Freiburg, Germany). The full-length construct was cloned as follows. The cloning started from the La cDNA La23 in pBluescript SK(-). As La23 contained a deletion of a single (A)-nucleotide residue in the exon 7 which caused a (−1) frame shift mutation within the coding region we had to correct this by inserting an (A)-nucleotide.

First, the core portion of the La cDNA (spanning from the Kpn I site to the Ava II site) was isolated. The 5′- and 3′-portions were modified by use of a polymerase chain reaction (PCR) technique. For the 3′-portion we used P1 (P1: CGAAATTTGCTAGTGATGATGAACA) as the upstream primer and P2 (P2: TGGTTTGGATCCCTACTGGTCTCCAG; the artificial Bam HI site neighbouring the stop codon TAG (CTA) is underlined) as downstream primer. The resulting fragment was cut with Ava II and Bam HI and subcloned into pBluescript SK(-). The 5′-end was created as follows. In the regular La mRNA form translation starts at the first AUG located in exon 2. Such a 5′-terminal construct was prepared from the cDNA La23 by PCR using the P3 (P3: ACATAGGATCCATGGCTGAAAATGGT; the artificial Bam HI neighbouring the translational start ATG is underlined) as the upstream primer and P4 (P4: TGTTGTTAGACGGTTCAACCTGTTG) as the downstream primer. The PCR fragment was cleaved by Bam HI and Kpn I and cloned into the corresponding sites of pBluescript SK(-). The insert was isolated using the Nco I/Bam HI sites and cloned into the respective cloning sites of the pQE-60W vector. Thereby a C-terminally His-tagged La protein construct was obtained. The insert was isolated and further subcloned into the expression vector pET-3d using the Nco I/Hind III sites. Finally the reading frame was corrected as follows. La19 cDNA containing the correct La coding sequence was restricted with Bst EII, which cleaved at exon 10 of the La sequence, and Kpn I, which cleaved at exon 3 of the La sequence. The pET-3d construct was linearized with Bst EII and after isolation of the linearized DNA partially digested with Kpn l. Then the Kpn I/Bst EII fragment of La19 was cloned in the respective sites of the pET-3d construct. The final construct was sequenced.

ELISA

The 96-well polystyrene plates were coated with 10 μg/ml peptides (in the case of biotinylated peptides the plates were pretreated with 5 μg/ml streptavidin), 5 μg/ml SOC4-(349–364aa) peptide, recombinant La protein, N-terminus and C-terminus fragment (100 μl/well) and kept for 4 h at 37°C (until complete evaporation). Afterwards, 200 μl of bovine serum albumin (BSA) 2% in PBS pH 7.3 were added per well and the plates were incubated at room temperature for 1 h. After two washing steps with PBS–0.1% Tween 20, sera were added at 1:100 dilution in BSA 2% in PBS (100 μl/well) in duplicate and in both peptide-coated and non-coated wells. After an overnight incubation at 4°C and four washing steps with PBS–0.1% Tween 20, 100 μl of anti-human IgG (γ) peroxidase goat-conjugated antibodies (Sigma) diluted 1:1500 in BSA 2% in PBS were added per well. Following 1 h incubation at room temperature and five washings, 100 μl substrate solution of 2,2′azino-bis 3-ethylbenzothiazoline sulphonic acid (ABTS) were added and the absorbance of the colour was measured at 405 nm after 30 min. Preliminary experiments using different concentrations of all reagents in different tests were used to define the optimal conditions of all ELISA developments. The real binding was calculated by subtracting the mean optical density (OD) of the sample in the non-peptide-coated well from the mean OD of the peptide-coated wells. The cut off point of positivity was calculated as the mean OD of the normal sera + 3 s.d.

Dot blot

One microlitre aliquots of the peptides diluted in distilled water in a concentration 4 mg/ml were spotted on nitrocellulose membranes (0.45 μm pore size), incubated with blocking buffer (0.5% BSA, 1.5% ovalbumin in TBS–0.1% Tween 20) for 1 h and then with diluted sera (1:50) in blocking buffer at 4°C overnight. After three washes with TBS–0.1% Tween 20 pH 7.3, a solution of anti-human IgG (γ) peroxidase goat conjugated antibodies diluted 1:800 in blocking buffer was added and allowed to react for 1 h. The membranes were washed and the colour was developed by adding 4-chloro-1-naphthol as substrate.

Inhibition assays

Anti-La/SSB-positive sera reacting with the four synthetic B cell epitope analogues in dilutions 1:50, 1:100, 1:200, 1:400 were incubated with the soluble peptides (0, 0.5, 1, 5, 10, 50, 100, 200 μg/ml) overnight at 4°C. These mixtures were tested against the peptide-coated ELISA plates.

An anti-La/SSB-positive serum from a pSS patient, with high anti-La/SSB activity, reacting with all four synthetic epitope analogues, was incubated with the peptides 145–164aa, 289–308aa and a mixture of peptides 145–164aa, 289–308aa, 301–318aa and 349–364aa in concentrations of 0, 0.01, 0.5, 1, 5, 10, 50, 100 μg/ml each for 3 h at 37°C and overnight at 4°C. Afterwards they were tested in an anti-La/SSB ELISA (Shield Diagnostics, Diastat, UK) according to manufacturer's instructions.

Two other anti-La/SSB-positive sera were incubated with the SOC4-(349–364aa) peptide in concentrations 0, 0.01, 0.5, 1, 5, 10, 50 μg/ml overnight at 4°C. Sera preincubated with the synthetic peptide were tested against the recombinant La protein and the La C-terminus. Recombinant La protein and La C-terminus were coated in a concentration of 5 μg/ml.

Intra-assay/interassay specificity and sensitivity, statistical analysis

The sensitivity of the ELISAs with the synthetic peptides was calculated as follows: sensitivity (%) = (number of positive samples/total samples) × 100. The specificity was calculated according to the formula: specificity (%) = (1 − number of positive disease controls/number of total disease controls) × 100.

RESULTS

Homologous inhibition

Preincubation of sera, specific for the antigenic peptides 301–318 (18aa), 349–364 (16aa), 145–164 (20aa) and 289–308 (20aa), with soluble peptides showed the highest homologous inhibition at serum dilutions 1:50, 1:100, 1:200, 1:50, respectively, at a peptide concentration ≥ 50 μg/ml (Fig. 1a).

Fig. 1.

Fig. 1

Open in a new tab

(a) Homologous inhibition of anti-La/SSB antibodies binding on ELISA plates, coated with p145–164, p289–308, p301–320 and p349–368. The best inhibition values were obtained at sera dilutions: 1:200 for p145–164, 1:50 for p289–308, 1:50 for p301–318 and 1:50 for p349–364. (b) Inhibition of anti-La/SSB antibody binding in anti-La/SSB ELISA, using as inhibitors different concentrations of the synthetic peptides p145–164, p289–308 and a mixture of all four synthetic peptides (each one contributing to the solution by 25%). Anti-La/SSB sera were used in dilution 1:500. (c) Inhibition of antibody binding to recombinant La/SSB protein and La C fragment ELISA, using as inhibitor the synthetic peptide SOC4-(349–364aa).

Preincubation of sera with the synthetic peptides and testing in an anti-La/SSB ELISA showed an inhibition of antibody binding not greater than 60%. Serum preincubated with the mixture of peptides gave a maximum inhibition of 73% (Fig. 1b).

The greatest inhibition of the recombinant La protein and the La C-terminus ELISA, using the SOC4-(349–364aa) peptide, was 60% and 80%, respectively (Fig. 1c).

Recovery of sensitivity of the two short epitopes

In order to increase the sensitivity, the antigenic peptides 147–154aa and 291–302aa were resynthesized in the initial full length 145–164aa and 289–308aa, respectively, in the biotinylated and non-biotinylated forms. Both forms were tested against the same sera (63 anti-La/SSB-positive, 35 disease controls (all anti-Ro60-kD-positive [7]), 41 healthy blood donor sera) with ELISA. It was found that the two 20mer peptides regained their sensitivity. The epitope TLHKAFKGSIFVVFDSIESA (145–164), which incorporates the previously reported limited epitope HKAFKGSI (147–154) (reacting with 30% of sera) was recognized by 49 out of 63 anti-La/SSB-positive sera (78%) (Fig. 2a). Fifty-one out of 63 anti-La/SSB-positive sera reacted with the full length peptide ANNGNLQLRNKEVTWEVLEG (289–308) (82.5%), which contained the short epitope NGNLQLRNKEVT (291–302), reacting with 27% of sera (Fig. 2b).

Fig. 2.

Fig. 2

Open in a new tab

Prevalence of antibodies to 145TLHKAFKGSIFVVFDSIESA164 (a) and 289ANNGNLQLRNKEVTWEVLEG308 (b) synthetic epitope analogues in sera from patients with primary Sjögren's syndrome (pSS) and systemic lupus erythematosus (SLE) with anti-La/SSB antibodies, patients with pSS and SLE without anti-La/SSB antibodies and normal controls. The cut off point was calculated using the mean optical density (OD) of normal control sera + 3 s.d.

Four sera from the disease control group were found reactive with both 20mer peptides. These four sera have been reported as anti-La/SSB-negative by CIE, but after careful examination with immunoblot two of them (with the higher OD) were found to be anti-La-positive (94.3% specificity for both peptides). Thus, the prevalence of anti-p145–164aa and anti-p289–308aa antibodies among anti-Ro/SSA-positive sera was 5.7%.

Antibody levels against the peptides p145–164 and p289–308 were highly correlated with each other (r = 0.868, P < 0.001, concordance 92.1%) There was no correlation of antibody binding between any other combination of peptides. The concordance between peptide-based assays ranged from 64% to 79.4%.

Dot blot using as substrates the La/SSB peptide analogues

The qualitative analysis of the autoantibodies directed against the short epitopes 147–154 (8aa), 291–302 (12aa), 301–318 (18aa), 349–364 (16aa) and the longer peptides 145–164 (20aa) and 289–308 (20aa) was performed using the dot blot technique.

Sixty out of 63 anti-La/SSB-positive sera (93.6%) bound to the p145–164 (20aa) and 61 out of 63 of these sera (97%) bound the p289–308 (20aa). Forty-six and 59 out of 63 positive anti-La/SSB sera recognized the 301–318 (18aa) and 349–364 (16aa) antigenic peptides, respectively. The interassay concordance in each individual peptide assay was significantly high (81%, 86%, 78% and 89% for the peptides 145–164aa, 289–308aa, 301–318aa and 349–364aa, respectively) (Fig. 3).

Fig. 3.

Fig. 3

Open in a new tab

Comparison of ELISA (▪) and dot-blot (□) assays, for the detection of anti-La/SSB antibodies from primary Sjögren's syndrome (pSS) and systemic lupus erythematosus (SLE) patients using synthetic peptides. The numbers on the abscissa represent the number of peptides reacting with each serum. Two out of 63 anti-La/SSB-positive sera (3%) did not react with any of the peptides, while 54% of sera reacted with all four peptides in ELISA. In dot blot one out of 63 (1.6%) serum samples did not react with any of the peptides, while 71% of sera reacted with all four peptides.

The dot blot was more sensitive than ELISA, but with lower specificity (specificity 76% for p145–164, 56% for p289–308, 88% for p301–318 and 72% for p349–364). The p289–308 (20aa) showed the highest sensitivity in dot blot but lower specificity when it was used against disease control sera. The two short peptides 147–154 (8aa) and 291–302 (12aa) showed no reactivity with this technique.

Comparison of the SOC4-(349–364aa) synthetic epitope analogue with the recombinant La/SSB protein

Fifty-nine anti-La/SSB and anti-Ro/SSA-positive sera, 27 anti-Ro/SSA-positive sera from patients with pSS and SLE as well as 54 normal blood donors were tested by ELISA against recombinant La/SSB (Fig. 4a), La N-terminus, La C-terminus and SOC4-(349–364aa) synthetic peptide (Fig. 4b). Using a cut off value corresponding to mean OD + 3 s.d., it was found that 88.1%, 83%, 67.8% (not shown) and 88.1% of anti-La/SSB-positive sera reacted with the La/SSB, La N-terminus, La C-terminus and the synthetic peptide, respectively. The synthetic peptide exhibited high specificity (89%), while the recombinant La/SSB, La N-terminus and La C-terminus showed lower specificity (63%, 74% and 67%, respectively).

Fig. 4.

Fig. 4

Open in a new tab

Prevalence of antibodies to recombinant La/SSB protein (a) and SOC4-(349–364aa) synthetic epitope analogue (b) in sera from patients with primary Sjögren's syndrome (pSS) and systemic lupus erythematosus (SLE) with anti-La/SSB antibodies, patients with pSS and SLE without anti-La/SSB antibodies and normal controls. The cut off point was calculated using the mean optical density (OD) of normal control sera + 3 s.d.

The sensitivity using recombinant La/SSB or SOC4-(349–364aa) peptide was almost the same. These assays presented high concordance (80%), but the assay using the synthetic peptide appeared to be more specific. Assays using as antigen the recombinant La/SSB protein or La N-terminus fraction gave high concordance (85%) and high sensitivity.

DISCUSSION

The present study indicates that four synthetic peptide analogues corresponding to the previously assigned major linear antigenic epitopes of La/SSB [7] can be used in ELISA and dot blot for the detection of anti-La/SSB antibodies from both pSS and SLE patients. Most healthy controls and disease control sera were found to be negative in these assays. The correlation of ELISA with dot blot and CIE was high; the sensitivity of ELISA, using these peptides as antigens, ranged from 73% to 88.1% and that of dot blot ranged from 73% to 97%.

The dot blot was used as an additional way to confirm the results obtained by ELISA. This method presented higher sensitivity but remarkably lower specificity compared with the ELISA. The short peptides (8aa and 12aa) had no reactivity with this technique, possibly because they were not retained by the 0.45 μm pore size nitrocellulose membrane [20] and/or because of their low antigenicity already evident with the ELISA technique [7]. By contrast, the two 20mer p289–308 and p145–164 peptides and the shorter p301–318 and p349–364 gave high sensitivities.

All 63 anti-La/SSB-positive sera reacted with at least one synthetic epitope analogue. One anti-La/SSB-positive serum did not react in dot blot but was found to be reactive against p349–364 in ELISA. Two other anti-La/SSB-positive sera were negative by ELISA but positive by the p145–164 and p289–308 dot blots. These differences may be explained by interassay variation as well as by differences in the practical approach of each technique.

As shown previously, the restricted epitopes p147–154 and p291–302 presented the lowest antigenicity [7]. Increasing the length of these peptides to the size originally shown to be reactive (20mer peptides) showed a significant recovery of their antigenic properties. This observation can be explained as follows. First, it was shown that substitution of W303 by alanine resulted in significant loss of antigenicity of the epitope ANNGNLQLRNKEVTWEVLEQ (289–308); this residue was not included in the restricted epitope of the 12aa (291–302). Second, the epitope 145–164 is a part of the RNP motif of the La/SSB protein [21], and it attains a helical conformation containing a β loop structure [7]. It has been postulated that a length greater than 15 residues is rather necessary to stabilize an α helix in water environment [22]. In this regard, the previously synthesized 8mer epitope (147–154) could not adopt the necessary conformation in order to be recognized by the anti-La/SSB antibodies [23]. These two enlarged epitopes inhibited partly the binding of antibodies to native La/SSB protein, being targets for a significant population of anti-La/SSB antibodies.

There was no correlation of antibodies against the peptides 289–308aa and 301–318aa, though these epitopes share 8aa in common. Hence, these regions consist of two different continuous linear epitopes being targets of two distinct antibody populations.

To investigate further the value of these La/SSB synthetic epitope analogues for detecting anti-La/SSB autoantibodies, they were compared with the recombinant La protein and with large fragments of this protein as the antigen. A number of sera were tested against the recombinant native La protein, the La C-terminus part (215aa), the N-terminus fraction of La with a mutation at base pair 640 (nine adenines instead of eight), and with the epitope 349–364aa which presented the highest sensitivity and specificity from previous studies. With the aim of increasing the antigenicity of the 349–364aa epitope, it was anchored on a SOC. Previous studies [8] have shown that this carrier adopts a regular 310 helical structure, in which the attached antigenic peptides do not interact with each other and retain their original conformation; hence potent antigens can be obtained.

Both the synthetic peptide and the native La protein exhibited the same sensitivity, 88.1%. The concordance between the two assays was also high at 80%, but the synthetic peptide had greater specificity, 89% versus 63%, when anti-Ro-positive but anti-La-negative sera were tested. This observation can be explained in two ways. First, anti-Ro-positive sera may also contain a small amount of anti-La/SSB antibodies, directed against epitopes other than the p349–364 region. Second, false-positive results have been reported in assays using recombinant antigen [24]. This has been attributed to contaminants from the expression system.

A significant number of sera also reacted with the La N-terminus and La C-terminus. It is also interesting that the antigenicity of the two peptides is significantly correlated, implying that the anti-La/SSB sera assay contained constrained autoantibody diversity against these two epitopes. Similar observations have been previously reported [25], suggesting that these epitopes are located on the same exposed portion of the autoantigen, which is recognized by specific autoreactive B cell clones. These results, in conjunction with the high inhibition level produced by the peptide against the native La protein, suggest that the detection of anti-La antibodies using synthetic peptide epitopes presents the same sensitivity as the recombinant protein. In addition, it is confirmed that a large panel of anti-La sera contains antibodies also directed against the mutated N-terminus of the autoantigen [18].

The concordance between SOC4-(349–364aa) and the La C-terminus was low (56%), despite the fact that the peptide is part of this region. Three sera reacted with the synthetic peptide but they did not bind to recombinant La or any of its fractions. On the other hand, five sera did not react with the synthetic peptide, but they reacted with all recombinant proteins, so it is very probable that antibodies against conformational epitopes occur in these sera. The majority of anti-La/SSB-positive sera reacted with the peptide but not with the recombinant La C-terminus, suggesting that these antibodies are directed towards denatured or degraded parts of La/SSB, rather than the whole molecule. Hence, the 349–364 peptide is the major epitope of La/SSB in its carboxyterminus end.

The use of small length antigenic peptides to detect anti-La/SSB antibodies has been tested in a few previous studies. The failure of binding of anti-La/SSB human positive sera to synthetic La peptides reported previously [26] was probably due to an incomplete survey of sequential epitopes, excluding peptides that we found to be reactive. These four antigenic La peptides proved to be very sensitive and highly specific using the ELISA and dot blot. Their solubility, high sensitivity and specificity, and easy applicability to the detection of anti-La/SSB antibodies permit their production in large amounts for routine use.

Acknowledgments

E.E.Y., A.G.T. and J.H. were supported by a grant from the Greek Secretariat of Research and Technology (EKBAN Π-45). A.G.T. has been partly supported by a grant from the Hellenic Rheumatology Society.

References

  • 1.Tan EM. Antinuclear antibodies: diagnostic markers for autoimmune disease and probes for cell biology. Adv Immunol. 1989;44:93–151. doi: 10.1016/s0065-2776(08)60641-0. [DOI] [PubMed] [Google Scholar]
  • 2.Manoussakis MN, Tzioufas AG, Pange PJE, Moutsopoulos HM. Serological profiles in subgroups of patients with Sjögren's syndrome. Scand J Reumatol. 1986;61:89–92. [PubMed] [Google Scholar]
  • 3.Harley JB, Alexander EL, Bias WB, Fox OF, Provost TT, Reichlin M, Yamagata H, Arnett FC. Anti-Ro (SSA) and anti-La (SS-B) in patients with Sjögren's syndrome. Arthritis Rheum. 1986;29:196–205. doi: 10.1002/art.1780290207. [DOI] [PubMed] [Google Scholar]
  • 4.Andonopoulos AP, Skopouli FN, Dimou GS, Drosos AA, Moutsopoulos HM. Sjögren's syndrome in systemic lupus erythematosus. J Reumatol. 1990;17:201–4. [PubMed] [Google Scholar]
  • 5.Pruijn GJM. Vol. 2. The Netherlands: Kluwer Academic Publishers; 1994. The La (SS-B) antigen. Manual of biological markers of disease; pp. 1–14. [Google Scholar]
  • 6.Meilof JF, Bantjes I, De Jong J, Van Dam AP, Smeenk RJT. The detection of anti-Ro/SS-A and anti-La/SS-B antibodies. A comparison of counterimmunoelectrophoresis with immunoblot, ELISA and RNA-precipitation assays. J Immunol Methods. 1990;133:215–26. doi: 10.1016/0022-1759(90)90362-y. [DOI] [PubMed] [Google Scholar]
  • 7.Tzioufas AG, Yiannaki E, Sakarellos-Daitsiotis M, Routsias JG, Sakarellos C, Moutsopoulos HM. Fine specificity of autoantibodies to La/SSB. Epitope mapping molecular mimicry and clinical applications. Clin Exp Immunol. 1997;108:191–8. doi: 10.1046/j.1365-2249.1997.d01-1003.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Tsikaris V, Sakarellos C, Cung-Thong M, Marraud M, Sakarellos-Daitsiotis M. Concept and design of a new class of sequential oligopeptides carriers (SOC) for covalent attachment of multiple antigenic peptides. Biopolymer. 1996;38:291–3. doi: 10.1002/(SICI)1097-0282(199603)38:3%3C291::AID-BIP1%3E3.0.CO;2-P. [DOI] [PubMed] [Google Scholar]
  • 9.Tsikaris V, Sakarellos C, Sakarellos-Daitsiotis M, Cung MT, Marraud M, Konidou G, Tzinia A, Soteriadou KP. Use of sequential oligopeptide carriers (SOCn) in the design of potent Leishmania gp63 immunogenic peptides. Peptide Res. 1996;9:240–7. [PubMed] [Google Scholar]
  • 10.Tsikaris V, Sakarellos C, Sakarellos-Daitsiotis M, Orlewski P, Marraud M, Cung MT, Vatzaki E, Tzartos S. Construction and application of a new class of sequential oligopeptide carriers (SOCn) for multiple anchoring of antigenic peptides—application to the acetylcholine receptor (AChR) main immunogenic region. Biol Macromol. 1996;19:195–205. doi: 10.1016/0141-8130(96)01128-2. [DOI] [PubMed] [Google Scholar]
  • 11.Vitali C, Bombardieri S, Moutsopoulos HM, et al. Preliminary criteria for the classification of Sjögren's syndrome. Arthritis Rheum. 1993;36:340–7. doi: 10.1002/art.1780360309. [DOI] [PubMed] [Google Scholar]
  • 12.Tan EM, Cohen AS, Fries JF, et al. The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum. 1982;25:1271–77. doi: 10.1002/art.1780251101. [DOI] [PubMed] [Google Scholar]
  • 13.Merrifield RB. Solid phase peptide synthesis I. The synthesis of a tetrapeptide. JACS. 1963;85:2149–54. [Google Scholar]
  • 14.Le-Nguyen D, Heitz A, Castro B. Resin substrates. Part 2. Rapid solid phase synthesis of the ratine sequence tetradecapeptide using BOP reagent. Chem Soc Perkin Trans. 1987;1:1915–19. [Google Scholar]
  • 15.Johnson T, Sheppard RC. Resin effects in solid phase peptide synthesis. Enhanced purity of tryptophan-containing peptides through two-step cleavage of side chain protecting groups and peptide–resin linkage. J Chem Soc Chem Commun. 1991. pp. 1653–5.
  • 16.Knorr R, Trzeciak A, Bannwarth W, Gillessen D. New coupling reagents in peptide chemistry. Tetrahedron Let. 1989;30:1927–30. [Google Scholar]
  • 17.Chiron mimotopes. Pin-points mimotopes and peptide technology; 1992. ELISA method using biotinylated peptides. September. [Google Scholar]
  • 18.Bachmann M, Tröster H, Bartsch H, Grölz D. A frame shift mutation in a hot spot region of the nuclear autoantigen La/SS-B. J Autoimmun. 1996;9:747–56. doi: 10.1006/jaut.1996.0097. [DOI] [PubMed] [Google Scholar]
  • 19.Tröster H, Metzger TE, Semsei I, Schwemmle M, Winterpacht A, Zabel B, Bachmann M. One gene, two transcripts: isolation of an alternative transcript encoding for the autoantigen La/SS-B from a cDNA library of a patient with primary Sjögren's syndrome. J Exp Med. 1994;180:2059–69. doi: 10.1084/jem.180.6.2059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Stott DI. Immunoblotting and dot blotting. J Immunol Methods. 1989;119:153–87. doi: 10.1016/0022-1759(89)90394-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chan EKL, Sullivan KF, Tan EM. Ribonucleoprotein SS-B/La belongs to a protein family with consensus sequences for RNA-binding. Nucl Acid Res. 1989;17:2233–44. doi: 10.1093/nar/17.6.2233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Leach SJ. How antigenic are antigenic peptides? Biopolymers. 1983;22:425–40. doi: 10.1002/bip.360220156. [DOI] [PubMed] [Google Scholar]
  • 23.Berzofsky JA. Intrinsic and extrinsic factors in protein antigenic structure. Science. 1985;229:932–40. doi: 10.1126/science.2410982. [DOI] [PubMed] [Google Scholar]
  • 24.Bini P, Chu JL, Okolo C, Elkon K. Analysis of autoantibodies to recombinant La (SS-B) peptides in systemic lupus erythematosus and primary Sjögren's syndrome. J Clin Invest. 1990;85:325–33. doi: 10.1172/JCI114441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Rothfield N, Whitaker D, Bordwell B, Weiner E, Senecal JL, Earshaw W. Detection of anticentromere antibodies using cloned autoantigen. CENP-B. Arthritis Rheum. 1987;30:1416–9. doi: 10.1002/art.1780301214. [DOI] [PubMed] [Google Scholar]
  • 26.St Clair EN, Burch JA, Ward MM, Keene JD, Pisetsky DS. Temporal correlation of antibody responses to different epitopes of the human La autoantigen. J Clin Invest. 1990;85:515–21. doi: 10.1172/JCI114467. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES