Skip to main content
NCBI home page
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 1998 Jun;112(3):516–527. doi: 10.1046/j.1365-2249.1998.00580.x

VH usage and somatic hypermutation in peripheral blood B cells of patients with rheumatoid arthritis (RA)

S-C Huang *, R Jiang *, W O Hufnagle †, D E Furst ‡, K R Wilske ‡, E C B Milner *
PMCID: PMC1904985  PMID: 9649224

Abstract

The human antibody repertoire has been demonstrated to have a marked V-gene-dependent bias that is conserved between individuals. In RA patients, certain heavy chain V genes (VH) have been found to be preferentially used for encoding autoantibodies. To determine if such preferential use of VH genes in autoantibodies is associated with a general distortion of the V gene repertoire in RA patients, the VH composition of peripheral blood B cells was analysed among four RA patients and four age- and sex-matched healthy controls. Usage of individual VH genes (eight VH3 and three VH4 genes tested by hybridization with a set of gene-specific oligonucleotide probes) was highly biased among RA patients, but no evidence of a distortion in the bias was observed compared with healthy controls. However, the occurrence of somatic mutations in these VH genes (estimated by differential hybridization with motif-specific oligonucleotide probes targeted to CDR and FR of the tested genes, and by DNA sequence analysis) was strikingly different between patients and healthy subjects. The number of VH3 rearrangements that had accumulated somatic mutations and the number of mutations per rearrangement were significantly elevated in three of the four RA patients. A slight but not significant elevation in mutations among rearranged VH4 genes was also observed in these patients. These data suggest that although usage of individual VH genes among peripheral blood B cells is not affected by the disease, the autoimmune process may involve a significant fraction of the B cell compartment.

Keywords: rheumatoid arthritis, immunoglobulin heavy chain variable region, somatic hypermutation

INTRODUCTION

RA is an autoimmune disease which results in severe polyarticular inflammation and damage. Multiple pathologic anti-self antibodies (autoantibodies) have been found associated with RA [1–7]. It has been hypothesized that the production of these pathologic autoantibodies may result either from antigen-driven processes [8–10] or from polyclonal B cell activation [11–16]. However, the exact mechanisms involved in the pathologic autoantibody response in RA remain unclear. Studies of antibody structure may help to decipher the aetiology of a potentially pathologic autoantibody response in RA [8–10,17–22].

Antibodies consist of immunoglobulin heavy and light chains, and are encoded resulting from rearrangements of V genes, D segments (for heavy chains), and J segments. The usage of individual V genes in peripheral B cells for encoding antibodies has been the subject of a number of studies. Contrary to the conventional notion that adult V gene usage is normalized with respect to family complexity, our laboratory and others have observed an over-representation of a small group of immunoglobulin heavy chain V genes (VH) in the human B cell repertoire [23–29]. It is known that VH family representation in autoimmune diseases reflects the normal B cell repertoire in humans [17,30,31], and that VH genes used in rheumatoid factors (RF) are those preferentially expressed or utilized during fetal development [8,17,18,32]. It is not clear, however, if the preferential use of individual VH genes in autoantibodies is associated with a distortion in the VH repertoire in peripheral B cells of RA patients.

Here we report the results of analysis of VH gene usage and somatic mutation in peripheral B cells of RA patients. Although DNA sequence analysis is the most definitive method for ascertaining the identity of any particular rearranged V gene segment, the number of rearrangements that can be analysed is limited by the constraints inherent to sequence analysis itself. We have used an alternative approach in which individual VH gene segments are identified by hybridization of the cloned rearrangements to motif-specific oligonucleotide probes [23,24]. In addition, differential hybridization with multiple motif-specific probes corresponding to different regions of the same V segment has allowed the estimation of somatic mutations among a large number of the rearrangements [33]. In this study, VH3 genes and VH4 genes were analysed by this approach for their contribution to the rearranged VH repertoire and for the accumulation of somatic mutations among peripheral blood B cells from RA patients and controls. The results demonstrate that utilization of individual VH segments was similar between RA patients and normal subjects, but that the accumulation of somatic mutations in these genes was significantly elevated in three of four RA patients, suggesting that the autoimmune process in some RA patients may result in the antigen-driven activation of a significant fraction of the B cell compartment.

MATERIALS AND METHODS

Subjects and DNA

Peripheral blood samples were obtained from four patients with active RA and from four age- and sex-matched normal subjects, under Internal Review Board-approved informed consent. All patients and normal subjects were Caucasian. All patients were RF+, had erosive chronic disease in excess of 5 years, and met the American College of Rheumatology (ACR) criteria for RA. Each patient had been treated with a variety of non-steroidal anti-inflammatory drugs, low-dose prednisone, and one or more slow acting anti-rheumatic drugs. Purification of leucocytes and extraction of genomic DNA was as described [23]. Genomic DNA was also obtained from a lymphoblastoid B cell line, L1, which carried a rearrangement of the VH3 gene, V3-30 [34]. DNA from this B cell line was used as a control in estimating the amount of artefact in the measurement of CDR1 or CDR2 somatic mutation. In some experiments, mononuclear cells were stained with PE-conjugated anti-CD19 and FITC-conjugated anti-IgD and sorted on a Coulter Epics 750 cell sorter (Coulter Electronics, Hialeah, FL). The purity of the sorted IgD+ B cells was 95%. CD19+ IgD+ sorted B cells were lysed in lysis buffer as described [23] and the lysate was used for polymerase chain reaction (PCR) amplification of VH rearrangements as described below.

VH rearrangement and germ-line library construction

Rearranged and germ-line VH genes were quantitatively amplified from genomic DNA using primers corresponding to VH family-specific 5′ leader sequences and 3′ consensus JH or a conserved FR3 sequence as described [23,24]. The PCR products were cloned and libraries containing rearranged or germ-line VH3 and VH4 genes were made as described [23,24]. VH3 rearrangement libraries were also made in duplicate from 1 × 104 IgD+ B cells per PCR reaction from one RA patient (RA4) and one normal subject (N2). Phages containing single-stranded DNA were rescued and multiple replicate filters were prepared by dot blotting 10 μl of supernatant per well on the filter from each library [23,24].

Oligonucleotide probes

A panel of diagnostic oligonucleotide probes which identify individual VH3 or VH4 gene segments was used to hybridize the replicate filters (Table 1). Hybridization was conducted by overnight incubation of the filters with each 32P-labelled probe as described [23,24,33,35]. These probes were specially designed to target unique sequences of FRs or CDRs of individual VH genes. The specificity of each oligonucleotide probe has been tested by hybridization to genomic DNA to verify the ability of the probe to detect uniquely, individual germ-line gene segments [34,36–38]. Some oligonucleotide probes have been previously described [23,24,34,36–38]. Additional oligonucleotide probes were: E35, AGTGACTACTACATGAGCTGG; E36, AGTGGTAGTACCATATACTAC; E41, GAAATCAATCATAGTGGAAGC; E57, GAAATCTATCATAGTGGGAGC; E58, TACATCTATTACAGTGGGAGC; E86, TCAGCTATTAGTAGTAATGGG; E87, TCAGCTATTAGTGGTAGTGGT; E127, ATTAATAGTGATGGGAGTAGC; E149, CGCTGTCTATGGTGGGTCCTT; E150, AGTAGTAACTGGTGGACTTGG; E151, GCCAGCACCCAGGGAAGGGCC; E166, AGTAGCTTTGGCATGCACTGG; E167, GGAAGAAATAAATACTATGCA; E182, GCAGTTATATCATATGATGGA; E186, AGTAGTAGTTACACAAACTAC.

Table 1.

Diagnostic criteria for identification of VH genes and for estimation of CDR1 and CDR2 mutations by oligonucleotide probes

graphic file with name cei0112-0516-t1.jpg

Open in a new tab

Library screening and detection of somatic mutations in CDR1 and CDR2 by oligonucleotide probes

VH3+ or VH4+ clones were identified by hybridizing the dot-blotted filter to full-length VH3 or VH4 family-specific probes, as previously described [23,24]. Individual VH3 and VH4 gene segments were identified by hybridizing the replicate filters with their FR- and CDR-specific oligonucleotide probes as described [23,24] (Table 1). For the VH3 gene V3–15, only oligonucleotide probes targeted at CDR1 and CDR2 were used because there was no unique FR-specific probe available for this gene. The frequency of occurrence of each VH gene segment was calculated by dividing the number of clones hybridizing with diagnostic oligonucleotide probes by the total number of clones hybridizing with the family-specific probe [23,24]. Somatic mutation was detected by differential motif-specific hybridization as previously described [33].

DNA sequence analysis

Supernatant from each well (5 μl) containing single-stranded DNA was used for PCR amplification using M13-forward and M13-reverse primers. The PCR products were purified using the QIA quick-spin PCR purification Kit (Qiagen Inc., Santa Valencia, CA) and sequences were determined using the DyeDeoxy Terminator cycle sequencing Kit (Perkin Elmer, Foster City, CA) on the Applied Biosystems Model 373A DNA automated sequenator using T3 and T7 primers. Comparison and alignment of DNA were performed using the Lasergene program (DNASTAR, Inc., Madison, WI). D segment utilization was determined as described [24].

Statistical analysis

Student's t-test was used to test the significance of differences in the rearrangement frequency of individual VH gene segments, and of differences in somatic mutations between RA patients and normal subjects.

RESULTS

Representation of individual VH genes in peripheral blood B cells

To determine if the VH repertoire in RA patients was different from healthy subjects, phagemid libraries containing rearranged VH3 and VH4 genes were made from peripheral blood B cells derived from four RA patients and four age- and sex-matched controls. The germ-line origin of individual genes among VH3 or VH4 rearrangements was identified by hybridization with a set of motif-specific oligonucleotide probes. We observed that, with one exception, no significant differences in the rearrangement frequency of tested individual VH3 and VH4 genes were found between RA patients and normal subjects (Table 2). Similar results were observed in the repeated experiments on one normal subject and two RA patients from two independent PCR reactions. The eight VH3 genes analysed accounted for 66% of all VH3 rearrangements and the three VH4 genes represented 60% of all VH4 rearrangements. The rearranged VH repertoire in peripheral B cells was biased toward some individual VH genes. For instance, V3–23 was the most commonly rearranged VH3 gene, comprising 20–33% of the total VH3 rearrangements in both RA patients and normal controls. On the other hand, the VH3 gene V3–64 was rarely found in the peripheral blood of either RA patients or normal controls (Table 2), although this gene was present in the germ-line of all tested subjects. In addition, the rearrangement frequency of individual VH genes varied among patients and normal subjects. For example, V3–74 rearrangement was not found in the RA patient RA3 although this gene was present in the germ-line, whereas in other subjects, V3–74 comprised 2.3–7.7% of all VH3 rearrangements.

Table 2.

Rearrangement of individual VH genes in peripheral blood B cells of RA patients and controls

graphic file with name cei0112-0516-t2.jpg

Open in a new tab

The one exception observed in this study was V3–30. The frequency of V3–30 rearrangements was significantly higher in normal subjects than in RA patients (means of 15.77% and 4.46%, respectively, Table 2). Subsequent analysis by gel hybridization of genomic DNA showed that this difference was probably due to differences in gene dose between patients and controls. One patient (RA4), from whom no V3–30 rearrangements were observed, appeared to lack the V3–30 gene as V3–30 was not obtained from a germ-line library. This apparent germ-line deletion was confirmed by hybridization of genomic DNA with gene-specific oligonucleotide probes (data not shown). Results from similar analysis indicated that V3–30b (hv3005) was absent in the other three patients but that one or more V3–30 elements were present in each of the controls. High frequency of deletion of V3–30b in RA patients has been shown by others [39].

Detection of somatic mutations by hybridization

To test if the occurrence of somatically mutated rearrangements was different between RA patients and normal subjects, we designed unique motif-specific oligonucleotide probes targeted at the CDR1, CDR2 and FR of five VH3 genes and three VH4 genes. By comparison of hybridization profiles of multiple, non-overlapping gene-specific oligonucleotide probes, the presence of somatic mutations in the rearranged genes was revealed by the loss of concordance (relative to the hybridization profile on germ-line clones) of one or more probes (Table 1). We have previously used this approach to study the accumulation of somatic mutations in rearrangements of the V3–23 gene [33]. These probes were tested in germ-line libraries and were found to correlate with over 95% of the targeted genes, indicating a background error of ≤ 5%.

Additional system background not detectable by analysis of germ-line libraries was estimated from control experiments in which a rearranged VH3 library was made from the L1 B lymphoblastoid cell line [34,37] in parallel with the libraries from RA patients and controls. To approximate more closely the conditions of amplification of VH rearrangements from leucocytes (about 10% B cells), L1 DNA was mixed with autologous granulocyte genomic DNA at a ratio of 1:10 prior to the amplification of VH3 rearrangements. Hybridization analysis of 373 clones of the rearranged heavy chains from this cell line showed concordance between FR and CDR probes 90% of the time. These results together with the germ-line library data suggested that the combined errors from all sources (PCR artefact, cloning artefact, hybridization analysis) contributed a system error incidence of ≈ 10%. Because each analysis assays 42 bp, this is equivalent to a mutation incidence of ≈ 0.3% per bp, or approximately one substitution per rearrangement, which is close to the observed PCR error for V gene rearrangements estimated by others [40,41].

Somatic mutation in VH3 rearrangements

Approximately 2400 rearrangements among the five frequently used VH3 genes were analysed by hybridization for the occurrence of somatic mutations. Figure 1 shows the frequency of occurrence of somatic mutations among the VH3 rearrangements detected by CDR1 (Fig. 1a) and CDR2 (Fig. 1b) probes. The occurrence of somatic mutations ranged from 42% to 83% detected by CDR1 probes and from 29% to 97% detected by CDR2 probes among the VH3 rearrangements in RA patients. In the controls, however, the occurrence of somatic mutations among VH3 rearrangements was much lower, ranging from 6% to 42% for CDR1 probes, and from 7% to 55% for CDR2 probes. The mean occurrence of somatic mutations detected by CDR1 and CDR2 probes was significantly greater in VH3 rearrangements from RA patients than from controls. For instance, among the V3–23 rearrangements the average occurrence of somatic mutations detected was 61% in RA patients compared with 27% in controls in CDR1 (P < 0.006), and almost 70% for RA patients compared with 36% for controls in CDR2 (P < 0.003). Similarly, significant elevation of somatic mutations was found in CDR1 and CDR2 of rearrangements from other VH3 genes (Fig. 1a,b). The occurrence of somatic mutations was significantly higher in RA patients than in controls even when the background (10%) was subtracted from the observed values. However, there was variation in the somatic mutation events among patients and healthy subjects. For instance, the occurrence of somatic mutations in CDR1 and CDR2 of the five rearranged VH3 genes from three RA patients (RA1, RA2, RA4) was higher than that seen in all normal subjects (Fig. 1a,b). In patient RA3, however, the occurrence of somatic mutations was elevated only in CDR2 of V3–23 rearrangements and in CDR1 and CDR2 of V3–11 rearrangements, but was similar to controls in CDR1 and CDR2 of V3–33 and V3–30 rearrangements and in CDR1 of V3–23 rearrangements.

Fig. 1.

Fig. 1

Open in a new tab

Somatic mutations among rearrangements of five VH3 genes derived from peripheral blood B cells of four RA patients and four normal controls. Somatic hypermutation events were estimated by hybridizing VH3 libraries with motif-specific oligonucleotide probes targeted at CDR1 or CDR2 sequences of each gene as described [33]. Filled symbols, RA patients; open symbols, normal controls. Paired samples are indicated by shape of symbol. (a) Percent of rearrangements with somatic mutations in CDR1. (b) Percent of rearrangements with somatic mutations in CDR2.

Somatic mutation in VH4 rearrangements

Similar analyses of ≈ 1500 rearrangements of the three VH4 genes revealed that there were fewer mutations in VH4 rearrangements than in VH3 rearrangements among RA patients, and that among controls the occurrence of somatic mutations in VH4 rearrangements did not differ from the occurrence of somatic mutations in VH3 rearrangements (Fig. 2). A marginal elevation of somatic mutations in CDR2 of V4–34 rearrangements was observed in the RA patients compared with controls (P = 0.057). Somatic mutations in CDR2 in the rearrangements of the other two VH4 genes and in CDR1 in the rearrangements of the three VH4 genes from RA patients were slightly, albeit not significantly, higher than those from normal subjects (P > 0.08, Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

Somatic mutations among rearrangements of three VH4 genes in the blood samples of four RA patients and four healthy subjects. Somatic hypermutation events were estimated by hybridizing VH4 libraries with motif-specific oligonucleotide probes targeted at CDR1 or CDR2 sequences of each gene as described [33]. Filled symbols, RA patients; open symbols, normal controls. Paired samples are indicated by shape of symbol. (a) Percent of rearrangements with somatic mutations in CDR1. (b) Percent of rearrangements with somatic mutations in CDR2.

Comparison of VH3 and VH4 mutations

The mean incidence of somatic mutations was calculated by combining data from the five VH3 genes or from the three VH4 genes. Each mean value from each subject was treated as a single point in statistical analysis. As shown in Fig. 3, the occurrence of somatic mutations in VH3 rearrangements was significantly higher in RA patients than in controls (P = 0.0006). However, the occurrence of somatic mutations in VH4 rearrangements was not statistically different between RA patients and controls (P = 0.054). Among RA patients, the occurrence of somatic mutations in VH3 rearrangements was significantly greater than in VH4 rearrangements (P = 0.027), but among controls, mutation in VH3 was not different from that in VH4 (P = 0.277).

Fig. 3.

Fig. 3

Open in a new tab

Somatic mutations in VH3 versus VH4 rearrangements among patients and controls. The mean incidence of somatic mutations was calculated from each subject from the data in Figs 1 and 2. Each mean value from each subject was treated as a single point in statistical analysis (pair-wise Student's t-test).

Sequence analysis of rearrangements

The hybridization assay indirectly measures somatic mutations by determining the loss of hybridization to motif-specific probes. To correlate results obtained by this assay with actual mutations, the complete nucleotide sequences of randomly selected rearrangements and of germ-line clones were determined. This analysis focused exclusively on the V3–23 gene from each subject. Each subject carried at least one germ-line V3–23 allele that was found to be identical to the known V3–23 sequence (not shown) [42]. In addition, patients RA1, RA2 and RA4 as well as control N4 carried a second V3–23 allele in which a G for a T was substituted in the first position of codon 5, resulting in substitution of valine with leucine. This variant V3–23 germ-line sequence was not identical to any of the alleles identified by Sasso et al. [43] and therefore represents a new allele of V3–23. DNA sequences of V3–23 rearrangements from each individual were compared with the respective germ-line sequences, which allowed a precise identification of substitutions.

DNA sequence analysis was performed on 61 V3–23+ rearrangements from the four RA patients and 62 V3–23 rearrangements from the four controls. Among the V3–23 rearrangements from the RA patients, two were found to result from PCR crossing-over of V3–23 genes with other genes, and were excluded from further analysis. One V3–23 rearrangement from patient RA2 contained 3 base insertion (GCC) at codon position 14, which was treated as a single mutation. Figure 4 shows a comparison of rearrangements that had acquired two or fewer substitutions (representing unmutated rearrangements and accounting for system background) with rearrangements that had acquired three or more substitutions (definite somatic mutations). As shown, more than twice as many rearrangements had acquired mutations in RA patients than in controls. In conjunction with Fig. 5, which shows the results expressed as the averaged number of substitutions per 100 nucleotides for each region of the V segment, the results show that more rearrangements were mutated and there were more mutations per rearrangement in RA patients compared with controls. The results from Fig. 5 also fully corroborate the hybridization data shown in Fig. 1. In addition, comparison of the nucleotide sequence with the hybridization data confirmed the hybridization results in all cases. The number of substitutions and their effect on coding amino acids (i.e. replacement or silent) in different regions of V segment of V3–23 rearrangements from RA patients and healthy controls are shown in Table 3. The total number of nucleotide substitutions in FRs and CDRs of V3–23 rearrangements from RA patients was greater than that from healthy controls. The ratio of replacement to silent substitutions (R/S) in both FRs and CDRs varied among subjects. The total R/S ratio in CDRs was greater than that in FRs, regardless of disease status. However, the total R/S ratios in the CDRs as well as in the FRs of V3–23 rearrangements from RA patients were lower compared with that from normal subjects (Table 3).

Fig. 4.

Fig. 4

Open in a new tab

The fraction of mutated rearrangements is larger in RA patients than controls. Rearrangements that had 0–2 substitutions (unmutated and system background) are compared with rearrangements that had three or more substitutions (mutated). ▪, RA patients; □, normal controls.

Fig. 5.

Fig. 5

Open in a new tab

Nucleotide substitutions in FRs and CDRs of V3–23 rearrangements from RA patients and healthy subjects. A total of 59 V3–23 rearrangements from four RA patients and 62 V3–23 rearrangements from four healthy subjects were randomly selected for DNA sequence analysis. Filled symbols, RA patients; open symbols, normal controls. Paired samples are indicated by shape of symbol. Data are presented as number of nucleotide substitutions per 100 nucleotides among the respective regions. FR and CDR are defined according to Kabat et al. [62].

Table 3.

Distribution of nucleotide substitutions in V3–23 rearrangements from RA patients (RA) and healthy subjects (N)

graphic file with name cei0112-0516-t3.jpg

Open in a new tab

CDR3 and usage of D segments in rearrangements

To determine independence of rearrangements and to compare utilization of D segments between RA patients and controls, CDR3 sequences were analysed. Table 4 shows the CDR3 sequences from randomly selected V3–23+ rearrangements from RA patients and normal subjects. We observed 50 unique CDR3 among 59 rearrangements from RA patients and 59 unique CDR3 among 62 rearrangements from controls. Among 18 V3–23 rearrangements from RA3, a repeated CDR3 was observed in six rearrangements and another repeated CDR3 was found in three rearrangements (Table 4). Such highly repeated CDR3 which indicate clonal expansion were not observed among the normal controls or the other RA patients. Figure 6 shows the comparison of D segment usage between RA patients and controls. D–D joins were found in two CDR3 sequences from N1 and in one CDR3 sequence from N4. The usage of individual D segments varied between subjects regardless of status, and some D segments seemed to be used more frequently than others (Fig. 6).

Table 4.

DNA sequences of CDR3 of V3–23 rearrangements from RA patients and normal subjects (N)

graphic file with name cei0112-0516-t4a.jpg

graphic file with name cei0112-0516-t4b.jpg

Open in a new tab
Fig. 6.

Fig. 6

Open in a new tab

D segment usage in RA patients and in controls. Individual D segments were identified as described [24]. Total number of each D segment from four RA patients or from four controls is presented.

Somatic mutations in pre-immune B cells (IgD+ B cells)

To determine if the pre-immune B cell compartment contributed to the observed elevation in somatic mutation in RA patients, the VH repertoire from IgD+ B cells was studied in one RA patient (RA4) and one normal subject (N2). By flow cytometry analysis, 75% of circulating CD19+ B cells were IgD+ in N2 and 60% in RA4. The percentage of IgD+ B cells was also analysed in blood samples from the other three RA patients 2 years after the initial VH repertoire experiment. IgD+ B cells accounted for 81%, 75% and 76% of CD19+ cells for RA3, RA2 and RA1, respectively. In addition to VH3 rearrangement libraries from sorted IgD+ B cells, new libraries were also made from unsorted B cells from RA4 and N2. Figure 7 shows the results of analyses for somatic mutations in V3–23 rearrangements from unsorted and from sorted (IgD+) B cells of RA4 and N2. The incidence of somatic mutations in V3–23 rearrangements from unsorted B cells was much higher in the RA patient than in the normal subject, but no significant difference was observed in the rearrangements derived from the IgD+ sorted B cells (Fig. 7), indicating that pre-immune B cells did not contribute to the elevation in somatic mutations seen in RA patients.

Fig. 7.

Fig. 7

Open in a new tab

Somatic mutations in B cell subsets. VH3 rearrangement libraries were made from unsorted PBL and from sorted IgD+/CD19+ B cells. Purity of the sorted IgD+ CD19+ B cells was 95%. V3–23+ clones were identified by hybridization with at least one of the V3–23-specific probes, M18, M8, or E87. Somatic hypermutation events in CDR1 and CDR2 were estimated by loss of concordant hybridization to M8 or E87 probes, respectively.

DISCUSSION

In this study we have analysed the utilization of eight individual VH3 genes and three individual VH4 genes among VH3 and VH4 rearrangements in peripheral blood B cells from four RA patients and four age- and sex-matched controls. Data from this study are consistent with earlier observations that immunoglobulin VH gene utilization in peripheral blood B cells from adults exhibits a stable but non-stochastic pattern [23,24]. No significant differences in individual VH gene usage in peripheral B cells were observed between RA patients and controls, suggesting that although some VH genes such as V4–34, V3–23 and V1–69 have been found preferentially used in RF [8–10,17,18], the overall representation of individual genes in the peripheral B cells from these RA patients may not be affected.

The frequency of rearrangement of individual genes in peripheral B cells was estimated using a set of probes specifically targeted at unique FR, CDR1 and CDR2 motifs of each gene. This strategy allowed us to estimate the accumulation of somatic mutations as well [33]. The FR-specific probes hybridized to more than 90% of rearrangements of each gene. Among five VH3 genes tested in normal controls, ≈ 70% of clones that were identified by the FR probes were concordantly identified by hybridization to CDR1- or CDR2-specific oligonucleotide probes. However, in three of the four RA patients, only 10–40% were similarly concordant, suggesting an elevation of somatic mutations in the CDRs. As shown by control experiments, the excess accumulation of somatic mutations was neither due to mutations introduced by PCR nor due to allelic differences in the probe-targeted regions. Furthermore, DNA sequence analysis revealed that there were significantly more nucleotide substitutions in CDR1 and CDR2 among V3–23 rearrangements from these three RA patients than from the normal subjects (Fig. 5). These observations suggest that in some RA patients, the fraction of B cell repertoire that has been antigen-driven is substantially larger than in normal controls. Observations by others are consistent with this conclusion [19,21,22].

It is unclear why the occurrence of somatic mutation in the rearranged VH3 genes was not elevated in one RA patient (RA3), but a similar finding has been reported [19], suggesting that an elevation in somatic mutation occurs in only a fraction of RA patients. Whether this correlates to a clinically definable subset of RA remains to be determined.

Several possible explanations for the increase in somatic mutation in RA patients may exist. First, somatic mutation may be occurring prematurely in B cell development. The population of B cells in the blood that is newly derived from bone marrow (pre-immune B cells) and has not encountered antigens is positive for CD19 and IgD. It is known that high incidence of somatic hypermutations can be observed in the IgD− B cell component but rarely in the IgD+ B cell component in the blood of normal humans [33,40,41]. It is also known that IgD+IgM− germinal centre B cells from normal subjects can express a high rate of somatic mutations in VH genes [44]. Because the percentage of IgD+ B cells in the blood from RA patients either does not differ or is slightly reduced compared with that from healthy controls [14,45], mutations in blood IgD+ B cells might contribute a component of the overall elevation of somatic mutations in rearranged VH3 genes from RA patients.

To test this possibility, we investigated the VH repertoire in IgD+ B cells. The frequency of rearrangements with mutations in CDR1 and CDR2 of V3–23 among IgD+ B cells was low in both the tested RA patient and the control subject, but did not differ between the patient and the control (Fig. 7), suggesting that the excess mutations in RA are not in the IgD+ B cell compartment, but must be derived from IgD− B cells.

Second, RA patients may have a higher percentage of circulating antigen-activated B cells in the peripheral blood. The higher incidence of somatic mutations among VH3 rearrangements in the three RA patients may be due to an alteration of the peripheral B cell compartment in these patients. Although the contribution of individual VH3 or VH4 genes to the total VH3 or VH4 repertoire is similar between RA and normal controls, the contribution of each VH family to the total peripheral B cell repertoire was not determined in our experiments. However, it has been shown that VH3 genes contribute 50–60% to the total B cell repertoire in healthy adults [46–48]. In this study, we observed that the incidence of somatic mutation in CDRs among the rearrangements from three tested VH4 genes in RA patients was much lower than from the five tested VH3 genes, and was not significantly different from controls. It is possible that, among those three RA patients, the increased number of peripheral B cells carrying mutated VH genes may be preferentially derived from the VH3-bearing B cells. Such cells could represent a population of polyclonally activated B cells as well as a population of antigen-driven B cells.

Somatic hypermutation is the extraordinary strategy of the immune system to produce antibodies of high affinity by introducing large numbers of point mutations into immunoglobulin V genes. Several recent studies have shown that VH genes used in natural autoantibodies are those preferentially expressed or utilized during fetal development, and rearrangements of these natural autoantibodies are mostly unmutated [8,17,18,31,32,49]. In contrast, VH gene usage in IgM RF from peripheral blood of RA patients has been shown to be genetically heterogeneous and somatically mutated [21,22]. Further, an elevation of somatic hypermutation has been observed in CDRs of VH and VL in two of three IgG RF [20]. Since somatic hypermutations in immunoglobulin V genes have been demonstrated to be responsible for generating pathologic autoantibodies in animal and other human autoimmune diseases [50–59], it would be interesting to know if the elevation of somatic mutations is involved in the pathogenesis of RA.

DNA sequence analysis of CDR3 showed that the usage of individual D segments varied between subjects regardless of disease status, although some D segments (e.g. DN1 and DA1) seemed to be preferentially used in normal subjects (Fig. 5). One CDR3 was found to be repeated among six clones among the 18 randomly selected V3–23 clones from patient RA3, suggesting the presence of B cell oligoclonality in patient RA3. While it is possible that this was a result of PCR artefact, no similarly high repetition of CDR3 was observed in normal controls or in the other three RA patients (Table 4). Clonal B cell expansions in RA patients have been observed by others [19,60]. Thus, it is likely that clonal expansion of B cells due to antigen-driven processes is a common occurrence in a subset of RA patients.

Acknowledgments

We would like to thank Patricia A. Breen for collecting blood samples from RA patients. This work was supported in part by Grant AR39918 from the National Institutes of Health and a Biomedical Science Grant from the Arthritis Foundation.

References

  • 1.Mannik M, Nardella FA, Sasso EH. Rheumatoid factors in immune complexes of patients with rheumatoid arthritis. Springer Semin Immunopathol. 1998;10:215–230. doi: 10.1007/BF01857226. [DOI] [PubMed] [Google Scholar]
  • 2.Franklin EC, Holman HR, Muller-Eberhard HJ, Kunkel HG. An unusual protein component of high molecular weight in the serum of patients with rheumatoid arthritis. J Exp Med. 1957;105:425–32. doi: 10.1084/jem.105.5.425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Stuart JM, Huffsttutter EH, Townes AS, Kang AH. Incidence and specificity of antibodies to type I, II III, IV, and V collagen in rheumatoid arthritis and other rheumatic diseases as measured by 125I–radioimmunoassay. Arthritis Rheum. 1983;26:836–40. doi: 10.1002/art.1780260703. [DOI] [PubMed] [Google Scholar]
  • 4.Chen PP, Fong S, Carson DA. Rheumatoid factor. Rheum Dis Clin North Am. 1987;13:545–68. [PubMed] [Google Scholar]
  • 5.Winchester RJ, Agnello V, Kunkel HG. Gamma globulin complexes in synovial fluids of patients with rheumatoid arthritis: partial characterization and relationship to lowered complement levels. Clin Exp Immunol. 1970;6:689–706. [PMC free article] [PubMed] [Google Scholar]
  • 6.Munthe E, Natvig JB. Characterization of IgG complexes in eluates from rheumatoid tissue. Clin Exp Immunol. 1971;8:249–62. [PMC free article] [PubMed] [Google Scholar]
  • 7.Zvaifler NJ. The immunopathology of joint inflammation in rheumatoid arthritis. Adv Immunol. 1973;13:265–336. doi: 10.1016/s0065-2776(08)60299-0. [DOI] [PubMed] [Google Scholar]
  • 8.Olee T, Lu EW, Huang D-F, et al. Genetic analysis of self-associating immunoglobulin G rheumatoid factors from two rheumatoid synovia implicates an antigen-driven response. J Exp Med. 1992;175:831–42. doi: 10.1084/jem.175.3.831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Lee SK, Bridges SL, Jr, Kirkham PM, Koopman WJ, Schroeder HW., Jr Evidence of antigen receptor-influenced oligoclonal B lymphocyte expansion in the synovium of a patient with longstanding rheumatoid arthritis. J Clin Invest. 1994;93:361–70. doi: 10.1172/JCI116968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Randen I, Pascual V, Victor K, et al. Synovial IgG rheumatoid factors show evidence of an antigen-driven immune response and a shift in the V gene repertoire compared to IgM rheumatoid factors. Eur J Immunol. 1993;23:1220–5. doi: 10.1002/eji.1830230604. [DOI] [PubMed] [Google Scholar]
  • 11.Petersen J, Heilmann C, Hoier–Madsen M. Pokeweed mitogen-induced secretion of IgG- and IgM-rheumatoid factors by synovial fluid and blood B lymphocytes in rheumatoid arthritis. Rheumatol Int. 1986;6:115–20. doi: 10.1007/BF00270347. [DOI] [PubMed] [Google Scholar]
  • 12.Bonagura VR, Ilowite NT, Hatam L, Valacer DJ, Wedgwood JF. Expression of the major rheumatoid factor cross-reactive idiotype in pediatric patients with systemic lupus erythematosus. Clin Immunol Immunopathol. 1991;60:232–43. doi: 10.1016/0090-1229(91)90066-j. [DOI] [PubMed] [Google Scholar]
  • 13.Nakamura M, Burastero SE, Notkins AL, Casali P. Human monoclonal rheumatoid factor-like antibodies from CD5 (Leu-1)+ B cells are polyreactive. J Immunol. 1988;140:4180–6. [PubMed] [Google Scholar]
  • 14.Youinou PY, Irving WL, Shipley M, Hayes J, Lydyard PM. Evidence for B cell activation in patients with active rheumatoid arthritis. Clin Exp Immunol. 1984;55:91–98. [PMC free article] [PubMed] [Google Scholar]
  • 15.Eisenberg GM. The significance of polyclonal B cell activator in patients with rheumatoid arthritis. Proc Inst Med Chgo. 1981;34:75–78. [PubMed] [Google Scholar]
  • 16.Teodorescu M, Chang J-L, Skosey JL. Polyclonal B cell activator associated with alpha-2-macroglobulin in the serum of patients with rheumatoid arthritis. Int Archs Allergy Appl Immunol. 1981;66:1–12. doi: 10.1159/000232793. [DOI] [PubMed] [Google Scholar]
  • 17.Bridges SL, Jr, Lee SK, Koopman WJ, Schroeder HW., Jr Analysis of immunoglobulin gamma heavy chain expression in synovial tissue of a patient with rheumatoid arthritis. Arthritis Rheum. 1993;36:631–41. [PubMed] [Google Scholar]
  • 18.Kipps TJ, Duffy SF. Relationship of the CD5 B cell to human tonsillar lymphocytes that express autoantibody-associated cross-reactive idiotypes. J Clin Invest. 1991;87:2087–96. doi: 10.1172/JCI115239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Schröder AE, Greiner A, Seyfert C, Berek C. Differentiation of B cells in the nonlymphoid tissue of the synovial membrane of patients with rheumatoid arthritis. Proc Natl Acad Sci USA. 1996;93:221–5. doi: 10.1073/pnas.93.1.221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Deftos M, Olee T, Carson DA, Chen PP. Defining the genetic origins of three rheumatoid synovium-derived IgG rheumatoid factors. J Clin Invest. 1994;93:2545–53. doi: 10.1172/JCI117265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Youngblood K, Fruchter L, Ding G, Lopez J, Bonagura V, Davidson A. Rheumatoid factors from the peripheral blood of two patients with rheumatoid arthritis are genetically heterogeneous and somatically mutated. J Clin Invest. 1994;93:852–61. doi: 10.1172/JCI117040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Fang Q, Kannapell CC, Gaskin F, Solomon A, Koopman WJ, Fu SM. Human rheumatoid factors with restrictive specificity for rabbit immunoglobulin G: auto- and multi-reactivity, diverse VH gene segment usage and preferential usage of V lambda IIIb. J Exp Med. 1994;179:1445–56. doi: 10.1084/jem.179.5.1445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Suzuki I, Pfister L, Glas A, Nottenburg C, Milner ECB. Representation of rearranged VH gene segments in the human adult antibody repertoire. J Immunol. 1995;154:3902–11. [PubMed] [Google Scholar]
  • 24.Huang S-C, Jiang R, Glas AM, Milner ECB. Nonstochastic utilization of Ig V region genes in unselected human peripheral B cells. Mol Immunol. 1996;33:553–60. doi: 10.1016/0161-5890(95)00162-x. [DOI] [PubMed] [Google Scholar]
  • 25.Yancopoulos GD, Desiderio SV, Paskind M, Kearney JF, Baltimore D, Alt FW. Preferential utilization of the most J-proximal VH gene segments. Nature. 1984;311:727–33. doi: 10.1038/311727a0. [DOI] [PubMed] [Google Scholar]
  • 26.Perlmutter RM, Kearney JF, Chang SP, Hood LE. Developmentally controlled expression of immunoglobulin VH genes. Science. 1985;227:1597–601. doi: 10.1126/science.3975629. [DOI] [PubMed] [Google Scholar]
  • 27.Schroeder HW, Jr, Hillson JL, Perlmutter RM. Early restriction of the human antibody repertoire. Science. 1987;238:791–3. doi: 10.1126/science.3118465. [DOI] [PubMed] [Google Scholar]
  • 28.Matsuda F, Shin EK, Nagaoka H, et al. Structure and physical map of 64 variable segments in the 3′ 0.8-megabase region of the human immunoglobulin heavy-chain locus. Nature Genetics. 1993;3:88–94. doi: 10.1038/ng0193-88. [DOI] [PubMed] [Google Scholar]
  • 29.Stewart AK, Huang C, Stollar BD, Schwartz RS. High-frequency representation of a single VH gene in the expressed human B cell repertoire. J Exp Med. 1993;177:409–18. doi: 10.1084/jem.177.2.409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Stewart AK, Huang C, Long AA, Stollar BD, Schwartz RS. VH-gene representation in autoantibodies reflects the normal human B-cell repertoire. Immunol Rev. 1992;128:101–22. doi: 10.1111/j.1600-065x.1992.tb00834.x. [DOI] [PubMed] [Google Scholar]
  • 31.Sanz I, Casali P, Thomas JW, Notkins AL, Capra JD. Nucleotide sequences of eight human natural autoantibody VH regions reveals apparent restricted use of VH families. J Immunol. 1989;142:4054–61. [PubMed] [Google Scholar]
  • 32.Harindranath N, Goldfarb IS, Ikematsu H, et al. Complete sequence of the genes encoding the VH and VL regions of low- and high-affinity monoclonal IgM and IgA1 rheumatoid factors produced by CD5+ B cells from a rheumatoid arthritis patient. Int Immunol. 1991;3:865–75. doi: 10.1093/intimm/3.9.865. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Suzuki I, Milner ECB, Glas AM, et al. Immunoglobulin heavy chain variable region gene usage in bone marrow transplant recipients: lack of somatic mutation indicates a maturational arrest. Blood. 1996;87:1873–80. [PubMed] [Google Scholar]
  • 34.Willems van Dijk K, Milner LA, Sasso EH, Milner ECB. Chromosomal organization of the heavy chain variable region gene segments comprising the human fetal antibody repertoire. Proc Natl Acad Sci USA. 1992;89:10430–4. doi: 10.1073/pnas.89.21.10430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Rao SP, Huang S-C, Milner ECB. Analysis of the VH3 repertoire among genetically disparate individuals. Exp Clin Immunogenet. 1996;13:131–8. [PubMed] [Google Scholar]
  • 36.Sasso EH, Willems van Dijk K, Milner ECB. Prevalence and polymorphism of human VH3 genes. J Immunol. 1990;145:2751–7. [PubMed] [Google Scholar]
  • 37.van der Maarel SM, Willems van Dijk K, Alexander CM, Sasso EH, Bull AB, Milner ECB. Chromosomal organization of the human VH4 gene family: location of individual gene segments. J Immunol. 1993;150:2858–68. [PubMed] [Google Scholar]
  • 38.Sasso EH, Willems van Dijk K, Bull A, Milner ECB. A fetally expressed VH1 gene belongs to a complex set of alleles. J Clin Invest. 1993;91:2358–67. doi: 10.1172/JCI116468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Yang P-M, Olsen NJ, Siminovitch KA, et al. Possible deletion of a developmentally regulated heavy-chain variable region gene in autoimmune diseases. Proc Natl Acad Sci USA. 1990;87:7907–11. doi: 10.1073/pnas.87.20.7907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Pascual V, Liu Y-J, Magalski A, de Bouteiller O, Banchereau J, Capra JD. Analysis of somatic mutation in five B cell subsets of human tonsil. J Exp Med. 1994;180:329–39. doi: 10.1084/jem.180.1.329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Klein U, Küppers R, Rajewsky K. Human IgM+IgD+ B cells, the major B cell subset in the peripheral blood, express Vk genes with no or little somatic mutation throughout life. Eur J Immunol. 1993;23:3272–7. doi: 10.1002/eji.1830231232. [DOI] [PubMed] [Google Scholar]
  • 42.Matthyssens G, Rabbitts TH. Structure and multiplicity of genes for the human immunoglobulin heavy chain variable region. Proc Natl Acad Sci USA. 1980;77:6561–5. doi: 10.1073/pnas.77.11.6561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Sasso EH, Buckner JH, Suzuki LA. Ethnic differences in polymorphism of an immunoglobulin VH3 gene. J Clin Invest. 1995;96:1591–600. doi: 10.1172/JCI118198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Liu Y-J, de Bouteiller O, Arpin C, et al. Normal human IgD+IgM− germinal center B cells can express up to 80 mutations in the variable region of their IgD transcripts. Immunity. 1996;4:603–13. doi: 10.1016/s1074-7613(00)80486-0. [DOI] [PubMed] [Google Scholar]
  • 45.Kumagai S, Ishida H, Iwai K, et al. Possible different mechanisms of B cell activation in systemic lupus erythematosus and rheumatoid arthritis: opposite expression of low-affinity receptors for IgE (CD23) on their peripheral B cells. Clin Exp Immunol. 1989;78:348–53. [PMC free article] [PubMed] [Google Scholar]
  • 46.Huang C, Stewart AK, Schwartz RS, Stollar BD. Immunoglobulin heavy chain gene expression in peripheral blood lymphocytes. J Clin Invest. 1992;89:1331–43. doi: 10.1172/JCI115719. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Brezinschek HP, Brezinschek RI, Lipsky PE. Analysis of the heavy chain repertoire of human peripheral B cells using single-cell polymerase chain reaction. J Immunol. 1995;155:190–202. [PubMed] [Google Scholar]
  • 48.Demaison C, David D, Letourneur F, Thèze J, Saragosti S, Zouali M. Analysis of human VH gene repertoire expression in peripheral CD19+ B cells. Immunogenetics. 1995;42:342–52. doi: 10.1007/BF00179395. [DOI] [PubMed] [Google Scholar]
  • 49.Siminovitch KA, Misener V, Kwong PC, Song Q-L, Chen PP. A natural autoantibody is encoded by germline heavy and lambda light chain variable region genes without somatic mutation. J Clin Invest. 1989;84:1675–8. doi: 10.1172/JCI114347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Shlomchik M, Mascelli M, Shan H, et al. Anti-DNA antibodies from autoimmune mice arise by clonal expansion and somatic mutation. J Exp Med. 1990;171:265–97. doi: 10.1084/jem.171.1.265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Eilat D. The role of germline gene expression and somatic mutation in the generation of autoantibodies to DNA. Mol Immunol. 1990;27:203–10. doi: 10.1016/0161-5890(90)90131-i. [DOI] [PubMed] [Google Scholar]
  • 52.Pascual V, Victor K, Randen I, et al. Nucleotide sequence analysis of rheumatoid factors and polyreactive antibodies derived from patients with rheumatoid arthritis reveals diverse use of VH and VL gene segments and extensive variability in CDR-3. Scand J Immunol. 1992;36:349–62. doi: 10.1111/j.1365-3083.1992.tb03108.x. [published erratum appears in Scand J Immunol 1994 40:125] [DOI] [PubMed] [Google Scholar]
  • 53.Ikematsu H, Ichiyoshi Y, Schettino EW, Nakamura M, Casali P. VH and V kappa segment structure of anti-insulin IgG autoantibodies in patients with insulin-dependent diabetes mellitus. Evidence for somatic selection. J Immunol. 1994;152:1430–41. [PMC free article] [PubMed] [Google Scholar]
  • 54.Bridges SL, Jr, Lee SK, Johnson ML, et al. Somatic mutation and CDR3 lengths of immunoglobulin k light chains expressed in patients with rheumatoid arthritis and in normal individuals. J Clin Invest. 1995;96:831–41. doi: 10.1172/JCI118129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Shlomchik MJ, Marshak-Rothstein A, Wolfowicz CB, Rothstein TL, Weigert MG. The role of clonal selection and somatic mutation in autoimmunity. Nature. 1987;328:805–11. doi: 10.1038/328805a0. [DOI] [PubMed] [Google Scholar]
  • 56.Behar SM, Chien NC, Corbet S, et al. Impact of somatic mutation on the S107 (T15) heavy-chain V region of antibodies reactive with self and nonself. Cold Spring Harb Symp Quant Biol. 1989;54:921–32. doi: 10.1101/sqb.1989.054.01.107. [DOI] [PubMed] [Google Scholar]
  • 57.Diamond B, Katz JB, Paul E, Aranow C, Lustgarten D, Scharff MD. The role of somatic mutation in the pathogenic anti-DNA response. Ann Rev Immunol. 1992;10:731–57. doi: 10.1146/annurev.iy.10.040192.003503. [DOI] [PubMed] [Google Scholar]
  • 58.Davidson A, Manheimer-Lory A, Aranow C, Peterson R, Hannigan N, Diamond B. Molecular characterization of a somatically mutated anti-DNA antibody bearing two systemic lupus erythematosus-related idiotypes. J Clin Invest. 1990;85:1401–9. doi: 10.1172/JCI114584. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Ray SK, Putterman C, Diamond B. Pathogenic autoantibodies are routinely generated during the response to foreign antigen: a paradigm for autoimmune disease. Proc Natl Acad Sci USA. 1996;93:2019–24. doi: 10.1073/pnas.93.5.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Bridges SL, Jr, Clausen BE, Lavelle JC, Fowler PG, Jr, Koopman WJ, Schroeder HW., Jr Analysis of immunoglobulin gamma heavy chains from rheumatoid arthritis synovium. Evidence of antigen-driven selection. Ann NY Acad Sci. 1995;764:450–2. doi: 10.1111/j.1749-6632.1995.tb55862.x. [DOI] [PubMed] [Google Scholar]
  • 61.Milner ECB, Hufnagle WO, Glas AM, Suzuki I, Alexander CM. Polymorphism and utilization of human VH genes. Ann NY Acad Sci. 1995;764:50–61. doi: 10.1111/j.1749-6632.1995.tb55806.x. [DOI] [PubMed] [Google Scholar]
  • 62.Kabat EA, Wu TT, Perry HM, Gottesman KS, Foeller C. 5. Bethesda: US Government Printing Office, U.S. Department of Health and Human Services, USPHS, NIH; 1991. Sequences of proteins of immunological interest. [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES