Skip to main content
NCBI home page
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 1998 Oct;114(1):1–8. doi: 10.1046/j.1365-2249.1998.00684.x

Regulation of cytokine expression by an autoreactive B cell clone derived from MRL/MP-lpr/lpr mice

T Iwasaki *, T Hamano *, J Fujimoto *, A Ogata *, E Kakishita *
PMCID: PMC1905090  PMID: 9764595

Abstract

The B cell line, MRL159.5, was established by somatic hybridization between splenic MRL/MP-lpr/lpr (lpr) mice B cells and 2.52M, a hypoxanthine-aminopterine-thymidine (HAT) medium-sensitive B cell line mutant. It possessed a receptor molecule for mouse erythrocytes treated with bromelain (Br-MRBC) on its surface, likely to be an autoreactive B cell clone specific for Br-MRBC as detected by rosette-forming assay with Br-MRBC. MRL159.5 spontaneously produced IL-6 and secreted IgM, and was induced to augment IgM secretion when treated with Br-MRBC or IL-6. Triggering of CD40 led to an augmentation of IgM secretion as well as IL-6 expression. Blocking the binding of IL-6 to its cellular receptor through the use of inhibitory antibodies inhibited CD40-induced IgM secretion, suggesting a possible autocrine role of IL-6 for CD40-induced differentiation of this B cell hybridoma. Addition of IL-4 or Br-MRBC augmented IL-6 expression as well as IgM secretion by CD40-activated MRL159.5 cells. CD40 also augmented tumour necrosis factor-alpha (TNF-α) and granulocyte-macrophage colony-stimulating factor (GM-CSF) expression but resulted in decreased IL-10 expression. Furthermore, under conditions where IL-6 expression was augmented, IL-6Rα (gp80) expression was down-regulated, suggesting a negative feedback mechanism of an IL-6 autocrine loop in this hybridoma. These results demonstrate a role by which T cell-dependent activation through CD40 regulates an IL-6 autocrine loop, controlling differentiation of autoreactive B cells in autoimmune disease.

Keywords: autocrine differentiation, endogenous IL-6, MRL/MP-lpr/lpr, B cell hybridoma

INTRODUCTION

B cells contribute to the immune response by their production of specific antibodies in response to antigenic stimuli. However, additional immunoregulatory roles for B cells have also been proposed. Indeed, B cells have the capacity to act as effective antigen-presenting cells (APC) in MHC-restricted T cell activation [1,2]. Moreover, B cells are able to produce cytokines capable of regulating the response of interacting cells as well as their own development; B cell-derived cytokines govern B cell activation, growth and differentiation through IL-6, IL-10 and tumour necrosis factor (TNF) autocrine loops [3,4]. It is likely that such autocrine loops are involved in the pathogenesis of uncontrolled activation or replication of B cells, which could lead to autoimmune disease or oncogenic transformation [5,6].

Recent studies have revealed an over-expression of IL-6 in one of the representative animal models of human autoimmune disease, MRL/MP-lpr/lpr (lpr) mice [7,8]. This strain produces high levels of autoantibodies, and develops glomerulonephritis and arthritis [9,10]. Abnormalities in T cells have been revealed in lpr mice: lymphadenopathy accumulated with T cells expressing both Thy-1 and B220 antigens and lacking CD4 and CD8 antigens were reported, and these T cells were found to have defects in the Fas antigen gene [10,11]. In addition, some abnormalities of B cells such as B cell hyperactivity and over-expression of IL-6R on B cells have been reported [12]. Thus, it was of interest to examine a functional role of an IL-6 autocrine loop for B cell differentiation in this strain.

The presence of autoreactive B cells which react to autoantigens has been found by binding autoantigens to B cells [13,14]. From this standpoint, we recently established an autoreactive B cell clone reactive to mouse erythrocytes treated with bromelain (Br-MRBC) by somatic hybridization between splenic B cells from NZB×NZW (B/W)F1 mice and hypoxanthine-aminopterine-thymidine (HAT) medium-sensitive B cell line. This kind of autoreactive B cell clone may serve as a good model for the study of the mechanism of autoimmune disease, since it can be activated by autoantigens in addition to B cell stimulatory factors [15].

In this study, we established autoreactive B cell hybridomas reactive to Br-MRBC between splenic B cells from lpr mice and a HAT medium-sensitive lymphoma cell line (2.52M). MRL159.5, a representative subclone of the resulting hybridomas, was augmented to secrete IgM following induction with exogenous IL-6 as well as Br-MRBC, suggesting that MRL159.5 is reflective of an autoreactive B cell clone inducible to differentiate by autoantigens and IL-6. Using this B cell clone, we investigated the contribution of endogenous cytokines to the differentiation of autoreactive B cells in autoimmune disease. These data showed that ligation of CD40 on MRL159.5 via anti-CD40 MoAb directly augmented the expression of IL-6, TNF-α and granulocyte-macrophage colony-stimulating factor (GM-CSF), while down-regulating expression of IL-10. Triggering of CD40 augmented IgM secretion, and blocking the binding of IL-6 to its cellular receptor through the use of inhibitory antibodies inhibited CD40-induced IgM secretion, suggesting a possible autocrine role of IL-6 in the differentiation of this hybridoma. Furthermore, IL-6Rα (gp80) mRNA expression was down-regulated when high levels of IL-6 expression were induced by co-triggering with CD40 and B cell receptor (BCR) via Br-MRBC or by activation through CD40 and IL-4. Such regulation of endogenous cytokine expression in autoreactive B cells probably contributes to a hyperactivity of B cells in autoimmune disease.

MATERIALS AND METHODS

Monoclonal antibodies, cytokines, cell lines and reagents

Hybridomas secreting anti-IAk (10.2.16; mouse; IgG2b), anti-IgM (Bet 2; rat; IgG1), anti-Thy-1.2 (30-H12; rat; IgG2b), and anti-B220 (RA3-3A1; rat; IgM) MoAbs were obtained from the American Type Culture Collection (ATCC, Rockville, MD). The culture supernatants of these hybridomas were collected and each MoAb was purified on a protein G-Sepharose column. TP67.21 is a 2,4,6-trinitrophenyl (TNP)-specific B cell clone established by somatic hybridization. It has a receptor molecule for TNP on the surface and can be induced to differentiate by TNP–bovine serum albumin (BSA) [16]. Anti-CD40 MoAb (clone 3/23; rat; IgG2a) [17] was purchased from Serotec (Oxford, UK). Recombinant murine IL-4, IL-6, anti-mouse IL-6 MoAb (rat; IgG1), and anti-mouse IL-6 receptor MoAb (rat; IgG2bκ) were obtained from Genzyme Corp. (Cambridge, MA). Single-stranded DNA (ssDNA) was prepared by boiling a solution of calf thymus DNA (type I; Sigma, St Louis, MO) and subsequent rapid cooling. 2.4.6-trinitrobenzenesulphonic acid (TNBS) was purchased from Wako Pure Chemical Inc. (Osaka, Japan). TNP–BSA was prepared as previously described in detail [18].

Mice

MRL/MP-lpr/lpr mice, obtained from the Shizuoka Agricultural Cooperative Association for Laboratory Animals (Hamamatsu, Japan) were used at age 20–30 weeks.

Generation of hybridomas

2.52M, a mutant clone of TH2.52, was established by mutagenesis with ethyl methanesulphonate (Sigma) [16]. This B cell clone is resistant to 6-thioguanine (Sigma) and sensitive to HAT-selective medium. To generate hybridomas, 2 × 107 2.52M cells were fused with 108 B cells from lpr mice in the presence of 45% polyethylene glycol (mol. wt 4000; Sigma) and 15% DMSO (Sigma) as previously described [16]. After hybridization, cell suspensions were distributed into microtitre plates (96 wells/plate; Falcon, Oxnard, CA) at a concentration of 2.5 × 105 B cells (100 μl/well) and were cultured for at least 3 weeks in HAT medium. Hybridomas, cultured in RPMI 1640 medium with 5% fetal calf serum (FCS), were cloned by limiting dilution. Each clone was examined for the presence of Br-MRBC receptor molecules on the cell membrane by rosette-forming assays.

Br-MRBC rosette-forming cell assay

Hybridomas capable of binding Br-MRBC were detected using the procedure described previously [15]. In brief, mouse erythrocytes were incubated with bromelain (Sigma) at a final concentration of 10 mg/ml in PBS. Hybridoma cells (105) were incubated with resulting Br-MRBC in RPMI 1640 medium at room temperature for 1 h, and Br-MRBC rosette-forming cells (RFC) were enumerated by light microscope.

Preparation of plasma membrane-enriched fraction from Br-MRBC and sheep erythrocytes

Preparation of plasma membrane-enriched fraction (PM) was carried out according to the procedure described by Auget & Merlin [19]. In brief, 108 Br-MRBC and sheep erythrocytes were centrifuged at 400 g for 15 min at 4°C, and the pellet was resuspended in 20 ml of 10 mm Tris–HCl pH 7.2 containing 100 kU/ml aprotinin (Wako Pure Chemicals). After 10 min of incubation on ice, cells were subjected to Dounce homogenization and an equal volume of 10 mm Tris–HCl pH 7.2 containing 0.5 m sucrose, 100 mm KCl, 10 mm MgCl2, 2 mm CaCl2, and 100 kU/ml aprotinin was added. This suspension was centrifuged at 2000 g for 15 min at 4°C, and then the membrane-enriched fraction was sedimented at 100 000 g for 90 min at 4°C. This membrane fraction was adjusted to 108 cell equivalents/ml (equivalent to the amount obtained by membrane fraction of 108 cells).

IL-6 bioassay

IL-6-dependent hybridoma cells, MH60BSF2 (104/well), which were the kind gift of Dr T. Hirano (Osaka University, Osaka, Japan), were cultured in a volume of 200 μl containing various doses of recombinant mouse IL-6 or hybridoma supernatants. After 48 h of incubation, cells were pulsed with 1 μCi of 3H-TdR and harvested 8 h later. One unit of IL-6 was defined as the amount inducing one half-maximal proliferation.

IL-10, TNF-α and GM-CSF ELISA

For studies of IL-10, TNF-α and GM-CSF secretion, hybridoma culture supernatants were assayed using ELISA kits from Genzyme. Plates were read at 450 nm by Titertek Multiscan (Flow Labs, McLean, VA).

Flow microfluorometry analysis

Surface antigens on cells were determined by flow microfluorometry (FMF) analysis on a FACScan (Becton Dickinson, Mountain View, CA) as previously reported [16]. Briefly, 50 μl of a cell suspension (106 cells) were reacted with 10 μl of each MoAb for 45 min at 4°C. The cells were then stained with either 10 μl of FITC–F(ab′)2 fragment affinity-purified goat anti-mouse IgG (Cappel Labs, Cochranville, PA) or FITC–anti-rat κ light chain MoAb (MAR18.5; mouse; IgG2a) (Becton Dickinson) for 30 min at 4°C. For each sample, 2 × 104 viable cells were analysed.

Assay of hybridoma IgM secretion

Hybridoma cells (5 × 103) were cultured in 96-well microtitre plates in a volume of 200 μl for 5 days, in medium alone or in the presence of IL-4 (100 U/ml), anti-CD40 MoAb (5 μg/ml), Br-MRBC (1 × 106/well), anti-CD40 MoAb (5 μg/ml) + IL-4 (100 U/ml), or anti-CD40 MoAb (5 μg/ml) + Br-MRBC (1 × 106/well) at 37°C. The supernatants were collected from triplicate wells and tested for IgM production by ELISA as previously described [20]. In brief, 96-well polyvinyl chloride plates were incubated with affinity-purified goat anti-mouse IgM in PBS for 2 h at 37°C. The plates were washed and blocked for 30 min at 37°C in PBS with 10% FCS. After washing, samples and standards were incubated for 90 min at 37°C. The plates were washed, horseradish peroxidase (HRP)-labelled goat anti-mouse IgM was added (2 μg/ml), and incubation was continued for 90 min at 37°C. Fifteen to 30 min after addition of OPD solution (0.4 mg/ml) containing 0.01% H2O2, the absorbance (OD 492–540 nm) was measured with a Titertek Multiscan (Flow Labs).

RNA extraction and reverse transcription-polymerase chain reaction analysis

Cell pellets were harvested and washed with PBS. Total RNA was extracted using guanidine thiocyanate-phenol chloroform. Following quantification of isolated RNA by spectrophotometric analysis, 2.5 μg of total RNA were reverse transcribed in the presence of random hexanucleotide primers (Promega Corp., Madison, WI) and avian myeloblastosis virus reverse transcriptase (Promega). The reaction mixture was incubated at 42°C for 1 h and then at 72°C for 5 min to terminate the reaction. From this reaction mixture, one-tenth of the volume was amplified by polymerase chain reaction (PCR) to generate mouse IL-6, IL-10, TNF-α, transforming growth factor-beta (TGF-β), GM-CSF, gp80 and β-actin mRNAs. The reaction mixture contained 50 pmol of each primer, 25 mm dATP, dGTP, dCTP and dTTP (Pharmacia, Uppsala, Sweden), 2 μl of 10 × reaction buffer, 1 U of Taq DNA polymerase (Boehringer Mannheim, Indianapolis, IN), and sterile distilled water. PCR was performed at 94°C for 1 min, 65°C for 1 min, and 72°C for 1 min in a DNA thermal cycler (model 480; Perkin Elmer Cetus, Norwalk, CT). A 10-μl reaction mixture was subjected to electrophoresis on a 2% agarose gel (NuSleve; FMC, Vallensbaek Strand, Denmark) containing ethidium bromide, at 26, 29 and 32 cycles, to assure linearity of the reaction. The gels were then photographed under UV light. The 5′ and 3′ PCR primers, obtained from Clontech (Palo Alto, CA) and Stratagene (La Jolla, CA), had the following sequences, respectively: IL-6, ATG AAGTTCCTCTCTGCAAGAGACT and CACTAGGTTTGCC GAGTAGATC TC; IL-6Rα (gp80), AATGCGTCATCCATGAT GCCTTGCGAGG and GTGGTTTACGGTATTGTCAGACCCAG AGC; IL-10, ATGCAGGACTTTAAGGGTTACTTGGGTT and ATTTCGGAGAGAGGTACAAACGAGGTTT; β-actin, TGTGA-TGGTGGGAATGGGTCAG and TTTGATGTCACGATTTCC; TNF-α, TTCTGTCTACTGAACTTCGGGGTGATCGGTCC and GTATGAGATAGCAAATCGGCTGACGGTGTGGG; TGF-β, CGGGGCGACCTGGGCACCATCCATGAC and CTGCTCCAC CTTGGGCTTGCGACCCAC; GM-CSF, TGTGGTCTACAGCCT CTCAGCACCC and CAAAGGGGATATCAGTCAGAAAGGT.

Semiquantitative determination of PCR products was performed following procedures previously described [21]. A standard curve was obtained by the quantitative relationship between serial 1:2 dilutions of the cDNA mixture from 250 ng of total RNA and the final PCR products, measured densitometrically. There was a log-linear proportionality between the input cDNA mixture and PCR end products in the range of cDNA mixture dilutions used for PCR. Furthermore, the IL-6, IL-10, TNF-α, TGF-β, GM-CSF and gp80 PCR products were normalized in relation to the β-actin internal control.

RESULTS

Establishment of B cell hybridomas

B cell hybridomas were generated as previously described [15,16]. The cell growth in HAT medium after cell fusion was observed in 298 wells of a total of five microtitre plates. To obtain a Br-MRBC-reactive B cell clone, each clone was screened by the formation of Br-MRBC RFC as previously described [15]. The hybridomas of three wells were shown to form Br-MRBC RFC at a frequency of > 90%, but parental 2.52M did not form rosettes under the same conditions (data not shown). MRL159.5, one of the representative clones reacting to Br-MRBC, was used throughout the present study. Br-MRBC-PM markedly inhibited the rosette formation of MRL159.5 at the concentration of equivalent to 106 cells/ml. Because it is generally accepted that surface immunoglobulin molecules on B cells are receptors for antigens, we examined whether cells preincubated with anti-IgM MoAb have a reduced capacity to bind to Br-MRBC. Bet 2, an anti-mouse IgM MoAb, significantly inhibited the formation of Br-MRBC RFC. However, other MoAbs against B cell surface antigens such as IAk (10.2.16) and B220 (RA3-3A1) showed no inhibitory effect under the same conditions (Table 1). Furthermore, exogenous immunizing antigens and autoantigens such as sheep erythrocyte-PM, TNP–BSA and ssDNA did not inhibit the rosette formation of MRL159.5. The result strongly suggests that MRL159.5 possesses a receptor molecule specific for Br-MRBC which may cross-react with surface IgM molecules on the cell membrane. Surface antigens on MRL159.5 were characterized by FACS analysis; it expressed IgM, IAk, B220 and CD40 on the cell membrane. In contrast, the parental 2.52M expressed neither IAk nor CD40, characteristic of the B cells of lpr mice used in the cell fusion (Fig. 1). This result suggests that MRL159.5 has characteristics of lpr mouse B cells. Taken together, the result strongly suggests that MRL159.5 is an autoreactive B cell clone specific to Br-MRBC derived from lpr mice.

Table 1.

Effects of various reagents on the formation of mouse erythrocyte treated with bromelain (Br-MRBC) rosette-forming cells (RFC)*

graphic file with name cei0114-0001-t1.jpg

Open in a new tab

Fig. 1.

Fig. 1

Open in a new tab

Expression of cell surface antigens on MRL159.5 demonstrated by flow microfluorometry (FMF) profiles. The cells were reacted with each MoAb followed by FITC–(Fab′)2 fragments of goat anti-mouse IgG or FITC–MAR18.5. Stained cells were analysed for log fluorescence intensity with FACScan, and flow microfluorograms were constructed to show the staining by each antigen on the cells and background, which represents staining with control anti-Thy-1.2 MoAb (30-H12; rat; IgG2b) and MAR18.5.

Effects of Br-MRBC and IL-6 on IgM generation

We previously reported that some clones of B cell hybridomas with a B cell surface receptor specific to Br-MRBC between mouse splenic B cells from B/WF1 mice and M12.4.1 lymphoma are capable of generating a significant amount of IgM when treated with either Br-MRBC or B cell stimulatory factors [15]. So, it was of interest to examine whether MRL159.5 can be induced to develop IgM after treatment with these stimulators. In brief, the cells (5 × 103/well) were incubated with IL-6 (50 ng/ml), Br-MRBC (1 × 106/ml), or TNP–BSA (10 μg/ml) for 5 days, and the amounts of IgM in their culture supernatants were assessed by ELISA. IgM secretion in MRL159.5 was augmented either through Br-MRBC stimulation or by IL-6. In contrast, neither parental 2.52M nor other clones of hybridomas not forming rosettes with Br-MRBC developed any IgM secretion under the same conditions (Table 2). In order to ascertain whether the characteristics of MRL159.5 are peculiar to autoantigen-reactive B cells, we examined the effects of Br-MRBC and IL-6 on IgM secretion in an exogenous immunizing antigen-reactive B cell hybridoma. TP67.21, a TNP-specific B cell clone established by somatic hybridization [16], did not develop any IgM secretion under these two stimulators.

Table 2.

IgM secretion by B cell hybridomas*

graphic file with name cei0114-0001-t2.jpg

Open in a new tab

Effects of CD40 or BCR ligation on IgM generation and IL-6 production

Previous studies have revealed that endogenous IL-6 plays an obligatory role in human immunoglobulin synthesis triggered by stimulators such as IL-4, anti-CD40 MoAb, and Staphylococcus aureus Cowan I (SAC) [3,4,22,23]. Since MRL159.5 is inducible to differentiate into immunoglobulin-secreting cells by IL-6, we assessed endogenous IL-6 production as well as IgM secretion by MRL159.5. IgM secretion in MRL159.5 was augmented both by BCR-mediated stimulation via Br-MRBC and after CD40 activation, and was synergistically augmented by co-triggering with CD40 and BCR or activation through CD40 and IL-4. IL-6 production was also augmented both by BCR-mediated stimulation and after CD40 activation, although the level of IL-6 by acti-vation through CD40 had a five-to-six-fold higher effect on IL-6 production. Dual ligation of BCR and CD40 or activation through CD40 and IL-4 resulted in a synergistic effect on IL-6 production (Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

IgM generation and IL-6 production by MRL159.5. MRL159.5 cells (5 × 103) were cultured for 5 days, in medium alone or in the presence of IL-4 (100 U/ml), anti-CD40 MoAb (5 μg/ml), mouse erythrocytes treated with bromelain (Br-MRBC; 1 × 106/well), anti-CD40 MoAb (5 μg/ml) + IL-4 (100 U/ml), or anti-CD40 MoAb (5 μg/ml) + Br-MRBC (1 × 106/well), and IgM secretions were determined by ELISA. To analyse IL-6 production, cells (5 × 103) were cultured for 48 h under the described conditions, and culture supernatants were assayed for IL-6 activity as described in Materials and Methods. Data represent the mean ± s.d. of triplicate cultures.

Inhibitory effects of anti-IL-6 MoAb and anti-gp80 MoAb on the generation of IgM induced by CD40 activation

We demonstrated that CD40 engagement strongly induced IL-6 production (Fig. 2). To investigate further the regulatory mechanisms of endogenous IL-6 for the differentiation, we next examined the effects of anti-IL-6 and anti-gp80 MoAbs on IgM secretion in MRL159.5. Preventing the binding of IL-6 to its cellular receptor using anti-IL-6 and anti-gp80 MoAbs completely inhibited IgM generation by IL-6-stimulated MRL159.5 cells. These MoAbs also inhibited IgM secretion by CD40-stimulated MRL159.5 cells but did not inhibit IgM secretion by Br-MRBC stimulation (Table 3). The result suggests an involvement of an IL-6 autocrine loop for the differentiation of CD40-activated autoreactive B cells.

Table 3.

Inhibitory effects of anti-IL-6 MoAb and anti-gp80 MoAb on the generation of IgM by MRL159.5*

graphic file with name cei0114-0001-t3.jpg

Open in a new tab

Regulation of IL-6 and gp80 gene transcription in MRL159.5 cells

To analyse the regulation of IL-6 and gp80 expression in MRL159.5 at a transcriptional level, we attempted the induction of endogenous IL-6 gene expression by various agents such as anti-CD40 MoAb, Br-MRBC, or IL-4. Total RNA was extracted after 12 h of culture, and IL-6 and gp80 mRNA expressions were analysed by semiquantitative reverse transcription (RT)-PCR. IL-6 gene expression in MRL159.5 was augmented both by BCR-mediated stimulation via Br-MRBC and after CD40 activation. The level of IL-6 expression was much higher after CD40 activation compared with BCR-mediated stimulation. The costimulation of CD40 and BCR or activation through CD40 and IL-4 led to a strong synergistic induction of IL-6 gene expression (Fig. 3). Furthermore, under conditions where endogenous IL-6 gene expression was strongly augmented, gp80 gene expression by MRL159.5 was down-regulated (Fig. 3).

Fig. 3.

Fig. 3

Open in a new tab

Regulation of IL-6 and gp80 mRNA expression by MRL159.5 cells. Cells (5 × 105/m1) were cultured for 12 h, in medium alone or in the presence of mouse erythrocytes treated with bromelain (Br-MRBC; 5 × 106/ml), anti-CD40 MoAb (5 μg/ml), anti-CD40 MoAb (5 μg/ml) + IL-4 (100 U/ml), or anti-CD40 MoAb (5 μg/ml) + Br-MRBC (5 × 106/ml). Total RNA was extracted, and 1:2 dilution of the cDNA mixture was amplified for 32 cycles to detect IL-6 and gp80 mRNAs. For detection of β-actin mRNA, 1:4 dilution of cDNA mixture was amplified for 32 cycles by polymerase chain reaction (PCR). The IL-6 and gp80 PCR products were normalized in relation to β-actin. Consistent results were obtained in four separate experiments.

Effects of CD40 activation on the expression of IL-10, TNF-α, GM-CSF and TGF-β in MRL159.5 cells

Since cytokines such as IL-10, TNF-α, GM-CSF and TGF-β are also expressed by normal murine [24] and human [25] B cells, we examined the patterns of expression in MRL159.5 cells after stimulation either via the CD40 or through BCR cross-linking. Triggering of CD40 on MRL159.5 cells augmented TNF-α and GM-CSF mRNA levels, but resulted in decreased IL-10 mRNA levels. The expression of TGF-β mRNA was not affected by either CD40 or BCR stimulation (Fig. 4a). To investigate increased expression of TNF-α and GM-CSF, and simultaneous decrease of IL-10 following BCR and CD40 ligation at protein level, we assayed the secretion of such cytokines by MRL159.5 by a cytokine-specific ELISA. As shown in Fig. 4b, TNF-α and GM-CSF secretions were augmented by both BCR-mediated stimulation and CD40 activation. IL-10 secretion was decreased by CD40 activation (Fig. 4b).

Fig. 4.

Fig. 4

Open in a new tab

(a) Cytokine mRNA expression by MRL159.5 cells activated through CD40 or B cell receptor (BCR). Cells (5 × 105/ml) were cultured for 12 h in medium alone or in the presence of mouse erythrocytes treated with bromelain (Br-MRBC; 5 × 106/ml), or anti-CD40 MoAb (5 μg/ml). Cells were then harvested and total RNA was prepared. To detect granulocyte-macrophage colony-stimulating factor (GM-CSF) mRNA, tumour necrosis factor-alpha (TNF-α) mRNA, and transforming growth factor-beta (TGF-β) mRNA, 1:32 dilutions of cDNA mixture were amplified by 26 cycles of polymerase chain reaction (PCR). For detection of IL-10 mRNA and β-actin mRNA, 1:8 dilution of cDNA mixture was amplified by 26 cycles of PCR. The final PCR products (10%) were electrophoresed on an ethidium bromide-stained agarose gel. The cytokine PCR products were normalized in relation to β-actin. (b) Cytokine secretion from MRL159.5 activated through CD40 or BCR. Cells (5 × 103) were cultured for 48 h in medium alone or in the presence of Br-MRBC (1 × 106/well) or anti-CD40 MoAb (5 μg/ml), and culture supernatants were assayed for cytokine activity as described in Materials and Methods. Data represent the mean ± s.d. of triplicate assays.

DISCUSSION

We previously reported that B cell hybridomas between B lymphoma cell lines and murine splenic B cells may be a good model to study B cell growth and differentiation, because these hybridomas share certain characteristics with B cells used in the cell fusion and have a monoclonal origin [15,16]. MRL159.5, a representative subclone of the hybridomas established in this study, possessed a receptor molecule for Br-MRBC (Table 1). In addition, MRL159.5 was shown to generate a significant amount of IgM after treatment with Br-MRBC or IL-6 (Table 2). So, it is likely that MRL159.5 is an autoreactive B cell clone reactive against Br-MRBC and IL-6. Previously, Linder & Edgington identified two types of autoantigens present on MRBC: one is the X antigen expressed on the erythrocyte surface, and the other is the HB antigen revealed only by treatment of MRBC with proteolytic enzyme bromelain [26]. Immunologic autoresponsiveness to Br-MRBC can be detected as RFC [27] and plaque-forming cells (PFC) using Br-MRBC [28] at the cellular level, and the presence of Br-MRBC-reactive B cells has been detected in spleen cells from both autoimmune and normal mice [28,29]. The present study was undertaken to investigate a regulatory role of endogenous IL-6 in polyclonal B cell activation in autoimmune disease by using this autoreactive B cell clone.

An association between CD40 and IL-6 signalling has previously been demonstrated by Clark & Shu [30], suggesting that there is a connection between CD40 and IL-6 signalling pathways during normal B cell differentiation; ligation of CD40 increased IL-6 secretion in normal human B cells and a murine lymphoma cell line transfected with the human CD40 gene. Conversely, binding of IL-6 to the high-affinity IL-6R resulted in increased phosphorylation of CD40, which in turn stimulated IL-6 production. In our experiments, CD40 engagement augmented the induction of IL-6 expression, and co-triggering of CD40 and the BCR via Br-MRBC or costimulation of CD40 and IL-4 synergistically augmented the induction of IL-6 expression in MRL159.5 (Fig. 2). These results suggest that CD40 signalling is critical for the induction of endogenous IL-6 in autoreactive B cells, and that IL-4 or BCR triggering up-regulates their IL-6 expression. The functional role of an IL-6 autocrine loop in the proliferation and differentiation of normal human B cells has been demonstrated [3,4,22,23]. However, one cannot eliminate the possibility that very small numbers of other cell types remaining in the populations used for their experiments might have been involved in B cell differentiation. Thus, this study was initiated to establish the pattern of an IL-6 autocrine loop for the differentiation at a B cell clonal level. In our experiments, CD40 engagement induced IL-6 production and IgM generation (Fig. 2) and blocking the binding of IL-6 to its cellular receptor through the use of inhibitory MoAbs inhibited CD40-induced IgM generation (Table 3), suggesting a possible autocrine role of IL-6 for the differentiation of this B cell hybridoma.

Such an IL-6 autocrine loop is regulated by the production of endogenous IL-6 and the induction of IL-6Rα (gp80), which allows IL-6 responsiveness after association with the constitutively expressed gp130-transducing chain [31]. Previous studies suggest that hyperactivity of B cells observed with autoimmune disease is caused by an autocrine IL-6 loop: lpr mice exhibit over-production of IL-6 [8] and over-expression of IL-6R on B cells [12], and in human systemic lupus erythematosus (SLE) constitutive expression of IL-6R contributes to the excessive B cell function [6]. The hybridoma established in this study constitutively expressed gp80, and was augmented to express IL-6 by CD40 triggering, therefore it seems to have characteristics of B cells observed in autoimmune disease. One may argue that expression of IL-6 and gp80 in this B cell clone may reflect artificial hybridoma characteristics, since B cell hybridomas have the characteristics of secreting IL-6 [20] and expressing IL-6R on their surface [32]. However, we did not detect gp80 expression by 2.52M, a cell fusion partner of this hybridoma, and IL-6 expression by 2.52M was very weak (data not shown). Furthermore, the amount of IL-6 and gp80 expression by B cell hybridomas established between normal BALB/c mouse splenic B cells and 2.52M, a HAT-sensitive B lymphoma cell line, was smaller than that by MRL159.5 cells (manuscript in preparation). Thus, it is likely that augmented IL-6 and gp80 expression by MRL159.5 is reflective of characteristics of lpr mouse splenic B cells.

One of the most striking findings to emerge from the present study was the observation that gp80 expression was down-regulated when high levels of endogenous IL-6 expression were induced by co-triggering with CD40 and BCR or activation through CD40 and IL-4 (Fig. 3). Kishimoto et al. reported that IL-6R is not expressed on resting B cells but is inducible on activated B cells [33]. Our result that IL-6R is expressed on MRL159.5 agrees with the observation that MRL159.5, which spontaneously produced IgM and are at a more differentiated stage, responded well to IL-6 and generated IgM (Table 2). These facts reflect that IL-6 acts on B cells at a final maturation stage as a differentiation factor and provides a role of an IL-6 autocrine loop at a final maturation stage of autoreactive B cells in autoimmune disease. Furthermore, our present study showed negative feedback mechanisms of IL-6R expression during the final B cell maturation stage. Such regulation of IL-6R expression in autoreactive B cells is probably important in the control of B cell maturation to prevent uncontrolled activation of B cells.

It is well known that anti-CD40 MoAb promotes DNA synthesis but does not induce immunoglobulin secretion by murine B cells [34]. In our experiment, anti-CD40 MoAb augmented IgM secretion by MRL159.5. The precise mechanisms involved in this process are unclear at the present time. However, it should be emphasized that B cells used in their experiments, showing that anti-CD40 MoAb promotes DNA synthesis but does not induce immunoglobulin secretion [34], were obtained from spleen cells of unprimed mice and were therefore considered to be resting B cells, in contrast to the B cell line used in our study. It is possible that engagement of CD40 directly stimulates immunoglobulin production by means of various signalling pathways and nuclear factors known to be induced by ligation of this surface molecule [35,36]. Alternatively, the functional role of CD40 ligation might be indirect, mediated by surface molecules or cytokines induced by CD40L. In this regard, CD40 ligation increased IL-6 production and blocking MoAbs to IL-6 and gp80 had a partial inhibitory effect on immunoglobulin secretion induced by CD40 ligation, suggesting that immunoglobulin secretion by CD40 may be mediated in part by direct action and partly by IL-6 induced by CD40L. Supporting our findings, Bergman et al. reported that ligation of CD40 directly augmented immunoglobulin secretion of human immunoglobulin-secreting B cell hybridomas [37].

Four additional cytokine gene expressions were assessed in this B cell clone activated either through CD40 or the BCR. Using RT-PCR analysis, TNF-α, and GM-CSF mRNA expression were augmented by activation through CD40. In contrast, IL-10 mRNA expression was down-regulated and TGF-β mRNA expression remained unchanged following triggering of CD40 (Fig. 4a). Several reports of human B cell cytokine expression and regulation have been described. Matthes et al. [25] have demonstrated that immunoglobulin-secreting cells generated from human B cells in the EL-4 culture system, involving a CD40-mediated B cell activation signal, transiently express TNF-α and IL-6 mRNA during the early stage of B cell maturation, but continue to express TGF-β1 mRNA during the late stage of B cell maturation. Burdin et al. have reported that CD40 cross-linking induces purified human tonsillar B cells to secrete IL-1β, IL-6, IL-10, GM-CSF and TNF-α [4]. These results suggest that CD40 signalling plays a crucial role in B cell cytokine regulation and that these cytokines are programmed at every stage of B cell differentiation. Consistent with the report by Burdin et al. [4], our experiments demonstrate that ligation of CD40 on MRL159.5 cells, an immunoglobulin-secreting B cell hybridoma, induced TNF-α, IL-6 and GM-CSF mRNA expression. However, in contrast to their observation that CD40 cross-linking induced human tonsillar B cells to secrete IL-10, in our study IL-10 mRNA expression in MRL159.5 cells was down-regulated by activation through CD40 (Fig. 4a). This may suggest a stage-specific regulation of IL-10 mRNA expression; they used resting B cells, while MRL159.5 is an immunoglobulin-secreting B cell hybridoma which has the characteristics of a B cell at the late stages of maturation. In support of this hypothesis, Matthes et al. [25] demonstrated that IL-10 mRNA expression is induced at the early stage of B cell maturation, but is progressively lost at the late stage, as assessed by an in vitro EL-4 culture system. Taken together, our data specifically show that CD40 regulates an IL-6 autocrine loop in autoreactive B cells during a late stage of B cell maturation. Further experiments using such B cell clones will be required to establish a crucial role of endogenous IL-6 during the differentiation process of autoreactive B cells in autoimmune disease.

Acknowledgments

We would like to thank Dr Takako Iwasaki for technical help and for discussion and comments concerning the manuscript.

REFERENCES

  • 1.Lanzavecchia A. Antigen-specific interaction between T and B cells. Nature. 1985;314:537–9. doi: 10.1038/314537a0. [DOI] [PubMed] [Google Scholar]
  • 2.Ronches F, Hausmann B. B lymphocytes in vivo fail to prime naive T cells but can stimulate antigen-experienced T lymphocytes. J Exp Med. 1993;177:679–90. doi: 10.1084/jem.177.3.679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Rieckman P, Alessandro FD, Nordan RP, Fauci AS, Kehrl JH. IL-6 and tumor necrosis factor alpha: autocrine and paracrine cytokines involved in B cell function. J Immunol. 1991;146:3462–8. [PubMed] [Google Scholar]
  • 4.Burdin N, Van Kooten C, Galibert L, Abrams JS, Wijdenes J, Banchereau J, Rousset F. Endogenous IL-6 and IL-10 contribute to the differentiation of CD40-activated human B lymphocytes. J Immunol. 1995;154:2533–44. [PubMed] [Google Scholar]
  • 5.Ford RJ, Tamayo A, Ambrus JL. The role of growth factors in human lymphoma. Curr Top Microbiol Immunol. 1992;182:341–7. doi: 10.1007/978-3-642-77633-5_44. [DOI] [PubMed] [Google Scholar]
  • 6.Nagafuchi H, Suzuki N, Mizushima Y, Sakane T. Constitutive expression of IL-6 receptors and their role in the excessive B cell function in patient with systemic lupus erythematosus. J Immunol. 1993;151:6525–34. [PubMed] [Google Scholar]
  • 7.Murray L, Martens C. The abnormal T lymphocytes in lpr mice transcribe interferon-gamma and tumor necrosis factor-alpha genes spontaneously in vivo. Eur J Immunol. 1989;19:563–5. doi: 10.1002/eji.1830190325. [DOI] [PubMed] [Google Scholar]
  • 8.Tang B, Matsuda T, Akira S, Nagata N, Ikehara S, Hirano T, Kishimoto T. Age-associated increase in interleukin 6 in MRL/lpr mice. Int Immunol. 1991;3:273–8. doi: 10.1093/intimm/3.3.273. [DOI] [PubMed] [Google Scholar]
  • 9.Theofilopoulos AN, Dixon FJ. Murine models of systemic lupus erythematosus. Adv Immunol. 1985;37:269–90. doi: 10.1016/s0065-2776(08)60342-9. [DOI] [PubMed] [Google Scholar]
  • 10.Morse HC, Davidson WF, Yetter RA, Murphy ED, Roth JB, Coffman RL. Abnormalities induced by the mutant gene lpr: expression of unique lymphocyte subset. J Immunol. 1982;129:2612–5. [PubMed] [Google Scholar]
  • 11.Watanabe-Fukunaga R, Brannan CI, Copeland NG, Jenkins NA, Nagata S. Lymphoproliferative disorders in mice explained by defects in Fas antigen that mediate apoptosis. Nature. 1992;356:314–7. doi: 10.1038/356314a0. [DOI] [PubMed] [Google Scholar]
  • 12.Kobayashi I, Matsuda T, Saito T, Yasukawa K, Kikutani H, Hirano T, Taga T, Kishimoto T. Abnormal distribution of IL-6 receptor in aged MRL/lpr mice: elevated expression on B cells and absence on CD4+ cells. Int Immunol. 1992;4:1407–12. doi: 10.1093/intimm/4.12.1407. [DOI] [PubMed] [Google Scholar]
  • 13.Bankhurst AD, Torrigiani G, Allison AC. Lymphocytes binding human thyroglobulin in healthy people and its relevance for autoantigens. Lancet. 1973;1:226–30. doi: 10.1016/s0140-6736(73)90066-4. [DOI] [PubMed] [Google Scholar]
  • 14.Sjoberg O, Moller E. Antigen binding cells in tolerant animals. Nature. 1970;228:780–1. doi: 10.1038/228780a0. [DOI] [PubMed] [Google Scholar]
  • 15.Iwasaki T, Hamano T, Hase K, Murata Y, Yamasaki T, Kakishita E. Functional role of self IA molecules in polyclonal B cell activation using an autoreactive B cell clone derived from (NZB X NZW) F1 mice. Cell Immunol. 1992;139:386–98. doi: 10.1016/0008-8749(92)90080-9. [DOI] [PubMed] [Google Scholar]
  • 16.Hamano T, Murata Y, Yamasaki T, Yasuda Y, Iwasaki T, Nagai K. Establishment of an antigen-specific B cell clone by somatic hybridization. J Immunol. 1987;139:2556–61. [PubMed] [Google Scholar]
  • 17.Hasbold J, Johnson-Leger C, Atkins CJ, Clark EA, Klaus GGB. Properties of CD40: cellular distribution of CD40 and B cell activation by monoclonal anti-mouse CD40 antibodies. Eur J Immunol. 1994;24:1835–42. doi: 10.1002/eji.1830240817. [DOI] [PubMed] [Google Scholar]
  • 18.Hoffeld JT, Marrack P, Kappler JW. Antigen-specific and nonspecific mediators of T cell/B cell cooperation. IV. Development of a model system demonstrating responsiveness of two T cell functions to HGG in vitro. J Immunol. 1976;117:1960–5. [PubMed] [Google Scholar]
  • 19.Auget M, Merlin G. Purification of human gamma interferon receptors by sequential affinity chromatography on immobilized monoclonal antireceptor antibodies and human gamma interferon. J Exp Med. 1987;165:988–99. doi: 10.1084/jem.165.4.988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Little J, Alling DW, Asofsky R. Induction of differentiation in a B lymphoma × B lymphocyte hybrid line. II. Intraclonal heterogeneity in growth, secretion of IgM, and cytokine production in response to lipopolysaccharide. J Immunol. 1993;150:2129–38. [PubMed] [Google Scholar]
  • 21.Becker S, Quay J, Soukup J. Cytokine (tumor necrosis factor, IL-6, and IL-8) production by respiratory syncytial virus-infected human alveolar macrophage. J Immunol. 1991;147:4307–12. [PubMed] [Google Scholar]
  • 22.Vercelli D, Jabara HH, Arai K, Yokota T, Geha RS. Endogenous interleukin 6 plays an obligatory role in interleukin 4-dependent human IgE synthesis. Eur J Immunol. 1989;19:1419–24. doi: 10.1002/eji.1830190811. [DOI] [PubMed] [Google Scholar]
  • 23.Jabara HH, Fu SM, Geha RS, Vercelli D. CD40 and IgE: synergism between anti-CD40 monoclonal antibody and interleukin 4 in the induction of IgE synthesis by highly purified human B cells. J Exp Med. 1990;172:1861–4. doi: 10.1084/jem.172.6.1861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.O'Garra A, Stapleton G, Dhar V, et al. Production of cytokine by mouse B cells: B lymphomas and normal B cells produce interleukin 10. Int Immunol. 1990;9:821–32. doi: 10.1093/intimm/2.9.821. [DOI] [PubMed] [Google Scholar]
  • 25.Matthes T, Werner FC, Tang H, Zhang X, Zubler RH. Cytokine mRNA expression during an in vitro response of human B lymphocytes; kinetics of B cell tumor necrosis factor alpha, interleukin (IL)-6, IL-10, and transforming growth factor beta1 mRNAs. J Exp Med. 1993;178:521–8. doi: 10.1084/jem.178.2.521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Linder E, Edgington TS. Immunobiology of the autoantibody response. II. The lipoprotein-associated soluble HB erythrocyte autoantigen of NZB mice. J Immunol. 1973;110:53–62. [PubMed] [Google Scholar]
  • 27.Negoro S, Takahashi T, Fujuwara H, Tsuyuguchi I. Regulatory mechanism of autoantibody production in mice to bromelain-treated isologous red blood cells. Immunology. 1979;36:257–64. [PMC free article] [PubMed] [Google Scholar]
  • 28.Canningham AJ. Large numbers of cells in normal mice produce antibody components of isologous erythrocytes. Nature. 1974;252:749–51. doi: 10.1038/252749a0. [DOI] [PubMed] [Google Scholar]
  • 29.Lord E, Dutton RW. The properties of plaque-forming cells from autoimmune and normal strains of mice with specificity for autologous erythrocyte antigens. J Immunol. 1975;115:1199–205. [PubMed] [Google Scholar]
  • 30.Clark EA, Shu G. Association between IL-6 and CD40 signaling. IL-6 induces phosphorylation of CD40 receptor. J Immunol. 1990;145:1400–6. [PubMed] [Google Scholar]
  • 31.Hibi M, Murakami M, Saito M, Hirano T, Taga T, Kishimoto T. Characterization of IL-6 receptor expression by monoclonal and polyclonal antibodies. Cell. 1990;63:1149–57. [Google Scholar]
  • 32.Coulie PG, Stevens M, Van Snick J. High- and low-affinity receptors for murine interleukin 6. Distinct distribution on B and T cells. Eur J Immunol. 1989;19:2107–14. doi: 10.1002/eji.1830191121. [DOI] [PubMed] [Google Scholar]
  • 33.Taga T, Kawanishi Y, Hardy R, Hirano T, Kishimoto T. Receptor for B cell stimulatory factor 2: quantitation, specificity, distribution and regulation of their expression. J Exp Med. 1987;166:967–81. doi: 10.1084/jem.166.4.967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Axcrona K, Gray D, Leanderson T. Regulation of B cell growth and differentiation via CD21 and CD40. Eur J Immunol. 1996;26:2203–7. doi: 10.1002/eji.1830260936. [DOI] [PubMed] [Google Scholar]
  • 35.Berberich I, Shu GL, Clark EA. Cross-linking CD40 on B cells rapidly activates nuclear factor-κB. J Immunol. 1994;153:4357–66. [PubMed] [Google Scholar]
  • 36.Choi MS, Brines RD, Holman MJ, Klaus GG. Induction of NF-AT in normal B lymphocytes by anti-immunoglobulin or CD40 ligand in conjunction with IL-4. Immunity. 1994;1:179–87. doi: 10.1016/1074-7613(94)90096-5. [DOI] [PubMed] [Google Scholar]
  • 37.Bergman MC, Attrep JF, Grammer AC, Lipsky PE. Ligation of CD40 influences the function of human Ig-secreting B cell hybridoma both positively and negatively. J Immunol. 1996;156:3118–32. [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES