Skip to main content
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2000 Aug;121(2):302–310. doi: 10.1046/j.1365-2249.2000.01298.x

Comparative roles of free fatty acids with reactive nitrogen intermediates and reactive oxygen intermediates in expression of the anti-microbial activity of macrophages against Mycobacterium tuberculosis

T Akaki *,†, H Tomioka *, T Shimizu *, S Dekio †, K Sato *
PMCID: PMC1905686  PMID: 10931146

Abstract

We assessed the role of free fatty acids (FFA) in the expression of the activity of macrophages against Mycobacterium tuberculosis in relation to the roles of two major anti-microbial effectors, reactive nitrogen intermediates (RNI) and reactive oxygen intermediates (ROI). Intracellular growth of M. tuberculosis residing inside macrophages was accelerated by treatments of macrophages with either quinacrine (phospholipase A2 (PLA2) inhibitor), arachidonyl trifuloromethylketone (type IV cytosolic PLA2 inhibitor), NG-monomethyl-l-arginine (nitric oxide synthase inhibitor), and superoxide dismutase plus catalase (ROI scavengers). In addition, M. tuberculosis-infected macrophages produced and/or secreted these effectors sequentially in the order ROI (0–3 h), FFA (0–48 h), and RNI (3 to at least 72 h). Notably, membranous FFA (arachidonic acid) of macrophages translocated to M. tuberculosis residing in the phagosomes of macrophages in phagocytic ability-and PLA2-dependent fashions during cultivation after M. tuberculosis infection. FFA, RNI and H2O2-mediated halogenation system (H2O2-halogenation system) displayed strong activity against M. tuberculosis in cell-free systems, while ROI alone exerted no such effects. Combinations of ‘FFA + RNI’ and ‘RNI + H2O2-halogenation system’ exhibited synergistic and additive effects against M. tuberculosis, respectively, while ‘FFA + H2O2-halogenation system’ had an antagonistic effect. Moreover, a sequential attack of FFA followed by RNI exerted synergistic activity against M. tuberculosis. Since M. tuberculosis-infected macrophages showed simultaneous production of RNI with FFA secretion for relatively long periods (approx. 45 h) and prolonged RNI production was seen thereafter, RNI in combination with FFA appear to play critical roles in the manifestation of the activity of macrophages against M. tuberculosis.

Keywords: macrophages, Mycobacterium tuberculosis, free fatty acids, reactive nitrogen intermediates, reactive oxygen intermediates

Introduction

Growth and replication of Mycobacterium tuberculosis within host macrophages are well-documented features of the pathogenesis of tuberculosis (TB) and are critical to the establishment of M. tuberculosis infection [1]. Macrophages play a central role as anti-microbial effector cells in the expression of host resistance to M. tuberculosis. As previously reported, the therapeutic efficacies of certain anti-mycobacterial drugs, including fluoroquinolones, rifamycin derivatives, and new macrolides, against M. tuberculosis and M. avium complex infections well correlate to their anti-microbial activities against the organisms multiplying in the host macrophages [2–4]. Therefore, from the point of view of the clinical treatment of TB and M. avium complex infections, it is important to investigate the detailed profiles of the anti-microbial mechanisms of macrophages against mycobacterial pathogens.

Despite some controversy on the subject, effectors of the anti-mycobacterial activity of macrophages are believed to act in the following ways. Reactive nitrogen intermediates (RNI) have been demonstrated to play an important role in the activity of macrophages against M. tuberculosis in cases of murine macrophages [5–7], particularly by studies using interferon-gamma (IFN-γ) gene-knockout mice [8]. Studies employing inducible nitric oxide synthase (iNOS) gene-disrupted mice indicated that RNI were required for the activity of macrophages against M. tuberculosis [9,10], but not responsible for the macrophage function to cope with M. avium [11]. It has also been reported that human monocytes are lacking iNOS and the enzyme system for the synthesis of tetrahydrobiopterin, an essential cofactor required for nitric oxide synthesis [12]. However, recent studies have revealed that the alveolar macrophages of TB patients express significant levels of iNOS [13] and that RNI play a role in the inhibition of the growth of M. tuberculosis within human alveolar macrophages [14].

With respect to the role of reactive oxygen intermediates (ROI), it has been reported that ROI are insufficient to inhibit and/or kill M. tuberculosis [7,10,15,16]. However, we recently found that a H2O2-mediated halogenation system (H2O2-halogenation system) was potently efficacious in killing M. avium complex [17]. It thus appears that the H2O2-halogenation system may be involved in the activity of macrophages against M. tuberculosis, when the phagosomes of macrophages are supplied with catalytic Fe2+ by the action of divalent-cation transporter proteins encoded by Nramp-1 gene [18]. However, this concept needs some consideration, since the divalent cation transporters are also involved in the export of divalent cations, especially Fe2+ ions, from phagosomes, thereby causing the deprivation of divalent cations from the intracellular pathogens [19]. Moreover, it has been reported that Nramp-1 affects intracellular mycobacterial replication by modulating phagosomal pH, suggesting that Nramp protein plays a central role in this process [20].

We previously found that there was no relationship between the degree of susceptibility of a given M. avium complex strain to RNI and ROI and its virulence in mice [21]. Thus, RNI and ROI each alone are not decisive as the effector components of the host defence mechanism against M. avium complex, and alternative effectors may be involved in the anti-mycobacterial activity of macrophages. We previously found that free fatty acids (FFA), including arachidonic acid, exhibited strong anti-mycobacterial activity [22]. Virulent strains of M. avium complex were more resistant to FFA than were the avirulent strains [22], suggesting possible roles of FFA in the expression of anti-mycobacterial activity by macrophages. In the present study we examined the role of FFA in the expression of the activity of macrophages against M. tuberculosis, with special reference to their collaborating effects with RNI and ROI.

Materials and methods

Microorganisms

Mycobacterium tuberculosis H37Rv (virulent strain) grown in 7H9 medium (Difco Labs, Detroit, MI) was used.

Special agents

Arachidonic acid, xanthine oxidase (XOA), catalase, NG-monomethyl-l-arginine (NMMA), quinacrine, manoalide, desferrioxamine, bovine serum albumin (BSA), and zymosan A were obtained from Sigma Chemical Co. (St Louis, MO). 3H-arachidonic acid (3H-AA) was purchased from American Radiolabeled Chemicals, Inc. (St Louis, MO). Murine recombinant interferon-gamma (IFN-γ) was supplied by Genzyme Co. (Cambridge, MA). Arachidonyl trifluoromethylketone ( a-TFMK) was supplied from Research Biochemicals Int. (Natick, MA). Other agents including superoxide dismutase (SOD) were purchased from Wako Pure Chemical Industries (Osaka, Japan).

Medium

RPMI 1640 medium (Nissui Pharmaceutical Co., Tokyo, Japan) supplemented with 25 mm HEPES, 2 mm glutamine, and 5% (v/v) heat-inactivated fetal bovine serum (FBS) (Bio Whittaker Co., Walkersville, MD) was used for cell culture.

Anti-microbial activity of macrophages against M. tuberculosis

Zymosan A-elicited peritoneal exudate cells (PEC) obtained from 6–12-week-old female BALB/c mice (Japan Clea Co., Osaka, Japan) were suspended in 0·1 ml of the medium, seeded into microculture wells (flat-bottomed 96-well), and incubated at 37°C in a CO2 incubator (5% CO2−95% humidified air) for 2 h. After rinsing with 2% FBS–Hanks' balanced salt solution (HBSS), a 0·1-ml portion of the medium containing test organisms (1·5 × 105 colony-forming units (CFU)) was poured onto the monolayer culture of macrophages (5 × 103 cells/well).

Macrophages were incubated at 37°C for 2 h to allow infection with M. tuberculosis organisms at the multiplicity of infection (MOI) of 30. After washing three times with 2% FBS–HBSS to remove extracellular M. tuberculosis, infected macrophages were cultured in the medium (0·2 ml) with or without the addition of test agents at 37°C for 5 days. After cultivation, macrophages were lysed with 0·07% SDS followed by neutralization with 6% BSA. The number of bacterial CFU in the resultant lysate of macrophages was counted on 7H11 agar plates. In some experiments, macrophages were pretreated with 500 U/ml of IFN-γ for 3 days. The growth of M. tuberculosis residing in IFN-γ-activated macrophages was 37–53% of that observed in unstimulated macrophages (unpublished observation).

RNI, FFA, and ROI production by macrophages

Test macrophages were prepared as follows. PEC (2 × 107 cells) were cultured in 10 ml of the medium on a FBS-coated 80-mm culture dish at 37°C for 2 h. After rinsing with 2% FBS–HBSS, macrophages (≥ 90% pure) were scraped off into 20% FBS–RPMI medium with rubber policemen and collected by centrifugation.

RNI production by macrophages was measured in terms of NO2− accumulation in culture supernatant. Test macrophages (5 × 105 cells) were cultured in 1·0 ml of the medium containing M. tuberculosis (2·5 × 107/ml) in 16-mm culture wells at 37°C for up to 4 days. At intervals, culture supernatants were removed and allowed to react with Griess reagent, and the NO2− content was quantified by measuring the absorption at 550 nm. Mycobacterium tuberculosis alone did not generate NO2−.

FFA release by macrophages was measured as described by Neve et al. [23]. Test macrophages (6 × 106 cells) were cultured in 3 ml of the medium containing 4 μCi/ml of 3H-AA (80 Ci/mmole) in polypropylene tubes at 37°C for 24 h. After rinsing with 2% FBS–HBSS, 3H-AA-loaded macrophages (2·5 × 104 cells) were cultured in 0·2 ml of the medium containing 2 × 106 M. tuberculosis in microculture wells at 37°C for up to 48 h. The radioactivity liberated into culture fluid was measured by using a Tri-Carb liquid scintillation spectrometer (Packard Instrument Co., Downers Grove, IL).

ROI production by macrophages was measured in terms of chemiluminescence. Macrophages (5 × 105 cells) were suspended in 0·9 ml of HBSS containing 10 mm HEPES and 0·1 mm luminol. Then, 0·1 ml of M. tuberculosis suspension (2·5 × 107 CFU) was added to the incubation mixture and incubated at 37°C. Photoemission was measured in a lumiphotometer (Lumicounter ATP-237; Toyo Kagaku Industry, Tokyo, Japan).

Bacterial killing by anti-microbial effectors

The anti-microbial activities of RNI, FFA, H2O2-halogenation system, and XOA-Fe2+-EDTA system (XOA system) against M. tuberculosis were measured as follows. First, for measurement of the activity of RNI, M. tuberculosis organisms (approx. 106 CFU) were treated with RNI generated in a reaction mixture (1·0 ml) containing 1·0–3·0 mg/ml of NaNO2, in 100 mm sodium acetate buffer pH 5·5 at 37°C for 2 h. Second, for measurement of the activity of FFA, M. tuberculosis organisms were treated with 2·5–10 μg/ml of FFA (arachidonic acid), which were dissolved or finely emulsified in 1·0 ml of 100 mm sodium acetate buffer pH 5·5, at 37°C for 1 or 2 h. Third, the activity of the H2O2-halogenation system was measured by treating M. tuberculosis organisms in a reaction mixture (1·0 ml) consisting of 10 or 20 μm of H2O2, 10 or 20 μm of NaI, and 1–10 μm of FeSO4 in 100 mm of sodium acetate buffer pH 5·5 at 37°C for 1 or 2 h. In this experiment, H2O2, NaI, and FeSO4 alone at test concentrations were not toxic for the M. tuberculosis. Fourth, the activity of the XOA system was measured by treating organisms in a reaction mixture (1·0 ml) consisting of 20–200 μg/ml of XOA, 10–25 mm of acetaldehyde, 100 μm of FeSO4, and 100 μm of EDTA in 100 mm sodium acetate buffer pH 5·5 at 37°C for 2 h.

After individual treatments of test organisms, residual numbers of bacterial CFU were counted on 7H11 agar. In this study, the pHs of the anti-microbial systems were fixed at 5·5, since current evidence indicated that the phagosomes of macrophages engulfing virulent mycobacterial pathogens equilibrated to pHs of 5·5–5·7 after bacterial phagocytosis [24].

Translocation of membranous FFA to M. tuberculosis residing inside macrophages

Macrophages (2·5 × 105 cells) loaded with 3H-AA as mentioned above were suspended in 0·2 ml of culture medium containing 5 × 107 CFU of M. tuberculosis organisms and then incubated at 37°C for 2 h. After washing with 2% FBS–HBSS by centrifugation (120 g, 5 min) to remove extracellular organisms, M. tuberculosis-infected macrophages were cultivated at 37°C for up to 12 h. At intervals, cultured macrophages were collected, washed with 2% FBS–HBSS, and lysed with 0·07% SDS for 10 min. The pellet containing M. tuberculosis organisms residing inside macrophages and insoluble cell debris was then collected by centrifugation (4200 g, 10 min) and the radioactivity of recovered organisms was measured using toluene-based scintillant containing Triton X-100.

Expression of iNOS and phospholipase A2 mRNAs by macrophages

The expression of iNOS and phospholipase A2 (PLA2) mRNAs by macrophages was measured by reverse transcription-polymerase chain reaction (RT-PCR) as follows. The monolayer cultures of macrophages prepared by seeding 5·0 × 106 of PEC were precultivated in a 60-mm culture dish (Becton Dickinson) in 5 ml of culture medium with or without the addition of 500 U/ml of IFN-γ for 3 days. After washing with 2% FBS–HBSS, the resultant macrophages were cultured for 2 h in the medium containing 1·0 × 106 CFU/ml of M. tuberculosis. After infection with M. tuberculosis, the macrophages were washed with 2% FBS–HBSS and then cultivated in the fresh medium for up to 12 h. At intervals, total RNA was isolated from the cultured macrophages and subjected to RT-PCR as described previously [25]. Briefly, after DNase-I treatment of the RNA sample, the resultant RNA samples were reverse transcribed to the first strand of cDNA using oligo dT primers and Superscript II reverse transcriptase (Gibco, Rockville, MD) according to the recommendations of the manufacturer. After 1 h reaction at 42°C and subsequent heating at 72°C, the resultant cDNA samples were subjected to PCR in the standard reaction mixture consisting of PCR buffer (10 mm Tris–HCl pH 8·3, 50 mm KCl, and 1·5 mm MgCl2), dNTPs, Taq polymerase (Takara Biomedicals Co., Tokyo, Japan), and sense and antisense primers for iNOS, type IIa secretory PLA2 (sPLA2), and type IV cytosolic PLA2 (cPLA2) as follows (sense/antisense): iNOS, CCTGCTCACTCAGCCAAG/AGTCATGGAGCCGCTGCT; type IIa sPLA2, CGGCTTAAGACAGGAAAGAGAG/TGCAAAACATGTTGGGGTAGAA; type IV cPLA2, CTTACACCACAGAAAGTTAAAAGAT/AAATAGGTCAGGAGCCATAAA. PCR was performed for 30 cycles including denaturing at 94°C for 1 min, annealing at 58°C for 2 min, and extension at 72°C for 2 min for each cycle. PCR products were analysed by electrophoresis on 2% ethidium bromide-stained agarose gels.

Statistical analysis

Statistical analysis was performed using Bonferroni's multiple t-test or Student's t-test.

Results

Roles of FFA, RNI, and ROI in expression of the activity of macrophages against M. tuberculosis

We have determined whether or not FFA, RNI, and ROI play roles in the activity of macrophages against M. tuberculosis. As shown in Fig. 1, the addition of 5 μm quinacrine (PLA2 inhibitor) [26], 0·5 mm NMMA (NOS inhibitor) [27], or ‘1000 U/ml SOD + 900 U/ml catalase’ (scavengers of O2− and H2O2, respectively), significantly accelerated the growth of the organisms in IFN-γ-activated macrophages (P < 0·01; Student's t-test). The same result was obtained for unstimulated macrophages (data not shown). These metabolic inhibitors at test concentrations did not cause cytotoxic effects on macrophages on the basis of recovery and morphology of macrophages after 5-day cultivation. These findings suggest that FFA, RNI, and ROI are involved in the activity of macrophages against M. tuberculosis.

Fig. 1.

Fig. 1

Effects of some metabolic inhibitors on the growth of Mycobacterium tuberculosis residing in IFN-γ-activated murine peritoneal macrophages. Mycobacterium tuberculosis-infected macrophages were cultured in the presence or absence of either quinacrine (5 μm), NG-monomethyl-l-arginine (NMMA; 0·5 mm), or ‘superoxide dismutase (SOD; 1000 U/ml) + catalase (900 U/ml)’ for 5 days, and thereafter the number of colony-forming units (CFU) of intracellular organisms were enumerated. Each bar indicates the mean ± s.e.m. (n = 3). *Significantly different from the value of control macrophages (without test metabolic inhibitors) (P < 0·01; Student's t-test).

Figure 2 shows profiles of the production/secretion of these effectors by macrophages in response to M. tuberculosis infection. ROI production was initiated immediately after M. tuberculosis infection, peaked at 1 h, and then rapidly ceased within 3 h. FFA secretion was initiated within 1 h, peaked at 6 h, and thereafter gradually decreased, reaching the base line by 48 h. The onset of RNI production was much delayed compared with ROI and FFA production/secretion. RNI production gradually increased after M. tuberculosis infection from 3 h until 72 h. In separate experiments, RNI production continued at least up until 96 h.

Fig. 2.

Fig. 2

Time course of production/secretion of reactive oxygen intermediates (ROI) (○), free fatty acids (FFA) (Δ), and reactive nitrogen intermediates (RNI) (•) by macrophages in response to stimulation due to Mycobacterium tuberculosis infection. ROI and RNI production was measured in terms of chemiluminescence and NO2− accumulation into culture medium, respectively. FFA secretion was measured in terms of liberation of radioactive arachidonic acid from macrophages which had been labelled with 3H-arachidonic acid (3H-AA). Each plot indicates the mean ± s.e.m. (n = 3).

Intramacrophagial attack of FFA molecules on M. tuberculosis

Although the above results indicated that M. tuberculosis-infected macrophages secreted significant amounts of FFA into the extracellular milieu, it was still unknown whether the FFA attacked intracellular M. tuberculosis organisms residing inside the phagosomes of macrophages. In order to obtain this evidence, we examined the mode of translocation of membranous FFA to M. tuberculosis residing inside macrophages, by using macrophages loaded with 3H-AA. As shown in Figure 3a, the radioactivity of M. tuberculosis organisms, which were recovered from infected macrophages, was progressively increased during macrophage cultivation after M. tuberculosis infection. Such a phenomenon was blocked when macrophages were treated with quinacrine (PLA2 inhibitor) or cytochalasin D (microfilament inhibitor causing reduction of the membrane function of macrophages required for phagocytosis of bacteria by macrophages) (Fig. 3b). Therefore, 3H-AA incorporated in membranous phospholipids of macrophages appears to translocate to their phagosomal vesicles, concurrently with bacterial internalization due to phagocytosis. It seems that, in the next step, PLA2 might liberate 3H-AA molecules from the phagosomal membrane into the phagosome microenvironment and that the released 3H-AA molecules are then attached to M. tuberculosis organisms within the phagosomes. However, there still remains the possibility that the arachidonic acid attached to the M. tuberculosis organisms comes from exogenous arachidonic acid secreted by macrophages during the infection, since mycobacterial phagosomes of macrophages are fusion competent and therefore accessible to exogenous material [28].

Fig. 3.

Fig. 3

Evidence for the translocation of membranous free fatty acid (FFA) molecules to the intracellular Mycobacterium tuberculosis residing in macrophages. (a) Macrophages loaded with 3H-arachidonic acid (3H-AA) were infected with M. tuberculosis for 2 h and cultivated for up to 12 h (see Materials and methods). ○, Uninfected macrophages; •, M. tuberculosis-infected macrophages. Each plot indicates the mean ± s.e.m. (n = 3). Significantly greater than the values of uninfected macrophages: *P < 0·05; **P < 0·01; Student's t-test. (b) 3H-AA-loaded macrophages were infected with M. tuberculosis in the presence or absence of quinacrine or cytochalasin D for 2 h and then cultivated in the medium containing corresponding metabolic inhibitors for 12 h. □, Uninfected macrophages; hatched bars, M. tuberculosis-infected macrophages cultured in medium alone (the control for quinacrine treatment) or medium containing 1% dimethyl sulfoxide (DMSO) (the solute control for cytochalasin D treatment); ▪, metabolic inhibitor-treated macrophages. Each bar indicates the mean ± s.e.m. (n = 5). Significantly greater than the value of uninfected macrophages: *P < 0·01; significantly smaller than the values of corresponding control macrophages without drug treatment: †P < 0·01.

The isoform of PLA2 which is required for expression of the activity of macrophages against M. tuberculosis

Next, we determined the isoform of PLA2 which plays a central role in the expression of the anti-microbial activity of macrophages against M. tuberculosis. As shown in Fig. 4a, intracellular growth of M. tuberculosis within the IFN-γ-activated macrophages was markedly accelerated by a-TFMK, an inhibitor of type IV 85-kD cPLA2 [29]. In contrast, manoalide, an inhibitor of type IIa 14-kD sPLA2 [30], failed to display such an effect. This finding suggests that type IV cPLA2, but not type IIa sPLA2, plays a critical role in expression of the activity of macrophages against M. tuberculosis.

Fig. 4.

Fig. 4

The role of type IV cytosolic phospholipase A2 (cPLA2) in the expression of anti-microbial activity by IFN-γ-activated murine peritoneal macrophages against Mycobacterium tuberculosis. (a) Mycobacterium tuberculosis-infected macrophages were cultured in the presence or absence of 10 or 50 μm of either manoalide (type IIa secretory PLA2 (sPLA2) inhibitor) or arachidonyl trifluoromethylketone (a-TFMK) (type IV cPLA2 inhibitor) for 5 days and, thereafter, the number of colony-forming units (CFU) of intracellular organisms was enumerated. Each bar indicates the mean ± s.e.m. (n = 4). Significantly different from the value of control macrophages (without test metabolic inhibitors): *P < 0·01 (Student's t-test). (b) Expression of inducible nitric oxide synthase (iNOS), type IIa sPLA2, and type IV cPLA2 mRNAs by IFN-γ-activated macrophages during the course of M. tuberculosis infection. Murine peritoneal macrophages were precultivated in medium with or without 500 U/ml IFN-γ for 3 days. The resulting macrophages were infected with M. tuberculosis organisms for 2 h and the infected macrophages were cultured for up to 12 h. At intervals, the macrophages were subjected to reverse transcription-polymerase chain reaction assay. The values in parentheses are iNOS or PLA2 band/β-actin band ratios.

As shown in Fig. 4b, 3-day pretreatment of macrophages with 500 U/ml of IFN-γ caused a marked increase in the expression of type IV cPLA2 mRNA as well as the iNOS mRNA. In contrast, expression of type IIa sPLA2 mRMA by macrophages was not induced by IFN-γ-treatment. In response to M. tuberculosis infection, mRNA levels of type IV cPLA2 increased to some extent during the first 2 h, followed by a subsequent decline. The iNOS mRNA expression also increased at 2 h after M. tuberculosis infection and the increased levels of mRNA expression were retained for at least 12 h. Therefore, in addition to iNOS, type IV cPLA2, but not type IIa sPLA2, is responsible for IFN-γ-mediated potentiation of the activity of macrophages against M. tuberculosis.

The anti-microbial activity of FFA, RNI, and ROI against M. tuberculosis

When M. tuberculosis was treated with either FFA (arachidonic acid: 2·5–10 μg/ml), acidified NaNO2 (2 or 3 mg/ml)-derived RNI [31], or the H2O2-halogenation system (10 or 20 μm each of H2O2 and NaI with 1–10 μm of FeSO4) for 1–2 h, effective killing of the organisms was observed. These treatments caused 0·5–2·5 log-unit reduction in the numbers of residual CFU of M. tuberculosis in a dose-dependent manner (Fig. 5; other detailed data are not shown). The anti-microbial activity of the H2O2-halogenation system against M. tuberculosis was dependent on concentrations of Fe2+ ion. In addition, NaNO2 at neutral pHs was incapable of exhibiting significant levels of activity against M. tuberculosis. Notably, the XOA system, which generates ROI (O2−, H2O2, ·OH, and 1O2) [32], displayed no bactericidal activity against M. tuberculosis (see Fig. 5), indicating that M. tuberculosis is essentially resistant to the toxicity of ROI species themselves.

Fig. 5.

Fig. 5

Anti-Mycobacterium tuberculosis activities of the combinations of (a) ‘free fatty acids (FFA) + reactive nitrogen intermediates (RNI)’, (b) ‘RNI + H2O2-halogenation system’, (c) ‘FFA + H2O2-halogenation system’, and (d) ‘RNI + xanthine oxidase-acetaldehyde (XOA) system’. Mycobacterium tuberculosis was treated with either RNI (2·5 or 3·0 mg/ml NaNO2), FFA (5 or 10 μg/ml arachidonic acid), H2O2-halogenation system (10 μm H2O2, 10 μm NaI, 1 μm FeSO4), XOA system (20 μg/ml xanthine oxidase, 10 mm acetaldehyde, 100 μm FeSO4, 100 μm EDTA), or combinations of them for 2 h (a,b,d) or 1 h (c). Each plot indicates the mean ± s.e.m. (n = 3). Significant synergistic/additive effect: *P < 0·05 (Bonferroni's multiple t-test); significant antagonistic effect: †P < 0·05 (Bonferroni's multiple t-test). Treatment of M. tuberculosis with buffer alone was not toxic to the organisms.

As described above, FFA and RNI production by M. tuberculosis-infected macrophages overlapped for a long period of time (continued for 45 h). Therefore, it was of interest to examine whether or not FFA and RNI collaborated with each other in expressing their activities against M. tuberculosis. As shown in Fig. 5a,b, the combinations of ‘FFA + RNI’ and ‘RNI + H2O2-halogenation system’ exhibited synergistic and additive effects in killing of M. tuberculosis, respectively. In contrast, the activities of FFA and H2O2-halogenation system were antagonistically reduced when they were combined (Fig. 5c). The combination of ‘RNI + XOA system’, which generates highly cytotoxic peroxynitrite anion [33], did not increase RNI activity (Fig. 5d). Thus, M. tuberculosis appears to be resistant to peroxynitrite anion.

Since the production/secretion of anti-microbial effectors by M. tuberculosis-infected macrophages sequentially occurred in the order of ROI, FFA, and RNI, it was of interest to examine whether or not synergistic and/or additive effects could be produced by sequential double hits of these effectors. As shown in Table 1, a sequential attack of ‘H2O2-halogenation system followed by FFA’ and ‘H2O2-halogenation system followed by RNI’ had additive effects. Notably, sequential hits of ‘FFA followed by RNI’ gave synergistic effects.

Table 1.

Anti-Mycobacterium tuberculosis activities of the H2O2-halogenation system, free fatty acid (FFA: arachidonic acid), acidified NaNO2-derived reactive nitrogen intermediates (RNI), when the organisms were sequentially treated with the effectors as a double hit*

Treatment of M. tuberculosis

1st 2nd Residual bacterial CFU (log CFU/ml ± s.e.m.; n = 3)†
– – 5·44 ± 0·01
H2O2-halogenation – 4·69 ± 0·11
FFA – 4·98 ± 0·06
RNI – 4·64 ± 0·06
H2O2-halogenation FFA 4·04 ± 0·11‡§
H2O2-halogenation RNI 3·94 ± 0·07**
FFA RNI 3·72 ± 0·18§**
*

In the first incubation, M. tuberculosis organisms were treated with either FFA (2·5 μg/ml), acidified NaNO2 (2·0 mg/ml), or H2O2-halogenation system(10 μm H2O2, 10 μm NaI, 10 μm FeSO4) at 37°C for 2 h. The resultant organisms were collected by centrifugation (5000 g, 15 min), resuspended in sodium acetate buffer, and subsequently treated with either FFA (2·5 μg/ml) or acidified NaNO2 (2·0 mg/ml) for 2 h.

†

The 0-time value was 5·46 ± 0·01.

द**

Significantly smaller than the value of each effector alone (H2O2-halogenation system [‡¶], FFA [§], and RNI[**])(‡P < 0·05;§¶**P < 0·01; Bonferroni's multiple t-test).

Role of redox-active iron in combined activity of FFA, RNI, and ROI against M. tuberculosis

It is known that metal ions are released from bacterial metalloproteins due to the action of RNI [34]. Therefore, in order to verify the roles of redox-active iron in expression of the anti-M. tuberculosis activity of the combinations of ‘FFA + RNI’ and ‘RNI + H2O2-halogenation system’, we examined whether chelation of the redox-active iron could eliminate the anti-microbial activity of such combinations against M. tuberculosis. As indicated in Table 2, desferrioxamine (iron-chelating agent) inhibited the activities of both the H2O2-halogenation system alone and the combination of ‘RNI + H2O2-halogenation system’. In contrast, desferrioxamine did not affect the activities of FFA and RNI either alone or in combination. Therefore, the combination of ‘RNI + H2O2-halogenation system’ but not ‘FFA + RNI’ requires redox-active iron in expression of activity against M. tuberculosis.

Table 2.

Effect of an iron-chelating agent, desferrioxamine, on expression of the anti-Mycobacterium tuberculosis activity of free fatty acid (FFA: arachidonic acid), acidified NaNO2-derived reactive nitrogen intermediates (RNI), and H2O2-halogenation system each alone, or combinations of them*

Treatment with: Addition of desferrioxamine† Residual bacterial colony-forming units (log CFU/ml ± s.e.m.; n = 3)‡
None – 5·16 ± 0·04
None + 5·20 ± 0·03
FFA – 4·76 ± 0·01
FFA + 4·75 ± 0·04
RNI − 4·37 ± 0·01
RNI + 4·49 ± 0·01
H2O2-halogenation − 3·56 ± 0·07
H2O2-halogenation + 5·06 ± 0·02§
FFA + RNI − 3·91 ± 0·03
FFA + RNI + 3·54 ± 0·03
RNI + H2O2-halogenation − 2·86 ± 0·05
RNI + H2O2-halogenation + 4·13 ± 0·04§
*

Mycobacterium tuberculosis was treated with the indicated anti-microbial effectors at pH 5·5 for 2 h under the following conditions: FFA (5 μg/ml arachidonic acid), RNI (2·5 mg/ml NaNO2), H2O2-halogenation system (10 μm each of H2O2, NaI and FeSO4).

†

Desferrioxamine was added at 1 mm.

‡

The 0-time value was 5·14 ± 0·01.

§

Significantly larger than the corresponding control values (without desferrioxamine addition) (P < 0·01; Student's t-test).

Discussion

In the present study, FFA, RNI, and ROI (H2O2-halogenation system) each alone and their combinations exhibited strong activity against M. tuberculosis, and M. tuberculosis-infected macrophages showed sequential production/secretion of these effectors in the order ROI, FFA, and RNI in response to M. tuberculosis infection. These findings suggest the roles of these effectors in the activity of macrophages against M. tuberculosis. Notably, length of time of RNI production (≥ 72 h) was much longer than those of ROI and FFA production/secretion (ROI, 3 h; FFA, 48 h). Since expression of the activity of macrophages against M. tuberculosis requires long periods of time (i.e. > 3 days) [6], RNI appears to play the most important role among these effectors in expression of the activity of macrophages against M. tuberculosis.

Mycobacterium tuberculosis-infected macrophages secreted significant amounts of FFA (arachidonic acid) for fairly long periods (48 h) after M. tuberculosis infection. Alveolar macrophages are known to secrete FFA into the phagosomes, causing intraphagosomal accumulation of FFA reaching concentrations of 1800 μg/ml or more [35,36], which are about 180–720 times higher than the concentrations required for FFA-mediated anti-microbial actions against M. tuberculosis. Moreover, we have obtained a result which strongly suggests that membranous FFA (arachidonic acid) is translocated to M. tuberculosis within the phagosomes in phagocytic ability-and PLA2-dependent fashions (Fig. 3). As indicated in Fig. 4, the intracellular growth of M. tuberculosis residing in IFN-γ-activated macrophages was accelerated by a-TFMK (type IV cPLA2 inhibitor), but not by manoalide (type IIa sPLA2 inhibitor). In addition, increased levels of type IV cPLA2 mRNA but not type IIa sPLA2 mRNA were expressed in the IFN-γ-activated macrophages, and only type IV cPLA2 mRNA expression was up-regulated after infection of macrophages with M. tuberculosis. Thus, type IV cPLA2, but not type IIa sPLA2, appears to play a role in the expression of the anti-microbial activity of IFN-γ-activated macrophages against M. tuberculosis. These findings support the concept that FFA play important roles in expression of the activity of macrophages against M. tuberculosis. Notably, FFA and RNI production overlapped in time for a long period, i.e. from 3 h to 48 h after M. tuberculosis infection. The combination of ‘FFA + RNI’ resulted in a synergistic increase in activity against M. tuberculosis and sequential hits of ‘FFA followed by RNI’ also exhibited synergistic activity. Thus, the collaboration of FFA with RNI appears to be decisive for the effective killing of M. tuberculosis residing inside macrophages.

The H2O2-halogenation system displayed strong activity against M. tuberculosis. However, ROI production by M. tuberculosis-infected macrophages continued for only 3 h, which is too short to yield fatal damage to the organisms. In addition, although the combination of ‘RNI + H2O2-halogenation system’ had an additive effect on activity against M. tuberculosis, ROI production by M. tuberculosis-infected macrophages did not overlap in time with their RNI production. Moreover, ROI production overlapped with macrophage secretion of FFA, which have attenuating activity against the H2O2-halogenation system. Therefore, ROI appear to play relatively minor roles in the activity of macrophages against M. tuberculosis. This concept is inconsistent with the finding in Fig. 1 that the activity of macrophages against M. tuberculosis was significantly attenuated by ‘SOD + catalase’ (ROI scavengers). However, this is not surprising since the catalase is a potent inhibitor of the RNI synthesis of macrophages [37].

Concerning the combined effects of FFA, RNI, and H2O2-halogenation system against M. tuberculosis, the following can be stated, on the basis of target molecules of these anti-microbial effectors and cofactors required for their antibacterial action.

1Synergistic effect of ‘FFA + RNI’: FFA insert their non-polar moieties into the phospholipid layer of the cell membrane, causing severe changes in membrane permeability and the inactivation of membranous respiratory enzymes [38,39]. It appears that FFA-mediated changes in membrane functions lead to the amplification of the activity of RNI, which causes the inactivation of bacterial metalloenzymes and the inhibition of DNA synthesis [34,40,41].

2Additive effect of ‘RNI + H2O2-halogenation system’: as shown in Table 2, the activity of the H2O2-halogenation system against M. tuberculosis was almost completely abolished by an iron-chelator desferrioxamine, thereby indicating that the H2O2-halogenation system is strictly dependent on redox-active iron. Since RNI induce the release of metal ions from membrane metalloproteins [34], RNI might potentiate the activity of the H2O2-halogenation system by supplying catalytic Fe2+ ions from bacterial metalloproteins to the H2O2-halogenation system. Notably, in our previous study [17] an antagonistic effect was observed for ‘RNI + H2O2-halogenation system’ against M. avium complex. Therefore, the modes of interaction of M. tuberculosis organisms with the anti-microbial mechanisms of macrophages appear to be considerably different from those of M. avium complex.

3Antagonism between FFA and H2O2-halogenation system: it appears that double bonds in alkyl chains of FFA might scavenge highly bactericidal HOCl, which was generated by the H2O2-halogenation system. However, another possibility which cannot be excluded is that FFA might deprive the H2O2-halogenation system of redox-active iron.

In conclusion, the present study has demonstrated that membranous FFA of M. tuberculosis-infected macrophages translocated to M. tuberculosis internalized within macrophages in a PLA2-dependent fashion, and that such a phenomenon was associated with macrophage phagocytosis of M. tuberculosis. We also found that the synergistic effects between RNI and FFA were crucial in expression of the activity of macrophages against M. tuberculosis. Further studies are currently underway to assess the roles of RNI-and FFA-mediated anti-microbial mechanisms of macrophages in host resistance to mycobacterial organisms in vivo, using M. tuberculosis-infected mice with BcgS and Bcgr genotypes.

Acknowledgments

This study was supported in part by grants from the Ministry of Education, Science, and Culture of Japan and Ministry of Public Health and Welfare of Japan (Project for Emerging and Re-emerging Infectious Diseases).

References

  • 1.Chan J, Kaufmann SHE. Immune mechanisms of protection. In: Bloom BR, editor. Tuberculosis, pathogenesis, protection, and control. Washington, DC: ASM Press; 1994. pp. 389–415. [Google Scholar]
  • 2.Sato K, Akaki T, Tomioka H. Antimicrobial activities of benzoxazinorifamycin KRM-1648 and levofloxacin against intracellular Mycobacterium avium complex phagocytosed by murine peritoneal macrophages. J Antimicrob Chemother. 1998;41:77–83. doi: 10.1093/jac/41.1.77. [DOI] [PubMed] [Google Scholar]
  • 3.Sato K, Tomioka H. Antimicrobial activities of benzoxazinorifamycin (KRM-1648) and clarithromycin against Mycobacterium aviumintracellulare complex within peritoneal macrophages, human macrophage-like cells and human alveolar epithelial cells. J Antimicrob Chemother. 1999;43:351–7. doi: 10.1093/jac/43.3.351. [DOI] [PubMed] [Google Scholar]
  • 4.Tomioka H, Sato K, Kajitani H, Akaki T, Shishido S. Comparative antimicrobial activities of the newly synthesized quinolone WQ-3034, levofloxacin, sparfloxacin, and ciprofloxacin against Mycobacterium tuberculosis and Mycobacterium avium complex. Antimicrob Agents Chemother. 2000;44:283–6. doi: 10.1128/aac.44.2.283-286.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Chan J, Xing Y, Magliozzo RS, Bloom BR. Killing of virulent Mycobacterium tuberculosis by reactive nitrogen intermediates produced by activated murine macrophages. J Exp Med. 1992;175:1111–22. doi: 10.1084/jem.175.4.1111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.MacMicking J, Xie Q, Nathan C. Nitric oxide and macrophage function. Annu Rev Immunol. 1997;15:323–50. doi: 10.1146/annurev.immunol.15.1.323. [DOI] [PubMed] [Google Scholar]
  • 7.Sato K, Akaki T, Tomioka H. Differential potentiation of anti-mycobacterial activity and reactive nitrogen intermediate-producing ability of murine peritoneal macrophages activated by interferon-gamma (IFN-γ) and tumour necrosis factor-alpha (TNF-α) Clin Exp Immunol. 1998;112:63–68. doi: 10.1046/j.1365-2249.1998.00554.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cooper AM, Dalton DK, Stewart TA, Griffin JP, Russell DG, Orme IM. Disseminated tuberculosis in interferon gamma gene disrupted mice. J Exp Med. 1993;178:2243–7. doi: 10.1084/jem.178.6.2243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.MacMicking JD, North RJ, La Course R, Mudgett JS, Shah SK, Nathan CF. Identification of nitric oxide synthase as a protective locus against tuberculosis. Proc Natl Acad Sci USA. 1997;94:5243–8. doi: 10.1073/pnas.94.10.5243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Adams LB, Dinauer MC, Morgenstern DE, Krahenbuhl JL. Comparison of the roles of reactive oxygen and nitrogen intermediates in the host response to Mycobacterium tuberculosis using transgenic mice. Tuberc Lung Dis. 1997;78:237–46. doi: 10.1016/s0962-8479(97)90004-6. [DOI] [PubMed] [Google Scholar]
  • 11.Gomes MS, Florido M, Pais TF, Appelberg R. Improved clearance of Mycobacterium avium upon disruption of the inducible nitric oxide synthase gene. J Immunol. 1999;162:6734–9. [PubMed] [Google Scholar]
  • 12.Schoedon G, Schneemann M, Walter R, Blau N, Hofer S, Schaffner A. Nitric oxide and infection: another view. Clin Infect Dis. 1995;21:S152–7. doi: 10.1093/clinids/21.supplement_2.s152. [DOI] [PubMed] [Google Scholar]
  • 13.Nicholson S, Bonencini-Almeida M, Silva JRL, et al. Inducible nitric oxide synthetase in pulmonary alveolar macrophages from patients with tuberculosis. J Exp Med. 1996;183:2293–302. doi: 10.1084/jem.183.5.2293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Rich EA, Torres M, Sada E, Finegan CK, Hamilton BD, Toossi Z. Mycobacterium tuberculosis (MTB)-stimulated production of nitric oxide by human alveolar macrophages and relationship of nitric oxide production to growth inhibition of MTB. Tuberc Lung Dis. 1997;78:247–55. doi: 10.1016/s0962-8479(97)90005-8. [DOI] [PubMed] [Google Scholar]
  • 15.Warwick-Davies J, Lowrie DB, Cole PJ. Selective deactivation of human monocyte functions by TGF-β. J Immunol. 1995;155:3186–93. [PubMed] [Google Scholar]
  • 16.Manca C, Paul S, Barry CE, III, Freedman VH, Kaplan G. Mycobacterium tuberculosis catalase and peroxidase activities and resistance to oxidative killing in human monocyte in vitro. Infect Immun. 1999;67:74–79. doi: 10.1128/iai.67.1.74-79.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Akaki T, Sato K, Tomioka H, et al. Effector molecules in expression of the antimicrobial activity of macrophage against Mycobacterium avium complex: roles of reactive nitrogen intermediates, reactive oxygen intermediates, and free fatty acids. J Leukoc Biol. 1997;62:795–804. doi: 10.1002/jlb.62.6.795. [DOI] [PubMed] [Google Scholar]
  • 18.Gunshin H, Mackenzie B, Berger U, et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature. 1997;388:482–3. doi: 10.1038/41343. [DOI] [PubMed] [Google Scholar]
  • 19.Gomes MS, Appelberg R. Evidence for a link between iron metabolism and Nramp1 gene function in innate resistance against Mycobacterium avium. Immunology. 1998;95:165–8. doi: 10.1046/j.1365-2567.1998.00630.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hackam DJ, Rotstein OD, Zhang W, Gruenheid S, Gros P, Grinstein S. Host resistance to intracellular infection: mutation of natural resistance-associated macrophage protein 1 (Nramp1) impairs phagosomal acidification. J Exp Med. 1998;188:351–64. doi: 10.1084/jem.188.2.351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Tomioka H, Sato K, Sano C, et al. Effector molecules of the host defence mechanism against Mycobacterium avium complex: the evidence showing that reactive oxygen intermediates, reactive nitrogen intermediates, and free fatty acids each alone are not decisive in expression of macrophage antimicrobial activity against the parasites. Clin Exp Immunol. 1997;109:248–54. doi: 10.1046/j.1365-2249.1997.4511349.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Saito H, Tomioka H. Susceptibilities of transparent, opaque, and rough colonial variants of Mycobacterium avium complex to various fatty acids. Antimicrob Agents Chemother. 1988;32:400–2. doi: 10.1128/aac.32.3.400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Neve EPA, Boyer CS, Moldeus P. N-Methyl maleimide stimulates arachidonic acid release through activation of the signal-responsive phospholipase A2 in endothelial cells. Biochem Pharmacol. 1995;49:57–63. doi: 10.1016/0006-2952(94)00308-9. [DOI] [PubMed] [Google Scholar]
  • 24.Oh Y-K, Straubinger RM. Intracellular fate of Mycobacterium avium: use of dual-label spectrofluorometry to investigate the influence of bacterial viability and opsonization of phagosomal pH and phagosome–lysosome interaction. Infect Immun. 1996;64:319–25. doi: 10.1128/iai.64.1.319-325.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Shimizu T, Tomioka H, Sato K, et al. Effects of the Chinese traditional medicine Mao-Bushi-Saishin-To on therapeutic efficacy of a new benzoxazinorifamycin, KRM-1648, against Mycobacterium avium infection in mice. Antimicrob Agents Chemother. 1999;43:514–9. doi: 10.1128/aac.43.3.514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Blackwell GJ, Flower RJ. Inhibition of phospholipase A2. Br Med Bull. 1983;39:260–4. doi: 10.1093/oxfordjournals.bmb.a071830. [DOI] [PubMed] [Google Scholar]
  • 27.Hibbs JB, Jr, Vavrin Z, Taintor Z. Macrophage cytotoxicity: role for l-arginine deiminase and imino nitrogen oxidation to nitrite. Science. 1987;235:473–6. doi: 10.1126/science.2432665. [DOI] [PubMed] [Google Scholar]
  • 28.Russell DG, Dant J, Sturgill-Koszycki S. Mycobacterium avium-and Mycobacterium tuberculosis-containing vacuoles are dynamic, fusion-competent vesicles that are accessible to glycosphingolipids from the host cell plasmalemma. J Immunol. 1996;156:4764–73. [PubMed] [Google Scholar]
  • 29.Street IP, Lin H, Laliberte F, et al. Slow-and tight-binding inhibitors of the 85-kDa human phospholipase A2. Biochemistry. 1993;32:5935–40. doi: 10.1021/bi00074a003. [DOI] [PubMed] [Google Scholar]
  • 30.Winkler JD, McCarte-Roshak A, Huang L, Sung C, Bolognese B, Marshall LA. Biochemical and pharmacological comparison of a cytosolic, high molecular weight phospholipase A2, human synovial fluid phospholipase A2 and CoA-independent transacylase. J Lipid Med Cell Signalling. 1994;10:315–30. [PubMed] [Google Scholar]
  • 31.Stuehr DJ, Nathan CF. Nitric oxide. A macrophage product responsible for cytostasis and respiratory inhibition in tumor target cells. J Exp Med. 1989;169:1543–55. doi: 10.1084/jem.169.5.1543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Yamada Y, Saito H, Tomioka H, Jidoi J. Susceptibility of micro-organisms to active oxygen species: sensitivity to the xanthine oxidase-mediated antimicrobial system. J Gen Microbiol. 1987;133:2007–14. doi: 10.1099/00221287-133-8-2007. [DOI] [PubMed] [Google Scholar]
  • 33.Zhu L, Gunn C, Beckman JS. Bactericidal activity of peroxynitrite. Arch Biochem Biophys. 1992;298:452–7. doi: 10.1016/0003-9861(92)90434-x. [DOI] [PubMed] [Google Scholar]
  • 34.Pacelli R, Wink DA, Cook JA, et al. Nitric oxide potentiates hydrogen peroxide-induced killing of Escherichia coli. J Exp Med. 1995;182:1469–79. doi: 10.1084/jem.182.5.1469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Freeman BA, Lynn WS. Fatty acid secretion and metabolism in “activated” rabbit alveolar macrophages. Biochim Biophys Acta. 1980;620:528–37. doi: 10.1016/0005-2760(80)90145-9. [DOI] [PubMed] [Google Scholar]
  • 36.Kanetsuna F. Bactericidal effect of fatty acids on mycobacteria, with particular reference to the suggested mechanism of intracellular killing. Microbiol Immunol. 1985;29:127–41. doi: 10.1111/j.1348-0421.1985.tb00811.x. [DOI] [PubMed] [Google Scholar]
  • 37.Li Y, Severn A, Rogers MV, et al. Catalase inhibits nitric oxide synthesis and the killing of intracellular Leishmania major in murine macrophages. Eur J Immunol. 1992;22:441–6. doi: 10.1002/eji.1830220223. [DOI] [PubMed] [Google Scholar]
  • 38.Hori S, Kagimoto Y, Kamiya K, Inui K. Effects of free fatty acids as membrane components on permeability of drugs across bilayer lipid membranes. Biochim Biophys Acta. 1978;509:510–8. doi: 10.1016/0005-2736(78)90244-4. [DOI] [PubMed] [Google Scholar]
  • 39.Kanai K, Kondo E. Antibacterial and cytotoxic aspects of long-chain fatty acids as cell surface events: selected topics. Jpn J Med Sci Biol. 1979;32:135–74. doi: 10.7883/yoken1952.32.135. [DOI] [PubMed] [Google Scholar]
  • 40.Liew FY, Cox FEG. Nonspecific defence mechanism: the role of nitric oxide. Immunol Today. 1991;12:A17–21. doi: 10.1016/S0167-5699(05)80006-4. [DOI] [PubMed] [Google Scholar]
  • 41.Park J, Rikihisa Y. l-arginine-dependent killing of intracellular Ehrlichia risticii by macrophages treated with gamma interferon. Infect Immun. 1992;60:3504–8. doi: 10.1128/iai.60.9.3504-3508.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES