Hepatitis C virus (HCV) in lymphocyte subsets and in B lymphocytes expressing rheumatoid factor cross-reacting idiotype in type II mixed cryoglobulinaemia

Abstract

The IgMk rheumatoid factors (RF) of type II mixed cryoglobulinaemia (MC) react, in 95% of cases, with MoAbs against the cross-reactive idiotypes (CRI) Cc1 or Lc1 (corresponding to the products of the V_H1 and V_H4 genes). MC is closely associated with HCV infection, a virus which infects lymphocytes and may replicate in B cells. It has been suggested that HCV may induce clonal selection of B cells producing monoclonal IgMk RF in type II MC. To verify whether HCV is enriched in B cells, and in the subsets expressing Cc1 and Lc1 CRI, we studied peripheral blood lymphocytes from eight patients with MC and HCV RNA-positive sera. Seven patients had RF reacting with anti-Cc1, the other with anti-Lc1 CRI. Total lymphocytes, T cells, B cells, and Cc1⁺ or Lc1⁺, Cc1⁻ or Lc1⁻ B cells were purified using MoAb-coated magnetic beads. Lymphocyte subsets were then diluted to give a range of 1 × 10⁶−1 × 10³ cells and tested for HCV RNA by reverse transcriptase-polymerase chain reaction. HCV was found exclusively in B cells in seven out of eight patients. In three patients HCV was enriched in the Cc1⁺ cells. In one of these patients, HCV was found exclusively in Cc1⁺ cells, with Cc1⁻ cells being HCV⁻. The data indicate that B cells from type II MC patients are almost constantly infected by HCV. In selected cases, B cell subsets expressing IgMk RF CRI are the prevalent cell type infected by HCV. Our data suggest HCV involvement in B cell dysregulation leading to cryoprecipitable IgMk RF production.

INTRODUCTION

Cryoglobulinaemia is a pathological condition caused by the presence of immunoglobulins in the blood which precipitate reversibly in the cold. Type II cryoglobulinaemia is a mixed cryoglobulinaemia (MC) composed of two immunoglobulins: monoclonal IgMk rheumatoid factor (IgMk RF) and polyclonal IgG [1]. IgMk-IgG cryoglobulins induce purpura arthralgias and also often a peculiar membranoproliferative glomerulonephritis due to deposition of IgMk-IgG immune complexes, characterized by the particular extent of monocyte infiltration, vasculitis and, in the acute phases, by massive deposition of cryoglobulins within capillary lumens [2].

About 70% of these monoclonal IgMk RF from type II MC react with an anti-idiotypic MoAb called Cc1, and about 25% react with an anti-idiotypic MoAb called Lc1 [3,4]. As IgMk RF is expressed on the surface of B cell clones in peripheral blood or bone marrow, these clones can be detected and eventually purified using Cc1 or Lc1 MoAb [3]. Moreover, these MoAbs have been used to demonstrate selective expansion of a B cell subset characterized by the expression of RF-associated cross-reactive idiotypes (CRIs) in patients with Sjögren's syndrome [5]. Both Cc1 and Lc1 MoAbs recognize CRI expressed on the immunoglobulin heavy chain. In particular, Cc1 MoAb recognizes the products of the V_H1 gene and Lc1 MoAb recognizes the products of the V_H4 gene [6].

Clonal expansion of peripheral B lymphocytes has been demonstrated in patients with type II MC and with a lower frequency in HCV-infected patients without cryoglobulinaemia [7], and in the past few years many authors have closely associated essential MC with hepatitis C infection [8–11]. The association is so closely linked that it suggests a direct role of HCV infection in the pathogenesis of the disease. Moreover, it has recently been shown that HCV can replicate in B cells, and it has been suggested that HCV could induce clonal selection of B cells producing monoclonal IgMk RF [12,13].

The aim of this study was to obtain evidence that HCV induces IgMk RF production by B cells. With this purpose in mind, we verified whether HCV infected peripheral B cells predominantly and, for the first time, ascertained whether HCV predominantly infected the B cell subset expressing either Cc1 or Lc1 CRI.

PATIENTS AND METHODS

Patients

We selected eight patients from a group of 16 with type II MC associated with HCV infection, admitted to and followed up at the Department of Nephrology and/or at the Service of Immunohaematology of San Carlo Borromeo Hospital, Milano, between 1988 and 1995. The selection was necessary for technical reasons because only patients with a sufficient number of idiotype positive B cells to conduct the experiment were chosen. Diagnosis of MC was based on the presence of the typical syndrome of purpura, arthralgias and weakness, and on the presence of circulating mixed cryoglobulins, in the absence of underlying disorders such as haematological malignancies, acute or chronic infections (not related to HCV), or autoimmune disorders. Routine blood chemistry was performed by standard methods. The percentage of precipitating cryoglobulins, C3 and C4 fractions were measured as previously described [2,4]. The main demographic, clinical and serological features of patients studied are shown in Table 1. RF purified from cryoglobulins by gel filtration at acid pH reacted in ELISA in seven cases with Cc1 and in one case with Lc1 anti-idiotypic MoAb [4].

Table 1.

Main demographic, clinical and serological data of the patients studied

	Age (years)	Sex	Cryocrit, %	RA test, units	AST/ALT	C3	C4	HCV genotype	Renal involvement
1	62	F	5·3	1460	114/93	Low	Low	1b	Yes
2	44	M	47	446	16/26	N	Low	1b	Yes
3	59	M	4·7	288	19/12	N	Low	2	No
4	55	M	8·2	324	15/15	N	Low	2	Yes
5	60	F	5·7	437	36/40	N	Low	1b	Yes
6	68	F	33	201	68/69	N	Low	1b	No
7	65	F	22	316	54/32	N	Low	1b	Yes
8	67	F	10	420	77/84	N	Low	2	Yes

F, Female; M, male; N, normal value; RA test, serum rheumatoid factor (upper normal value = 50 U).

Methods

Blood samples were obtained from the eight subjects of the study, clotted and centrifuged at 37°C. From the same blood samples, the presence of HCV RNA in the serum and in peripheral blood lymphocyte subsets was investigated. Heparinized blood samples were obtained at 37°C and immediately washed in Hanks' solution at 37°C to avoid uptake at low temperature of HCV–anti-HCV immune complexes to RF-expressing B lymphocytes. Afterwards, peripheral blood mononuclear cells (PBMC) were prepared from heparinized venous blood samples by centrifugation on Ficoll–Hypaque density gradient (Ficoll–Hypaque; Pharmacia, Uppsala, Sweden). The T, B, natural killer (NK) lymphocyte subsets were determined by direct labelling with FITC-conjugated MoAbs, while lymphocyte subsets reacting with Cc1 or Lc1 MoAbs were determined by indirect fluorescence and lymphocyte subsets were then evaluated in flow cytometric analysis using a Becton Dickinson FACScan.

Lymphocytes were purified from monocytes by plastic adherence. T, B and idiotype-positive cells were isolated using magnetic microbead-positive methods (Dynabeads; Dynal, Oslo, Norway). T and B cells were purified, respectively, with Dynabeads-M450 coated with MoAb CD2 pan T and with Dynabeads-M450 CD19 pan B. Idiotypic positive cells were purified by an indirect technique: coating the target cells with specific MoAb Cc1 and Lc1 (IgG1 class) before using Dynabeads-M450 coated with rat anti-mouse IgG1. Although Cc1 and Lc1 anti-idiotypes each served as the control of the other, further control experiments were performed with 17.109 idiotype-positive cells. The 17.109 cross-reacting idiotype is present on the RF light chain and is a marker for a single variable region gene, Humkv325. The anti-17.109 MoAb reacts with about 40% of RF cryoglobulins [6] and reacted with the RF of patients no. 2, 3 and 6. For all purifications, at least 10⁷ beads/ml and 5:1 ratio beads/cells were used. All procedures were performed on ice, and the cells obtained were washed at least five times with sterile Rnase-free PBS. The solution of the fifth washing of cells was collected and stored at −70°C for later detection of HCV RNA. The purity of the cells was >99% as evaluated by flow cytometric analysis, while viability was >95%. Aliquots of 1 × 10⁶ cells (200 μl) were resuspended in RPMI.

HCV RNA sequences were detected in different lymphocyte subsets and HCV RNA positivity was assessed on a different number of cells ranging from 1 × 10⁶ to 1 × 10³ (1 × 10⁶ and: 500, 100, 50, 25, 10, 5, 1 × 10³) cells. Our method for isolation of RNA was effective at detecting HCV RNA in as few as 25 × 10³ cells as demonstrated by limiting dilution experiments. HCV RNA sequences were detected by polymerase chain reaction (PCR) amplification of cDNA using outer (nt 18–38, GGCGACACTCCACCATAGATC; and nt 341–321, GGTGCACGGTCTACGAGACCT) and inner (nt 45–65, CTGTGAGGAACTACTGTCTTC; and nt 301–281, CCCTATCAGGCAGTACCACAA) primers from the 5′ non-coding region of HCV. The same HCV RNA sequences were amplified by reverse transcriptase (RT)-PCR using nested primers from the core region and HCV genotypes identified by type-specific nested primers [14]. All tests were performed in duplicate. The quantitative results were consistent with PCR amplification from both 5′ non-coding and core regions. Final washes of different lymphocyte subset cells were shown to be negative for HCV RNA sequences.

RESULTS

The main demographic, clinical and serological features of the patients are shown in Table 1. Liver involvement, assessed on the basis of histological and/or liver enzyme alterations, was the most common manifestation of the disease and was present in seven out of eight cases. Renal involvement was also frequent in our group and was present in six out of eight cases. In all the cases, renal biopsy showed a membranoproliferative glomerulonephritis. Long-term steroid therapy was used in the majority of cases while interferon-alpha (IFN-α) therapy was never used before the study. The immunological data showed the presence of a mixed type II cryoprecipitate composed of monoclonal IgMk and polyclonal IgG in all cases. The cryoglobulin concentration was found to be between 4·7% and 47%, while a low C4 level was a constant feature. Five patients were infected with HCV genotype 1b, and three patients with genotype 2. As expected, lymphocyte subset analysis showed selective clonal expansion of the B cell subset expressing Cc1 or Lc1 cross-reactive idiotypes. The proportion of such cells ranged from 0·6% to 15% for overall lymphocyte numbers and 9% to 76% for B lymphocytes (Table 2).

Table 2.

Lymphocyte subsets and idiotype-positive cells in patients with mixed cryoglobulinaemia studied (data are expressed as the percentage of overall lymphocytes)

Patient no.	T cells	B cells	NK cells	Cc1+ cells	Lc1+ cells
1	76	10	4	1·5	0
2	80	3	22	0·6	0
3	73	13	10	10	0
4	54	11	33	1	0
5	60	15	25	1·5	0
6	78	9	5	3	0
7	44	42	9	15	0
8	80	7	6	0	5

As indicated in Table 3, HCV RNA was found in both B and T cells in one patient and, in the other seven patients, HCV RNA was found only within B cells; T cells were negative for HCV RNA even at the highest cell numbers tested (1 × 10⁶). In three patients of this B cell HCV RNA⁺ group, HCV RNA was enriched in Cc1⁺, compared with Cc1⁻, B cells and, interestingly, in one case HCV RNA was found only in Cc1⁺ cells, with B cells depleted of Cc1⁺ cells being HCV RNA⁻ even at the highest concentration tested (1 × 10⁶ cells). The same results were obtained using, as a control, 17.109⁺ cells of patients no. 2, 3 and 6. No correlations were found between these data and the clinical and serological aspects considered and serial experiments performed 10–18 months after the initial experiment, in patients no. 1, 3, 5, 6, 7, gave substantially the same results. Unexpected however, was the finding that patients with HCV RNA-enriched Cc1⁺ cells had a lower expansion of the Cc1⁺ clone. On the other hand, the same patients interestingly showed a higher number of NK cells compared with the other group of patients.

Table 3.

Lowest number of lymphocyte subsets positive at HCV RNA determination by 5′ non-coding and core region nested polymerase chain reactions

	IgMk-reacting anti-idiotype	All lymphocytes × 103	T cells × 103	B cells × 103	Idiotype+ B cells × 103	Idiotype− B cells × 103
1	Cc1	Pos 50	Pos 50	Pos 50	Pos 50	Pos 50
2	Cc1	Pos 50	Neg 1000	Pos 50	Pos 50	Pos 50
3	Cc1	Pos 50	Neg 1000	Pos 50	Pos 50	Pos 500
4	Cc1	Pos 50	Neg 1000	Pos 50	Pos 25	Pos 500
5	Cc1	Pos 50	Neg 1000	Pos 50	Pos 25	Neg 1000
6	Cc1	Pos 50	Neg 1000	Pos 50	Pos 500	Pos 500
7	Cc1	Pos 100	Neg 1000	Pos 500	Pos 500	Pos 500
8	Lc1	Pos 100	Neg 1000	Pos 500	Pos 500	Pos 500

Neg means HCV RNA-negative determined at concentration of 1 million cells.

DISCUSSION

In the past few years it has become increasingly apparent that HCV is the major cause of MC; in fact, HCV RNA and HCV antibodies are present in the serum of most patients (> 80%) with MC [8–11]. In these patients, HCV RNA has been shown to be concentrated up to 1000 times in their cryoprecipitate [11]. These findings suggest a direct role for HCV infection in the pathogenesis of MC and in the aetiology of the disease. Ferri and colleagues have suggested that HCV infection of B cells could result in dysregulation of the immune response and the generation of autoantibodies [12]. Ferri has also suggested that the clonal B cell expansion resulting from HCV infection may be responsible for the occasional B cell lymphomas that have been observed in patients with cryoglobulinaemia [15]. Moreover, the HCV has been found in a parotid non-Hodgkin's lymphoma in a patient with type II MC [16].

In the present study we have found that the B cell is the prevalent peripheral blood lymphocyte subset infected by HCV in type II MC. In our selected patient group, only one out of eight patients showed HCV RNA in their T cells. In contrast, all patients had HCV RNA in their B cells. These data differed slightly from those of previous studies of patients with HCV infection but without cryoglobulinaemic syndrome: examination of the different subsets of peripheral blood lymphocytes showed predominant infection of B lymphocytes during HCV disease, but an additional infection of T lymphocytes was detected in 60% of all chronically HCV-infected patients [16,17]. Moreover, it was shown that replication of HCV RNA takes place in B cells, although this point is still controversial [18,19].

In order to obtain additional evidence in patients with type II cryoglobulinaemia of a role of HCV in the possible selection of a particular B lymphocyte clone producing monoclonal IgMk RF, we purified peripheral blood B lymphocytes expressing, on the cell membrane, the same cross-reacting idiotype as cryoprecipitating RF. In one patient, HCV was detected by RT-PCR exclusively in the subpopulation of B lymphocytes expressing the RF cross-reacting idiotype. In two other patients, HCV was readily detected in a lower number of B cells expressing RF cross-reacting idiotype than in all the other lymphocyte subpopulations, indicating a higher concentration of HCV in the clone of B cells producing the monoclonal RF. Interestingly enough, these three patients showed lower expansion of the Cc1 clone. These unexpected data could be explained by the higher number of NK cells reacting with highly infected Cc1⁺ cells found in these patients. The data cannot be explained by the interaction of IgMk RF with HCV. In fact, Shott et al. have recently excluded such reactivity [20]. Instead, the data may be explained by quantitatively different binding of the HCV surface protein E2 to the CD81 receptor expressed on B lymphocytes of different patients. Moreover, the recent finding that this E2–CD81 interaction is able to modulate antibody synthesis is consistent with our data [21].

Taken together, the data suggest that HCV is implicated in the clonal selection of B lymphocyte producing cryoprecipitable IgMk RF in type II MC. HCV may be implicated in the recently described mutation of the B cell monoclonal RF V_H1 gene [22]. An in vitro study is currently in progress in order to ascertain whether HCV-infected B cells are more likely than uninfected B cells to produce IgM RF reacting with CC1 (or Lc1) CRI.