Skip to main content
NCBI home page
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2001 Jan;123(1):147–154. doi: 10.1046/j.1365-2249.2001.01432.x

IL-1β- and IL-4-induced down-regulation of autotaxin mRNA and PC-1 in fibroblast-like synoviocytes of patients with rheumatoid arthritis (RA)

A Kehlen *, R Lauterbach *, A N Santos *, K Thiele *, U Kabisch *, E Weber *, D Riemann *, J Langner *
PMCID: PMC1905967  PMID: 11168012

Abstract

Autotaxin (ATX) is a 125-kD ectonucleotide pyrophosphate/phosphodiesterase, which was initially isolated and cloned from human melanoma cells as a potent stimulator of tumour cell motility. ATX shows 44% identity to the plasma cell membrane marker PC-1. Recently, we described the decreased expression of ATX mRNA in cultured fibroblast-like synoviocytes (SFC) of patients with RA by interferon-gamma. In this study using a competitive reverse transcriptase-polymerase chain reaction, we show an increased ATX mRNA expression in SFC from patients with RA in comparison with synoviocytes from non-RA patients. The median ATX mRNA amount in SFC of RA patients (440 pg/μg total RNA) was five-fold higher than the expression in synoviocytes from non-RA patients (80 pg/μg total RNA) or foreskin fibroblasts (MRHF cells, 90 pg/μg total RNA). In contrast to the elevated ATX mRNA expression in SFC of patients with RA, we did not measure increased mRNA amounts of PC-1 in these cells. Both the ATX mRNA amount and the 5′-nucleotide phosphodiesterase (PDE) activity of SFC lysate were reduced after treatment of SFC with the cytokines IL-1β or IL-4. IL-1β and IL-4 induced a down-regulation of PC-1 mRNA and protein expression in SFC. In SFC treated with transforming growth factor-beta the expression of PC-1 mRNA and protein was increased, whereas no significant effect on ATX mRNA expression was detectable. Pharmacological drugs used in therapy for RA, such as dexamethasone, cyclosporin, methotrexate and indomethacin, did not show a statistically significant effect on either ATX mRNA or PC-1 mRNA expression. Only pentoxifylline suppressed ATX mRNA as well as PC-1 mRNA expression. In conclusion, we show a tight regulation of ATX and PC-1 gene expression by cytokines detectable in the inflamed tissue of RA. Further investigations will deal with the regulation of ATX protein expression as well as with the function of ATX in RA.

Keywords: autotaxin, cytokine, competitive, RT-PCR, rheumatoid arthritis

Introduction

RA is a chronic autoimmune disease characterized by relapsing and remitting course of joint inflammation. The chronic inflammation process leads to an excessive hyperplasia of the synovium with proliferation of the synovial lining cells, generation of new blood vessels and diffusely scattered or nodular mononuclear cell infiltrates. The proliferation and invasive growth of fibroblast-like cells of the synovium (SFC) result ultimately in the destruction of the joint [1,2].

Cytokines are known to be involved in the initiation and perpetuation of the chronic inflammation of RA. The synovial membrane cells synthesize various cytokines: IL-2, IL-4, IL-13 and interferon-gamma (IFN-γ) in lower amounts, whereas the levels for IL-1, IL-6, IL-8, tumour necrosis factor-alpha (TNF-α), and transforming growth factor-beta (TGF-β) are higher. These cytokines are also found in the synovial fluid [3–5].

Recently, we described the expression of the phosphodiesterase autotaxin (ATX) mRNA in cultured SFC of patients with RA as well as its down-regulation by IFN-γ [6]. ATX is a 125-kD glycoprotein with motility-stimulating activity [7–9] and 44% identity to the plasma cell membrane marker PC-1 [10]. PC-1 was originally characterized as an antigen that is selectively expressed on the surface of B lymphocytes when they reach their final stage of differentiation into antibody-secreting cells [11]. Both the molecules, ATX and PC-1, are members of a multigene family of ecto-phosphodiesterases. Recently a new name was suggested for this family: ecto-nucleotide pyrophosphate/phosphodiesterase family (E-NPP). Three structurally related mammalian E-NPPs are known: NPP1 (PC-1), NPP2 (ATX, PD-Iα) and NPP3 (gp130RB 13−6, PD-Iβ, B10) [12]. Members of the E-NPP family are capable of hydrolysing phosphodiester bonds of nucleotides and nucleic acids, and pyrophosphate bonds of nucleotides and nucleotide sugars. They can hydrolyse 3′,5′-cAMP to AMP, nucleoside 5′-triphosphates, such as ATP, to AMP and Pi, nucleoside 5′-diphosphates, such as ADP, to AMP and Pi, or NAD+ to AMP and nicotinamide mononucleotide [13]. Within this family, the extracellular domains are highly conserved, especially around the active site. In contrast, the transmembrane and cytoplasmic domains are highly divergent. ATX was first described as an autocrine motility factor that stimulates both random and directed motility in human melanoma cells [14]. Motility stimulation requires an intact 5′-nucleotide phosphodiesterase (PDE) active site, since a single point mutation at threonin-210 results in a mutant molecule which lacks both motility stimulation and enzymatic activity [15]. In the brain of rats, ATX is associated with oligodendrocytes and could have a function in myelination [16]. In human neuroblastoma cells, ATX expression is elevated and the enzyme stimulates cell motility [17]. ATX augments the tumourigenic capacity and metastatic potential of ras-transformed cells [18].

To gain knowledge about the regulation and a possible functional role of ATX and PC-1 in SFC of patients with RA, we analysed ATX and PC-1 mRNA expression levels in SFC from patients with RA in comparison with other fibroblasts, and we studied their modulation in SFC by cytokines and mediators.

Materials and methods

Cell culture

SFC were obtained from patients with classical or definite RA undergoing surgical synovectomy by dissociating the minced tissue enzymatically with Hanks' balanced salt solution (HBSS) containing 0·5 mg/ml collagenase type II (Sigma, Deisenhofen, Germany), 0·15 mg/ml DNase I (Boehringer, Mannheim, Germany) and 5 mm Ca2+. The cells were cultured in RPMI 1640 containing 10% fetal calf serum (FCS), antibiotics and glutamine as described earlier [19]. Cells were used at confluence at the third to fifth passage. The cell lines Caki 1 (renal cell carcinoma; ATCC, Rockville, MD) and tonsillar fibroblasts were cultured in RPMI 1640 containing 10% FCS. The cell lines LNZ308 (glioblastoma) and NT2/D1 (teratocarcinoma; ATCC) were grown in Dulbecco's modified Eagles' medium (DMEM; Cell Concepts, Umkirch, Germany) with 10% FCS supplemented with penicillin and streptomycin (1%; C.C. Pro, Neustadt, Germany). The human monocytic cell lines U937 and MonoMac6 (ATCC) were cultured in RPMI with 10% FCS, antibiotics (1 μl/ml fungizone, 0·75 μl/ml Refobacin) and 50 μmol 2-mercaptoethanol. Synoviocytes from non-RA patients were obtained from patients with meniscectomies and were kindly provided by Dr J. Rödel (Jena, Germany [20]).

Cytokines and reagents

Cells were treated with the following recombinant cytokines: TNF-α 1 ng/ml, IFN-α2b 0·5 ng/ml, IFN-β 1·5 ng/ml, IFN-γ 100 U/ml, TGF-β1 10 ng/ml, IL-1β 10 ng/ml, IL-4 100 U/ml, IL-6 100 U/ml, IL-10 10 ng/ml (Strathmann Biotech, Hamburg, Germany), TGF-β1 (10 ng/ml; R&D Systems, Wiesbaden, Germany), IL-8 (10 ng/ml; Genzyme, Cambridge, MA). The following mediators were obtained from Sigma: indomethacin 1000 ng/ml, methotrexate 100 ng/ml, cyclosporin A 1000 ng/ml, dexamethasone 100 mm, and pentoxifylline 5 mm. For investigating concentration dependency the following concentrations were used: IL-1β 1, 5, 10, 20, 50 ng/ml; IL-4 10, 50, 100, 200, 500 U/ml; and pentoxifylline 1, 2·5, 5, 10 mm.

RNA isolation and cDNA synthesis

Total cellular RNA was isolated according to Chomczynski & Sacchi [21]. The first strand of DNA was synthesized (after a 10-min incubation at 20°C) at 42°C for 50 min using 1 μg total RNA in the presence of dilutions of internal competitive standard RNA in 5·5 μl DEPC water, 2 μl 5 × first strand buffer (250 mm Tris–HCl pH 8·3, 375 mm KCl, 15 mm MgCl2), 0·5 μl dNTP mix (10 mm each of dATP, dCTP, dGTP, dTTP), 1 μl 0·1 m DTT, 0·5 μl (50 pmol) random primer (Boehringer), and 0·5 μl (200 U/µl) Superscript™ II-RT (Gibco BRL, Karlsruhe, Germany).

Construction of the internal standard

For the construction of the internal competitive standard RNA, composite primers were synthesized (see Table 1 for primer sequences). Primer 1 was composed of two specific primers complementary to the coding strand of the respective molecule. Primer 2 contained a sequence for the SP6 RNA polymerase and also one of the specific sequences of primer 1. The purified product of the first polymerase chain reaction (PCR) amplification with primers 1 and 3 was used as template for the second amplification using primers 2 and 3. The amplified DNA was gel purified (QIA quick Gel Extraction Kit; Qiagen, Hilden, Germany) followed by in vitro transcription by the SP6 promoter using the transcription system of Boehringer. The recombinant RNA was quantified at 260 nm and then used as an internal standard in the cDNA synthesis and the competitive PCR reaction.

Table 1.

Sequences of primers used for standard construction and polymerase chain reaction amplification

Gene Number Sequence 5′ – 3′
ATX 1 GTGCTTTGAACTTCAAGAGGCTGGCTGCTCAGAGGACTGCAAGG
2 GATTTAGGTGACACTATAGAATACGTGCTTTGAACTTCAAGAGGCTGG
3 GTGAGGGATGACAACAGACC
4 GTGCTTTGAACTTCAAGAGGCTGG
PC-1 1 ATTGAGACCCTCTGATGTCCCTCAGTGGCAACTTGCATTG
2 GATTTAGGTGACACTATAGAATACATTGAGACCCTCTGATGTCC
3 TGAAAATCCTCAATCGGCAA
4 ATTGAGACCCTCTGATGTCC
Open in a new tab

PCR analysis

cDNA (1·5 μl) synthesized as described above was diluted in 50 μl of the following solution: 50 mm KCl, 10 mm Tris–HCl pH 9·0, 1·5 mm MgCl2, 0·1% Triton X-100, 0·1 mm of each dNTP, 1 U Taq polymerase (Qiagen) and 50 pmol each of primer 4 and primer 3. PCR was conducted in a thermal cycler (Biometra, Göttingen, Germany) for 30 cycles of 60 s at 94°C, 60 s at 60°C and 60 s at 72°C. Each reaction product (10 μl) was run on a 1·5% agarose gel containing 0·1 μg/ml ethidium bromide in TAE buffer. The relative intensities of the bands corresponding to target and standard PCR products were visualized in UV light. The relative amounts of target and standard products were calculated after densitometric analysis using the Scan Pack 3.0 software (Biometra, Göttingen, Germany).

Western blotting

Cell culture plates were washed twice with ice-cold PBS. Cells were harvested by scraping into ice-cold RIPA buffer (1 × PBS, 1% Nonidet P-40, 0·5% sodium deoxycholate). Inhibitors were added at the time of use in the following concentrations: 1 mm PMSF, 1 μg/ml aprotinin, 1 μg/ml leupeptin, 1 μg/ml pepstatin, 1 mm Na3VO4, 1 mm NaF (Sigma). The cell lysate was transferred to microcentrifuge tubes and incubated on ice for 60 min and then centrifuged at 12 000 × g 20 min at 4°C. Both the cell culture supernatant and the cell lysate supernatant were quantified by means of the BCA Protein Assay Reagent Kit (KMF, Leipzig, Germany) and used for Western blot analysis. Western blot analysis was carried out using 40 μg protein. Proteins were electroblotted from NuPAGE gels (NOVEX, Frankfurt-Hoechst, Germany) onto Hybond ECL membrane (Amersham, Freiburg, Germany). The membrane was blocked with 5% dry milk in TBS–T for 1 h at room temperature. Blots were incubated with the primary antibody (PC-1 4H4, 1:1000 dilution, gift from Professor J. Goding, Australia) in TBS–T with 5% dry milk at room temperature for 2 h. Blots were washed three times and then incubated for 1 h with the secondary antibody (1:1000 dilution; Dianova, Hamburg, Germany) coupled with horseradish peroxidase. Immunodetection was accomplished using the ECL Western blotting detection reagents (Amersham) for chemiluminescent detection. Immunoreactivity was quantified by scanning densitometry using the Scan Pack 3.0 software (Biometra).

(5′-nucleotide) phosphodiesterase assay

The 5′-nucleotide PDE activity was measured using a modification of the method described by Clair et al. [22]. Cells (105) in 500 μl PBS were frozen and thawed five times. Cell lysate (5 μl) or 20 μl cell culture supernatant were incubated in a final volume of 100 μl containing p-nitrophenyl thymidine-5′-monophosphate (1 mm; Sigma) and 50 mm Tris–HCl pH 8·9. After 60 min at 37°C, reactions were terminated by addition of 50 μl 1 n NaOH. The reaction product was quantified by reading the absorbance at 410 nm (A410 × 64 = 1 nmol p-nitrophenol).

Statistical analysis

Data are expressed as mean ± s.d.. The Wilcoxon rank sum test was used to determine whether two experimental values were significantly different. P < 0·05 is indicated with *, P < 0·01 with **.

Results

Quantification of ATX mRNA expression in SFC of patients with RA

To investigate the ATX mRNA expression of SFC from patients with RA, we developed a competitive RT-PCR assay. We detected a higher absolute ATX mRNA expression in all SFC from patients with RA compared with other fibroblasts. Figure 1a illustrates the comparison of the absolute amounts of ATX mRNA in SFC, in synoviocytes from non-RA patients (SY) and the amounts in tonsillar and MRHF foreskin fibroblasts. In SFC (n = 15) ATX mRNA levels ranged between 140 pg and 1200 pg ATX mRNA/μg total RNA (median 440 pg/μg total RNA). The amount of ATX mRNA in tonsillar fibroblasts was 55 pg/μg total RNA, in SY 80 pg/μg total RNA, and in MRHF cells 90 pg/μg total RNA. The cell lines Caki 1 (renal cell carcinoma), U937 and MonoMac 6 (monocytic cells) showed an ATX mRNA expression < 1 pg/μg total RNA. The ATX mRNA amount of peripheral blood lymphocytes was below the detection level. High ATX mRNA expression was quantified in LNZ308 cells (glioblastoma) with 1800 pg/μg total RNA and NT2/D1 cells (teratocarcinoma) with 600 pg/μg total RNA.

Fig. 1.

Fig. 1

Open in a new tab

Comparison of the absolute amounts of autotaxin (ATX) mRNA (a) as well as of PC-1 mRNA (b) in fibroblast-like synoviocytes (SFC) (15 different patients each in duplicate experiments), tonsillar fibroblasts (t. fibro; n = 3), synoviocytes of non-RA patients (SY; two different patients each in duplicate experiments) and foreskin fibroblasts (MRHF; n = 4). Results of competitive reverse transcriptase-polymerase chain reaction after scanning and calculation as described in Materials and methods. Data are given as box plots with the median. The box encompasses the 25th to 75th percentiles. The 5th and 95th percentiles are displayed as error bars.

Quantification of PC-1 mRNA expression in SFC of patients with RA

In contrast to the elevated ATX mRNA expression in SFC of patients with RA, we did not quantify increased mRNA amounts of PC-1 in these cells. We found 50 pg PC-1 mRNA/μg total RNA in SFC (n = 15; range 6–130 pg/μg total RNA). Similar PC-1 mRNA amounts were quantified in SY from non-RA patients with 65 pg/μg total RNA and in MRHF cells with 67 pg/μg total RNA. The highest PC-1 mRNA expression was detected in LNZ308 cells and NT2/D1 cells with 260 pg/μg total RNA. Caki 1 cells (7 pg PC-1 mRNA/μg total RNA) and tonsillar fibroblasts (1 pg PC-1 mRNA/μg total RNA) expressed low levels whereas in U937 cells and T cells the PC-1 expression was not detectable (Fig. 1b).

Modulation of ATX and PC-1 gene expression in SFC by cytokines

Recently, we described the down-regulation of ATX mRNA expression in SFC by IFN-γ. To characterize further the modulation of ATX gene expression in SFC, we tested the effect of different cytokines in cell cultures. The cytokines IL-6, IL-8, IL-10, IL-12 and TNF-α showed no statistically significant effects on ATX gene expression. IL-1β 10 ng/ml reduced the ATX mRNA level to 65% (n = 6) of the untreated control cells and IL-4 100 U/ml down-regulated the ATX amount to 70% (n = 6) of the control (Fig. 2). With TGF-β1 10 ng/ml we observed in SFC of two patients (n = 6) a two-fold increase of ATX mRNA expression (Fig. 2a), but the effect was not statistically significant (Fig. 2b; n = 8). To compare the modulating effect of IL-1β, IL-4 and TGF-β on ATX and PC-1, we quantified the expression of both the mRNAs after treatment of SFC with the cytokines. As shown in Fig. 2a,b, IL-1β and IL-4 also reduced PC-1 mRNA expression in SFC; TGF-β, however, augmented PC-1 mRNA expression. IL-1β 10 ng/ml reduced the PC-1 mRNA level to 54% of the untreated control and IL-4 100 U/ml to 47% of the control. Both the cytokines, IL-1β and IL-4, reduced the mRNA expression of ATX and PC-1 in SFC of patients with RA. TGF-β did not affect the ATX mRNA expression significantly, but augmented the PC-1 mRNA level up to five-fold. As shown in Fig. 3, the IL-1β- or IL-4-induced down-regulation of ATX mRNA and PC-1 mRNA was dose-dependent. With the highest IL-1β concentration (50 ng/ml) tested we detected an ATX mRNA level of 38% compared with the control and a PC-1 mRNA level of 26%. The highest IL-4 concentration (500 U/ml) reduced ATX mRNA expression to 61% of the control and PC-1 mRNA expression to 41%.

Fig. 2.

Fig. 2

Open in a new tab

Regulation of mRNA expression of autotaxin (ATX) and PC-1 by different cytokines. Fibroblast-like synoviocytes (SFC) of six different patients (each in duplicate experiments) were cultured for 24 h with IL-1β, IL-4, transforming growth factor-beta 1 (TGF-β1). (a) Modulation of ATX and PC-1 mRNA expression in comparison with the unstimulated control. Total RNA (0·5 μg) was used for cDNA synthesis in the presence of six dilutions of ATX or PC-1 internal competitive standard RNA and random primer in a volume of 10 μl. The synthesized cDNA (1·5 μl) was amplified in the polymerase chain reaction (PCR) by means of the appropriate primers 4 and 3 as described in Materials and methods. PCR reaction product (10 μl) was separated on an agarose gel containing ethidium bromide. The relative intensities of the bands of ATX and PC-1 product and standard product were visualized in UV light. (b) Results of competitive RT-PCR are given as a percentage of the basal control (culture without cytokine = 100%; significant differences from control: *P < 0·05; **P < 0·01).

Fig. 3.

Fig. 3

Open in a new tab

Dose-dependent inhibition by IL-1β (a) or IL-4 (b) of autotaxin (ATX) mRNA expression (□) and PC-1 mRNA expression (▪). Fibroblast-like synoviocytes (SFC) of three different patients (each in duplicate experiments) were cultured for 24 h in presence of the indicated concentrations of IL-1β or IL-4. Total RNA was prepared and analysed by competitive reverse transcriptase-polymerase chain reaction (RT-PCR) as described in Materials and methods. Results of competitive RT-PCR are given as a percentage of the basal control (culture without cytokine = 100%; statistically significant differences from control: *P < 0·05; **P < 0·01).

Modulation of ATX and PC-1 gene expression in SFC by pharmacological mediators

Furthermore we wanted to study the influence of anti-rheumatic drugs on ATX mRNA expression. After treatment of SFC with methotrexate, dexamethasone or cyclosporin A for 24 h we did not measure significant changes in the ATX mRNA level. Only with indomethacin and pentoxifylline did we detect a decreasing effect on ATX mRNA expression (Fig. 4a). ATX mRNA expression was reduced to 61% in indomethacin-treated SFC but the effect was not significant compared with the control (n = 6). Pentoxifylline (5 mm) suppressed ATX mRNA expression to 39% of the control (n = 6; P < 0·01). The pentoxifylline effect is concentration-dependent and decreased the ATX mRNA level to 17% of the control and the PC-1 mRNA amounted to 19% of the control with a pentoxifylline concentration of 10 mm (Fig. 4b).

Fig. 4.

Fig. 4

Open in a new tab

Effect of pharmacological drugs used for therapy of RA on autotaxin (ATX; □) or PC-1 mRNA amount (▪) in fibroblast-like synoviocytes (SFC). (a) SFC of six different patients (each in duplicate experiments) were cultured for 24 h in the presence of dexamethasone (DEX), cyclosporin A (CsA), indomethacin (indo), methotrexate (MTX), or pentoxifylline (PTX) in concentrations as given in Materials and Methods. (b) Dose-dependent inhibition by PTX of ATX and PC-1 mRNA expression in SFC. SFC of three different patients (each in duplicate experiments) were cultured for 24 h in the presence of the indicated concentrations of PTX. Results of competitive reverse transcriptase-polymerase chain reaction (RT-PCR) after scanning and calculation as described in Materials and methods. Results of competitive RT-PCR are given as a percentage of the basal control (culture without cytokine = 100%; statistically significant differences from control: **P < 0·01).

Effects of IL-1 and IL-4 on the 5′-nucleotide PDE activity and the PC-1 protein expression in SFC

To verify the reducing effect of IL-1β and IL-4 also at the protein level, we investigated the effect of the cytokines on the 5′-nucleotide PDE activity in SFC culture supernatants and in SFC lysates. We did not detect changes in 5′-nucleotide PDE activity of the SFC culture supernatant after treatment with IL-1β (10 ng/ml) or IL-4 (100 U/ml); however, in SFC lysates PDE activity was reduced to 41% of the control after IL-1β treatment and to 48% of the control after cultivation with IL-4 (Fig. 5). In contrast, TGF-β could stimulate 5′-nucleotide PDE activity in SFC culture supernatants and in SFC lysates.

Fig. 5.

Fig. 5

Open in a new tab

Effects of IL-1β, IL-4 and transforming growth factor-beta (TGF-β) on 5′-nucleotide phosphodiesterase (PDE) activity in fibroblast-like synoviocyte (SFC) cell lysates (□) or SFC culture supernatants (▪). SFC from three different patients (each in duplicate experiments) were cultured for 48 h in the presence of cytokines. Cell culture supernatants or cell lysates were incubated with p-nitrophenyl thymidine-5′-monophosphate at 37°C as described in Materials and methods. Reaction product was quantified by reading the absorbance at 410 nm (statistically significant differences from control: *P < 0·05).

Only the protein expression of PC-1 could be investigated using Western blotting, due to the lack of a specific human ATX antibody. As shown in Fig. 6, PC-1 protein expression was decreased by IL-1β and IL-4, but augmented by TGF-β in both the cell lysate and the culture supernatant.

Fig. 6.

Fig. 6

Open in a new tab

Effect of IL-1β, IL-4 and transforming growth factor-beta (TGF-β) on the expression of PC-1 protein. Fibroblast-like synoviocytes (SFC) were cultured for 48 h in the presence of cytokines, cell lysates or cell culture supernatants were separated, blotted and probed with an antibody specific for PC-1 as described in Materials and methods. Results (PC-1 = 130 kD) of one representative of three experiments with SFC from two patients are shown.

Discussion

The present study provides the first demonstration of an increased expression of the ATX gene in SFC of patients with RA compared with fibroblasts of different origin, as well as its down-regulation by the cytokines IL-1β and IL-4. The median ATX mRNA amount in SFC of RA patients (440 pg/μg total RNA) was five-fold higher than the expression in synoviocytes from non-RA patients (80 pg/μg total RNA) or foreskin fibroblasts (MRHF cells, 90 pg/μg total RNA). The highest level of ATX mRNA was found in glioblastoma cells (LNZ308, 1800 pg/μg total RNA), whereas peripheral blood lymphocytes do not express ATX mRNA. Our results agree with those of Lee et al. describing high ATX mRNA expression in brain, placenta, ovary, small intestine and very low concentrations in liver, heart, spleen, thymus and peripheral blood lymphocytes [23]. In contrast to the elevated ATX mRNA expression in SFC of patients with RA, we did not quantify increased mRNA amounts of PC-1 in these cells. We found 50 pg PC-1 mRNA/μg total RNA in SFC, 65 pg/μg total RNA in SY from non-RA patients and 67 pg/μg total RNA in MRHF cells.

Recently, we described the decreased expression of ATX mRNA in cultured SFC of patients with RA by IFN-γ [6]. In this study we extend these results to other cytokines and show the reduced ATX mRNA amount in SFC after treatment with cytokines IL-1β or IL-4 using a competitive RT-PCR. The contrast between increased expression of ATX mRNA and cytokine IL-1β in RA on the one hand and the down-regulating effect of IL-1β on ATX gene expression on the other hand suggests the existence of unknown factor(s) responsible for the increased expression of ATX in SFC. The cytokines IL-6, IL-8, IL-10, IL-12, TNF-α and TGF-β showed no statistically significant effects on ATX gene expression. The addition of IL-1β or IL-4 caused SFC to decrease ATX mRNA expression as well as 5′-nucleotide PDE activity of SFC lysates. The used enzymatic test measuring the release of p-nitrophenol from thymidine-5′-monophospho-p-nitrophenyl ester is not specific for ATX. Therefore the reduction of 5′-nucleotide PDE activity can also be the consequence of the decreased expression of PC-1 mRNA and protein observed after treatment with IL-1β or IL-4. In contrast to the cytokine effect in cell lysate, in culture supernatant the inhibitory effect of IL-1β or IL-4 was not detectable. We speculate about a stimulating effect of these cytokines on other phosphodiesterases or an influence of IL-1β or IL-4 on the proteolytic cleavage process of membrane-bound enzyme to soluble enzyme. We could verify the suppressive effect of IL-1β on PC-1 mRNA and protein expression in SFC as described for chondrocytes [24]. Furthermore, we show a similar effect for the cytokine IL-4 on PC-1 mRNA and protein expression in SFC. The parallel regulation of both genes, ATX and PC-1, by IL-1β and IL-4 is in contrast to the divergent response to TGF-β. In TGF-β-treated SFC the expression of PC-1 mRNA and protein was increased whereas no significant effect on ATX mRNA expression was detectable. Recently, TGF-β was described as a cytokine increasing PC-1 expression and 5′-nucleotide PDE activity in chondrocytes [24,25] as well as increasing 5′-nucleotide PDE activity in osteoblast-like cells and osteosarcoma cells [26–28].

PC-1 may have a role in regulation of physiological and pathological calcification in chondrocytes and bone mineralization [24,29,30]. The phenotype of PC-1 knock-out mice generated by Sali et al. shows similarities to that of ttw/ttw (tip toe walking) mice [29], in which a mutation causes premature termination of PC-1 protein. PC-1 knock-out mice show excessive bone formation around growth plates, cartilage, tendons and joint capsules [31]. The function of ATX in SFC of RA patients is unknown, but we were able to show a tight regulation of ATX gene expression by cytokines detectable in the inflamed tissue of RA.

It has been observed that glucocorticoids raise PC-1 levels in several cell types [32–34]. We detected no significant effects of dexamethasone, a synthetic glucocorticoid, and other drugs such as cyclosporin, methotrexate and indomethacin used in therapy for RA [35] on ATX mRNA, or on PC-1 expression. Pentoxifylline, a methylxanthine with immunomodulatory and anti-inflammatory effects, suppressed ATX mRNA and the PC-1 mRNA levels. Pentoxifylline inhibits TNF-α production, fibroblast proliferation, phosphodiesterase activity and metalloproteinase production [36–39] as well as possibly having therapeutic properties in RA [40,41]. It modulates immune reactions favouring a Th2-like response and may therefore be useful for the treatment of autoimmune diseases with a dominant Th1-like T cell response such as RA [3,42]. In view of these effects its influence also on ATX expression is no great surprise.

Further investigations will deal with the regulation of ATX protein expression as well as with the function of ATX in the inflamed tissue of RA. However, a deeper understanding of the pathways regulating ATX expression may be necessary for the understanding of its possible function as well as for development of therapeutic approaches.

Acknowledgments

We acknowledge the technical assistance of Michaela Hemp, Karin Bornschein and Grit Helbing. This work was supported by the Deutsche Forschungsgemeinschaft (DFG Ke 698/2-1) and Fritz Thyssen foundation (AZ 92698003). Our sincere gratitude is expressed to Professor J. Goding, who provided the PC-1 antibody.

REFERENCES

  • 1.Weyand CM, Goronzy JJ. The molecular basis of rheumatoid arthritis. J Mol Med. 1997;75:772–85. doi: 10.1007/s001090050167. [DOI] [PubMed] [Google Scholar]
  • 2.Firestein GS. Invasive fibroblast-like synoviocytes in rheumatoid arthritis. Passive responders or transformed aggressors? Arthritis Rheum. 1996;39:1781–90. doi: 10.1002/art.1780391103. [DOI] [PubMed] [Google Scholar]
  • 3.Breedveld FC. New insights in the pathogenesis of rheumatoid arthritis. J Rheumatol Suppl. 1998;53:3–7. [PubMed] [Google Scholar]
  • 4.Feldmann M, Brennan FM, Maini RN. Role of cytokines in rheumatoid arthritis. Annu Rev Immunol. 1996;14:397–440. doi: 10.1146/annurev.immunol.14.1.397. [DOI] [PubMed] [Google Scholar]
  • 5.Feldmann M, Brennan FM, Maini RN. Rheumatoid arthritis. Cell. 1996;85:307–10. doi: 10.1016/s0092-8674(00)81109-5. [DOI] [PubMed] [Google Scholar]
  • 6.Santos AN, Riemann D, Santos AN, Kehlen A, Thiele K, Langner J. Treatment of fibroblast-like synoviocytes with IFN-gamma results in the down-regulation of autotaxin mRNA. Biochem Biophys Res Commun. 1996;229:419–24. doi: 10.1006/bbrc.1996.1819. [DOI] [PubMed] [Google Scholar]
  • 7.Stracke M, Liotta LA, Schiffmann E. The role of autotaxin and other motility stimulating factors in the regulation of tumor cell motility. Symp Soc Exp Biol. 1993;47:197–214. [PubMed] [Google Scholar]
  • 8.Stracke ML, Krutzsch HC, Unsworth EJ, et al. Identification, purification, and partial sequence analysis of autotaxin, a novel motility-stimulating protein. J Biol Chem. 1992;267:2524–9. [PubMed] [Google Scholar]
  • 9.Stracke ML, Clair T, Liotta LA. Autotaxin, tumor motility-stimulating exophosphodiesterase. Adv Enzyme Regul. 1997;37:135–44. doi: 10.1016/s0065-2571(96)00017-9. [DOI] [PubMed] [Google Scholar]
  • 10.Goding JW, Terkeltaub R, Maurice M, Deterre P, Sali A, Belli SI. Ecto-phosphodiesterase/pyrophosphatase of lymphocytes and non-lymphoid cells: structure and function of the PC-1 family. Immunol Rev. 1998;161:11–26. doi: 10.1111/j.1600-065x.1998.tb01568.x. [DOI] [PubMed] [Google Scholar]
  • 11.Takahashi T, Old LJ, Boyse EA. Surface alloantigens of plasma cells. J Exp Med. 1970;131:1325–41. doi: 10.1084/jem.131.6.1325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Zimmermann H, Beaudoin AR, Bollen M, et al. Proposed nomenclature for two novel nucleotide hydrolysing enzyme families expressed on cell surface. In: Vanduffel L, Lemmens R, editors. Ecto-ATPases and related ectonucloetidases. Proceedings of the Second International Workshop on Ecto-ATPases and Related Ectonucleotidases. Maastrich: Shaker Publishing BV; 1999. [Google Scholar]
  • 13.Zimmermann H, Braun N. Ecto-nucleotidases—molecular structures, catalytic properties, and functional roles in the nervous system. Prog Brain Res. 1999;120:371–85. [PubMed] [Google Scholar]
  • 14.Murata J, Lee HY, Clair T, et al. cDNA cloning of the human tumor motility-stimulating protein, autotaxin, reveals a homology with phosphodiesterases. J Biol Chem. 1994;269:30479–84. [PubMed] [Google Scholar]
  • 15.Lee HY, Clair T, Mulvaney PT, et al. Stimulation of tumor cell motility linked to phosphodiesterase catalytic site of autotaxin. J Biol Chem. 1996;271:24408–12. doi: 10.1074/jbc.271.40.24408. [DOI] [PubMed] [Google Scholar]
  • 16.Fuss B, Baba H, Phan T, Tuohy VK, Macklin WB. Phosphodiesterase I, a novel adhesion molecule and/or cytokine involved in oligodendrocyte function. J Neurosci. 1997;17:9095–103. doi: 10.1523/JNEUROSCI.17-23-09095.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kawagoe H, Stracke ML, Nakamura H, Sano K. Expression and transcriptional regulation of the PD-Ialpha/autotaxin gene in neuroblastoma. Cancer Res. 1997;57:2516–21. [PubMed] [Google Scholar]
  • 18.Nam SW, Clair T, Campo CK, Lee HY, Liotta LA, Stracke ML. Autotaxin (ATX), a potent tumor mitogen, augments invasive and metastatic potential of ras-transformed cells. Oncogene. 2000;19:241–7. doi: 10.1038/sj.onc.1203263. [DOI] [PubMed] [Google Scholar]
  • 19.Schwachula A, Riemann D, Kehlen A, Langner J. Characterization of the immunophenotype and functional properties of fibroblast-like synoviocytes in comparison to skin fibroblasts and umbilical vein endothelial cells. Immunobiology. 1994;190:67–92. doi: 10.1016/S0171-2985(11)80284-6. [DOI] [PubMed] [Google Scholar]
  • 20.Rodel J, Straube E, Lungershausen W, Roth A, Groh A. Primary cultivation of human synovial cells from nonrheumatic synovial tissue and fluid. Exp Toxicol Pathol. 1996;48:243–7. doi: 10.1016/S0940-2993(96)80006-6. [DOI] [PubMed] [Google Scholar]
  • 21.Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–9. doi: 10.1006/abio.1987.9999. [DOI] [PubMed] [Google Scholar]
  • 22.Clair T, Lee HY, Liotta LA, Stracke ML. Autotaxin is an exoenzyme possessing 5′-nucleotide phosphodiesterase/ATP pyrophosphatase and ATPase activities. J Biol Chem. 1997;272:996–1001. doi: 10.1074/jbc.272.2.996. [DOI] [PubMed] [Google Scholar]
  • 23.Lee HY, Murata J, Clair T, et al. Cloning, chromosomal localization, and tissue expression of autotaxin from human teratocarcinoma cells. Biochem Biophys Res Commun. 1996;218:714–9. doi: 10.1006/bbrc.1996.0127. [DOI] [PubMed] [Google Scholar]
  • 24.Lotz M, Rosen F, McCabe G, et al. Interleukin 1 beta suppresses transforming growth factor-induced inorganic pyrophosphate (PPi) production and expression of the PPi-generating enzyme PC-1 in human chondrocytes. Proc Natl Acad Sci USA. 1995;92:10364–8. doi: 10.1073/pnas.92.22.10364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Johnson K, Vaingankar S, Chen Y, et al. Differential mechanisms of inorganic pyrophosphate production by plasma cell membrane glycoprotein-1 and B10 in chondrocytes. Arthritis Rheum. 1999;42:1986–97. doi: 10.1002/1529-0131(199909)42:9<1986::AID-ANR26>3.0.CO;2-O. [DOI] [PubMed] [Google Scholar]
  • 26.Oyajobi BO, Caswell AM, Russell RG. Transforming growth factor beta increases ecto-nucleoside triphosphate pyrophosphatase activity of human bone-derived cells. J Bone Miner Res. 1994;9:99–109. doi: 10.1002/jbmr.5650090114. [DOI] [PubMed] [Google Scholar]
  • 27.Huang R, Rosenbach M, Vaughn R, et al. Expression of the murine plasma cell nucleotide pyrophosphohydrolase PC-1 is shared by human liver, bone, and cartilage cells. Regulation of PC- 1 expression in osteosarcoma cells by transforming growth factor-beta. J Clin Invest. 1994;94:560–7. doi: 10.1172/JCI117370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Johnson K, Moffa A, Chen Y, Pritzker K, Goding J, Terkeltaub R. Matrix vesicle plasma cell membrane glycoprotein-1 regulates mineralization by murine osteoblastic MC3T3 cells. J Bone Miner Res. 1999;14:883–92. doi: 10.1359/jbmr.1999.14.6.883. [DOI] [PubMed] [Google Scholar]
  • 29.Okawa A, Nakamura I, Goto S, Moriya H, Nakamura Y, Ikegawa S. Mutation in Npps in a mouse model of ossification of the posterior longitudinal ligament of the spine. Nat Genet. 1998;19:271–3. doi: 10.1038/956. [DOI] [PubMed] [Google Scholar]
  • 30.Caswell AM, Russell RG. Evidence that ecto-nucleoside-triphosphate pyrophosphatase serves in the generation of extracellular inorganic pyrophosphate in human bone and articular cartilage. Biochim Biophys Acta. 1988;966:310–7. doi: 10.1016/0304-4165(88)90080-3. [DOI] [PubMed] [Google Scholar]
  • 31.Sali A, Favaloro JM, Terkeltaub R, Goding JW. Germline deletion of the nucleoside triphosphate pyrophosphohydrolase (NTPPPH) plasma cell membrane glycoprotein (PC-1) produces abnormal calcification of periarticular tissues. In: Vanduffel L, Lemmens R, editors. Ecto-ATPases and related ectonucloetidases. Proceedings of the Second International Workshop on Ecto-ATPases and Related Ectonucleotidases. Maastrich: Shaker Publishing BV; 1999. [Google Scholar]
  • 32.Rousseau GG, Amar-Costesec A, Verhaegen M, Granner DK. Glucocorticoid hormones increase the activity of plasma membrane alkaline phosphodiesterase I in rat hepatoma cells. Proc Natl Acad Sci USA. 1980;77:1005–9. doi: 10.1073/pnas.77.2.1005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Goldfine ID, Maddux BA, Youngren JF, Frittitta L, Trischitta V, Dohm GL. Membrane glycoprotein PC-1 and insulin resistance. Mol Cell Biochem. 1998;182:177–84. [PubMed] [Google Scholar]
  • 34.Rebbe NF, Tong BD, Hickman S. Expression of nucleotide pyrophosphatase and alkaline phosphodiesterase I activities of PC-1, the murine plasma cell antigen. Mol Immunol. 1993;30:87–93. doi: 10.1016/0161-5890(93)90429-f. [DOI] [PubMed] [Google Scholar]
  • 35.Matteson EL. Current treatment strategies for rheumatoid arthritis. Mayo Clin Proc. 2000;75:69–74. doi: 10.4065/75.1.69. [DOI] [PubMed] [Google Scholar]
  • 36.Anaya JM, Espinoza LR. Phosphodiesterase inhibitor pentoxifylline: an antiinflammatory/immunomodulatory drug potentially useful in some rheumatic diseases. J Rheumatol. 1995;22:595–9. [PubMed] [Google Scholar]
  • 37.Berman B, Duncan MR. Pentoxifylline inhibits normal human dermal fibroblast in vitro proliferation, collagen, glycosaminoglycan, and fibronectin production, and increases collagenase activity. J Invest Dermatol. 1989;92:605–10. doi: 10.1111/1523-1747.ep12712140. [DOI] [PubMed] [Google Scholar]
  • 38.Berman B, Duncan MR. Pentoxifylline inhibits the proliferation of human fibroblasts derived from keloid, scleroderma and morphoea skin and their production of collagen, glycosaminoglycans and fibronectin. Br J Dermatol. 1990;123:339–46. doi: 10.1111/j.1365-2133.1990.tb06294.x. [DOI] [PubMed] [Google Scholar]
  • 39.Berman B, Wietzerbin J, Sanceau J, Merlin G, Duncan MR. Pentoxifylline inhibits certain constitutive and tumor necrosis factor- alpha-induced activities of human normal dermal fibroblasts. J Invest Dermatol. 1992;98:706–12. doi: 10.1111/1523-1747.ep12499916. [DOI] [PubMed] [Google Scholar]
  • 40.Ishii O, Yamada H, Ohya S, et al. Remission induction after pentoxifylline treatment in a patient with rheumatoid arthritis. Ryumachi. 1997;37:810–5. [PubMed] [Google Scholar]
  • 41.Maksymowych WP, Avina-Zubieta A, Luong MH, Russell AS. An open study of pentoxifylline in the treatment of severe refractory rheumatoid arthritis. J Rheumatol. 1995;22:625–9. [PubMed] [Google Scholar]
  • 42.Rieckmann P, Weber F, Gunther A, et al. Pentoxifylline, a phosphodiesterase inhibitor, induces immune deviation in patients with multiple sclerosis. J Neuroimmunol. 1996;64:193–200. doi: 10.1016/0165-5728(95)00176-x. [DOI] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES