Abstract
Besides environmental factors, the genetic background of an individual may contribute to the development and final outcome of peptic ulcer disease. Interleukin-1β (IL-1β) and the interleukin-1 receptor antagonist (IL-1ra) are cytokines that play a key role in modulating the inflammatory response in the gastrointestinal mucosa. This study aimed to investigate whether polymorphisms in the IL-1B and IL-RN genes are involved in the susceptibility to and final outcome of peptic ulcer disease. DNA from 179 unrelated Spanish Caucasian patients with peptic ulcer diseases and 99 ethnically matched healthy controls was typed for the TaqI polymorphism at position + 3954 in the IL-1B gene and the variable number of tandem repeats polymorphism in intron 2 of the IL-1RN gene. The determination of Helicobacter pylori status and non-steroidal anti-inflammatory drug (NSAIDs) use was studied in all patients and in controls. H. pylori infection and NSAID use were more frequent in ulcer patients than in controls. There were no significant differences in carriage rate, genotype and allele frequencies of the IL-1RN and the IL-1B+3954 gene polymorphisms between peptic ulcer patients and controls. However, a strong allelic association between IL-1B and IL-1RN genes was found in duodenal ulcer patients (P < 0·0006). Logistic regression identified H. pylori infection and NSAIDs use as independent risk factors for peptic ulcer diseases whereas the simultaneous carriage of IL-1B+3954 allele 2 and IL-1RN allele 2 was associated with reduced risk for duodenal ulcer disease (OR: 0·37, 95% CI = 0·14–0·9). Our data suggest that IL-1B and IL-1RN genes in addition to bacterial and environmental factors play a key role in determining the final outcome of peptic ulcer disease.
Keywords: cytokines, H. pylori, NSAIDs, peptic ulcer, polymorphisms
INTRODUCTION
Peptic ulcer is a complex disease with a multi-factorial aetiology that is not fully understood. Epidemiological data have revealed Helicobacter pylori infection and non-steroidal anti-inflammatory drugs (NSAIDs) as the two major environmental factors implicated in the genesis of peptic ulcer [1,2]. Gastric ulcers (GU) occur in a range from nine to 22% of patients taking NSAIDs with less consistent results for duodenal ulcer (DU) [3,4]. In addition to NSAID use, conclusive evidence exists that H. pylori is aetiologically involved in more than 95% of duodenal ulcers and 80% of gastric ulcers [5,6]. This causal relationship is based on the fact that H. pylori eradication in infected peptic ulcer patients dramatically lowers the ulcer relapse rate [7] and the development of complications [8,9]. However, it is still a matter of speculation why only a minority of individuals harbouring H. pylori develops peptic ulcer. In these cases, the influence of host genetic factors could explain the different clinical outcome. This observation, together with the importance of the immune system in the aetiopathogenesis of peptic ulcer disease [10,11], has stimulated research of genes that encode those mediators which participate in the regulation of the inflammatory and immune responses in the gastrointestinal mucosa [12,13]. From this point of view, interleukin‐1β (IL-1B) and interleukin-1 receptor antagonist (IL-1RN) genes are good candidates to study since they encode two cytokines, IL-1β and IL-1ra, respectively, which play a key role in regulating some gastric functions and in maintaining the gastrointestinal mucosal integrity. For example, in the stomach, IL-1β acts suppressing neutrophil migration induced by chemotaxis [14], and as a powerful inhibitor of gastric acid and pepsinogen secretion [15–17]. IL-1β also induces the synthesis of prostaglandins of the E type (PGE2) by fibroblasts and smooth muscle cells [18]. Furthermore, the levels of IL-1β in cultured antral biopsy are significantly higher in H. pylori+ patients than in individuals with negative cultures for H. pylori and normal antral mucosa, although no significant differences in the level of this cytokine have been shown between H. pylori+ patients with or without duodenal ulcer [19].
Inter-individual variations in in vitro production levels of IL-1 protein [20] have been reported to be genetically determined [21]. The genes of IL-1 family, IL-1 A, IL-1B and IL-1RN, are clustered located on the long arm of human chromosome 2 [22]. Several polymorphisms such as a variable number of an 86-base pair tandem repeat polymorphism (VNTR) in intron 2 of the IL-1RN gene [23], and a bi-allelic TaqI polymorphism at position + 3954 within exon 5 of the IL-1B gene [24] have been reported to be related to variations in the production levels of IL-1β and IL-1ra [24–27]. Furthermore, allele 2 of the IL-1RN polymorphism has been associated with increased frequency of several chronic inflammatory diseases, such as ulcerative colitis [28,29], Graves' disease [30], diabetic nephropathy [31] and psoriasis [32].
Since the integrity of the gastrointestinal mucosa may depend, at least in part, on the relative balance of these two cytokines, the aim of our study was to determine the genotype and allele frequencies of the IL-1RN and IL-1B gene polymorphisms in a Spanish Caucasian population of peptic ulcer patients and healthy controls, and to assess whether these two polymorphic genes are involved in the susceptibility to and final outcome of peptic ulcer disease.
MATERIAL AND METHODS
Subjects
A total number of 179 unrelated Spanish Caucasian patients with peptic ulcer disease attending the Hospital Clinico in Zaragoza, Spain were included in the study. One hundred and twenty-four patients had had an episode of upper gastrointestinal bleeding at the moment of diagnosis (43 patients with gastric ulcer, 74 with duodenal ulcer and seven with both, gastric and duodenal ulcer) and 55 were patients with uncomplicated peptic ulcers (47 with duodenal ulcer, five with gastric ulcer and three with both gastric and duodenal ulcer). Ninety-nine ethnically matched healthy volunteers without active or past peptic ulcer history served as controls (HC). All patients and controls gave informed consent to the study, which was conducted in accordance with the Ethical Committee of the University Hospital of Zaragoza. The diagnosis of gastric (GU) or duodenal ulcer (DU) and the presence of complications were based on conventional clinical and endoscopic findings. The determination of H. pylori status and NSAID use were studied in all patients at the time of the diagnosis and in controls.
The presence of H. pylori infection was determined in patients by both, urease test (CLO-test; Delta West Ltd, Canning Vale, Bentley, Australia) and histological examination from biopsies taken at the antrum and corpus of the stomach during the endoscopic procedure. In addition, a 13C-urea breath test (Isomed, Madrid, Spain) was performed in all patients who were negative by invasive methods. In controls, the presence of H. pylori was diagnosed by urease test, 13C-urea breath test, and serology using a commercial IgG ELISA kit (Plate Helicobacter IgG, Boehringer Mannheim; Cortesec Diagnostics Ltd, Clwyd, England). Two procedures had to yield positive results in order to define the H. pylori+ status.
The use of NSAIDs at the time of the diagnosis of peptic ulcer was determined by structured data collection. A patient was considered positive if the drug had been taken within the week prior to the hospital admission of the endoscopic diagnosis of peptic ulcer [33].
Smoking status was defined as follows: (1) patients who were current smokers or had stopped smoking < 1 year ago were considered smokers and (2) patients who had never smoked or had stopped smoking > 1 year ago were considered as non-smokers.
Methods
Genomic DNA was extracted from ethlyenediamine-tetraacetic acid (EDTA) preserved whole blood by a standard proteinase-K digestion and phenol/chloroform procedure [34].
A biallelic TaqI restriction fragment length polymorphism (RFLP) (C→T) at position + 3954 in the fifth exon of the IL-1B gene and a penta-allelic variable number of an 86-bp tandem repeat polymorphism (VNTR) in intron 2 of the IL-1RN gene were analysed by PCR according to previously described methods [35]. Summarized conditions are given in Table 1.
Table 1.
Primers and reaction conditions used for detection of + 3954 IL-1B and 2nd intron IL-1RN gene polymorphisms
| Position | Primers (5′ to 3′) | Annealing temperature | Type of polymorphism | Alleles |
|---|---|---|---|---|
| + 3954 IL-1B | Sense: GTTGTCATCAGACTTTGACC55°C | 55°C | TaqI RFLP | 1 (C) = digested fragment of 135 bp and 114 bp |
| Antisense: TTCAGTTCATATGGACCAGA | 2 (T) = intact fragment of 249 bp (Fig. 2) | |||
| 2nd intron | Sense: CTCAGCAACACTCCTAT | 60°C | VNTR | 1 = 4 repeats of the 86-bp region (410 bp) |
| IL-1RN | Antisense: TCCTGGTCTGCAGGTAA | 2 = 2 repeats (240 bp) | ||
| 3 = 5 repeats (500 bp) | ||||
| 4 = 3 repeats (325 bp) | ||||
| 5 = 6 repeats (595 bp) (Fig. 1) |
RFLP, restriction fragment length polymorphism; VNTR, variable number of tandem repeats.
Fig. 1.
Agarose gel showing six different patterns for IL-RN genotypes 1·1, 2·2, 1·2, 1·3, 2·3 and 1·4. A 100 base pair ladder is shown in the left lane (M).
Fig. 2.
Agarose gel showing IL-1B TaqI-restriction patterns in three individuals. The sizes of the fragments after TaqI digestion are given on the right side, 249 bp for allele 2, and 135 bp and 114 bp for allele 1. A 100 base pair ladder is shown in the left lane (M). Lanes 2, 3 and 4 show an individual heterozygous, homozygous for allele 2 and homozygous for allele 1, respectively.
Statistical analysis
Bivariate analysis was performed by χ2 test with Yates'correction for the comparison of phenotype frequencies between different groups of patients and healthy controls. A two-sided P-value < 0·05 was considered statistically significant. Hardy–Weinberg equilibrium was tested in the control samples by a χ2 test with one degree of freedom (d.f.).
Unconditional logistic regression analysis was carried out using the BMDP Dynamic v 7·0 program (BMDP Statistical Software Inc., Cork, Ireland) to quantify the influence of both genetic and environmental factors for duodenal and gastric ulcers as dependent variables. Starting with age and sex the model was constructed with a stepwise forward conditional method. The independent variables, H. pylori infection, NSAID use, cigarette smoking, carriers of the IL-1B allele 2, carriers of the IL-1RN allele 2 and the four combinations, i.e. (carriers IL-1B allele 2/carriers IL-1RN allele 2, non-carriers IL-1B allele 2/non-carriers IL-1RN allele 2, non-carriers IL-1B allele 2/carriers IL-1RN allele 2, and carriers IL-1B allele 2/non carriers IL-1RN allele 2) were considered. A variable was entered in the model if the significance level of its coefficient was less than 0·05 and was removed if it was greater than 0·10. Sex and age variables were present in all the models. Age was not categorized and was introduced as a continuous variable. Categorical variables included in the models were codified as dummy variables.
Based on previous data reported in several IBD (chronic inflammatory bowel disease) studies performed in European populations [35,36] we estimated that a 20% difference in the carrier status of the possible combinations of alleles 2 of the IL-1RN and IL-1B+3954 gene polymorphisms could be present in patients. Based on this assumption we calculated that it was necessary to study 95 subjects in each group in order to have 0·80 power and an α value of 0·05.
RESULTS
Clinical and demographic characteristics of patients and controls
Clinical and demographic characteristics of peptic ulcer patients and controls are given in Table 2. As it can be seen in the table, there were some patients (10) with combined GU and DU. However, the group was too small to perform statistical analysis for assessing its significance. H. pylori infection was more frequent in both DU (95·9%) and GU patients (81·2%) than in controls (71·7%) and it was distributed equally among males and females in all study groups. Seventy-four patients with DU (61% of the total DU group) and 43 with GU (90% of the total GU group) had experienced an episode of gastrointestinal bleeding, which was associated with NSAID use in 55·4% and 83·7% of cases, respectively. However, the frequency of H. pylori in this population was very high and similar to that observed in the whole group.
Table 2.
Demographics and clinical characteristics of healthy controls and peptic ulcer patients
| Healthy controls n = 99 (%) | Duodenal ulcer n = 121 (%) | Gastric ulcer n = 48 (%) | Duodenal + gastric ulcer n = 10 (%) | |
|---|---|---|---|---|
| Age years ± s.d (range) | 44·9 ± 18·8 | 47·2 ± 13 | 57·8 ± 13 | 63·1 ± 9·2 |
| (20–83) | (17–75) | (18–83) | (47–77) | |
| Sex | 62 M (62·2%) | 94 M (77·7%) | 29 M (60·4%) | 8 M (80%) |
| 37 F (37·8%) | 27 F (22·3%) | 19 F (39·6%) | 2 F (20%) | |
| H pylori + | 71 (71·7%) | 115 (95·9%)* | 39 (81·2%) | 10 (100%)** |
| 42/62 M (67·7%) | 88/94 M (93·6%) | 26/29 M (89·6%) | 8/8 M (100%) | |
| 29/37 F (78·4%) | 27/27 F (100%) | 13/19 F (68·4%) | 2/2 F (100%) | |
| NSAID-use | 8 (8·1%) | 44 (36·4%)* | 39 (81·2%)* | 7 (70%)* |
| Cigarette smoking | 37 (37·4%) | 57 (47%) | 19 (39·6%) | 4 (40%) |
| Family history-ulcer | 11 (11·1%) | 42 (34·7%) | 12 (25%) | 1 (10%) |
| Past ulcer history | – | 60 (49·6%) | 18 (37·5%) | 5 (50%) |
| GI bleeding history | – | 74 (61·2%) | 43 (89·6%) | 7 (70%) |
| H pylori + | – | 71 (95·9%)* | 34 (79·1%) | 7 (100%) |
| NSAID + | 41 (55·4%)* | 36 (83·7%)* | 6 (85·7%)* |
n, Number of patients; M, male; F, female.
P < 0·001
P < 0·05 versus. healthy controls.
IL-1B and IL-1RN gene polymorphisms
Genotypes and allele frequencies of the IL-1RN and the IL-1B+3954 gene polymorphisms in patients and controls according to their H. pylori status and history of NSAID use at the time of the ulcer diagnosis are shown in Tables 3 and 4, respectively. Genotype frequencies of these two polymorphisms did not deviate significantly from Hardy–Weinberg expectation in the control group. There were no significant differences in carriage rate, genotype and allele frequencies of the IL-1RN and the IL-1B+3954 gene polymorphisms between peptic ulcer patients and controls. When considering the H. pylori status, no significant differences between H. pylori-infected and non-infected individuals, within and between all study groups were found. Also within the patient groups no differences in genotype with respect to NSAIDs use were apparent. To investigate possible associations between specific alleles of the IL-1B and IL-1RN genes, individuals were classified into four groups depending on whether they were carriers or non-carriers of the less common allele 2 of each polymorphic gene (Table 5). A significant association of this pair of genes was found when peptic ulcer patients were considered as a whole group (OR: 2·6, 95% CI = 1·36–4·92, P = 0·004). However, no association was observed in the HC group, where carriers and non-carriers of IL-1B+3954 allele 2 were equally distributed in carriers and non-carriers of IL-1RN allele 2. When patients were classified according to the localization of the disease in duodenal and gastric ulcer patients, a strong association of IL-1B and IL-1RN genes was found in the subgroup of patients with duodenal ulcers. In this subgroup, patients who were non-carriers of the IL-1B+3954 allele 2 were more often carriers of the IL-1RN allele 2, and carriers of IL-1B+3954 allele 2 were less often carriers of the IL-1RN allele 2 (OR:4·1, 95% CI = 1·77–9·45, P = 0·0006). This association was unrelated to NSAIDs use and still remained highly significant in the group of duodenal ulcer patients who had not taken NSAIDs (OR: 4·4, 95% CI: 1·5–12·3, P = 0·004) (Table 5). By contrast, no association of these gene polymorphisms was found in the group of patients with gastric ulcer.
Table 3.
Genotype and allele frequencies of IL-1RN gene polymorphism in healthy controls and peptic ulcer patients according to their H. pylori status and NSAID-use history
| Genotype n (%) | Allele frequency (%) | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| IL-1RN | n | 1·1 | 1·2 | 2·2 | 1·3 | 2·3 | 1·4 | 1 | 2 | 3 | 4 |
| Healthy controls | 99 | 52 (52·5) | 34 (34·4) | 11 (11·1) | 1 (1) | 1 (1) | – | 70·2 | 28·8 | 1 | – |
| H. pylori + | 71 | 38 (53·5) | 24 (33·8) | 8 (11·3) | – | (1·4) | – | 70·4 | 28·9 | 0·7 | – |
| H. pylori− | 28 | 14 (50) | 10 (35·7) | 3 (10·8) | 1 (3·5) | – | – | 69·6 | 28·6 | 1·8 | – |
| NSAID use + | 8 | 4 (50) | 3 (37·5) | 1 (12·5) | – | – | – | 68·7 | 31·3 | – | – |
| NSAID use − | 91 | 48 (52·7) | 31 (34·1) | 10 (11) | 1 (1·1) | 1 (1·1) | – | 70·3 | 28·6 | 1·1 | – |
| Peptic ulcer | 179 | 88 (49·2) | 65 (36·3) | 13 (7·3) | 8 (4·5) | 3 (1·7) | 2 (1·1) | 70·1 | 26·3 | 3·1 | 0·5 |
| H. pylori + | 164 | 80 (48·8) | 59 (36) | 12 (7·3) | 8 (4·9) | 3 (1·8) | 2 (1·2) | 69·8 | 26·2 | 3·4 | 0·6 |
| H. pylori− | 15 | 8 (53·3) | 6 (40) | 1 (6·7) | – | – | – | 73·3 | 26·7 | – | – |
| NSAID use + | 90 | 41 (45·5) | 32 (35·5) | 10 (11·1) | 4 (4·4) | 2 (2·2) | 1 (1·1) | 66·1 | 30 | 3·3 | 0·6 |
| NSAID use − | 89 | 47 (52·8) | 33 (37) | 3 (3·4) | 4 (4·5) | 1 (1·1) | 1 (1·1) | 74·1 | 22·5 | 2·8 | 0·6 |
| Duodenal ulcer | 121 | 65 (53·7) | 43 (35·5) | 7 (5·8) | 4 (3·3) | 1 (0·8) | 1 (0·8) | 73·6 | 24 | 2·4 | 0·4 |
| H. pylori + | 115 | 62 (53·9) | 41 (35·6) | 6 (5·2) | 4 (3·5) | 1 (0·9) | 1 (0·9) | 73·9 | 23·5 | 2·2 | 0·4 |
| H. pylori− | 6 | 3 (50) | 2 (33·3) | 1 (16·7) | – | – | – | 66·7 | 33·3 | – | – |
| NSAID use + | 44 | 26 (59) | 13 (29·5) | 4 (9·1) | 1 (2·3) | – | – | 75 | 23·9 | 1·1 | – |
| NSAID use − | 77 | 39 (50·6) | 30 (39) | 3 (3·9) | 3 (3·9) | 1 (1·3) | 1 (1·3) | 72·7 | 24·1 | 2·6 | 0·6 |
| Gastric ulcer | 48 | 20 (41·7) | 18 (37·5) | 4 (8·3) | 3 (6·2 | 2 (4·2) | 1 (2·1) | 64·6 | 29·2 | 5·2 | 1 |
| H. pylori + | 39 | 15 (38·5) | 14 (35·9) | 4 (10·2) | 3 (7·7) | 2 (5·1) | 1 (2·6) | 61·5 | 30·8 | 6·4 | 1·3 |
| H. pylori− | 9 | 5 (55·5) | 4 (44·5) | – | – | – | – | 77·8 | 22·2 | – | – |
| NSAID use + | 39 | 14 (35·9) | 16 (41) | 4 (10·2) | 2 (5·1) | 2 (5·1) | 1 (2·6) | 60·3 | 33·3 | 5·1 | 1·3 |
| NSAID use − | 9 | 6 (66·7) | 2 (22·2) | – | 1 (11·1) | – | – | 83·3 | 11·1 | 5·6 | – |
n, Number of individuals.
Table 4.
Genotype and allele frequencies of IL-1B+3954 gene polymorphism in healthy controls and peptic ulcer patients according to their H. pylori status and NSAID-use history
| Genotype n (%) | Allele frequency (%) | |||||
|---|---|---|---|---|---|---|
| IL-IB | n | 1·1 | 1·2 | 2·2 | 1 | 2 |
| Healthy controls | 99 | 63 (63·6) | 33 (33·3) | 3 (3·1) | 80·3 | 19·7 |
| H. pylori + | 71 | 45 (63·4) | 23 (32·4) | 3 (4·2) | 79·6 | 20·4 |
| H. pylori− | 28 | 18 (64·3) | 10 (35·7) | – | 82·1 | 17·9 |
| NSAID use + | 8 | 4 (50) | 3 (37·5) | 1 (12·5) | 68·7 | 18·7 |
| NSAID use − | 91 | 59 (64·8) | 30 (33) | 2 (2·2) | 81·3 | 18·7 |
| Peptic ulcer | 179 | 114 (63·7) | 56 (31·3) | 9 (5) | 79·3 | 20·7 |
| H. pylori + | 164 | 105 (64) | 51 (31·1) | 8 (4·9) | 79·6 | 20·4 |
| H. pylori− | 15 | 9 (60) | 5 (33·3) | 1 (6·7) | 76·7) | 23·3 |
| NSAID use + | 90 | 58 (64·5) | 31 (34·4) | 1 (1·1) | 81·8 | 18·2 |
| NSAID use − | 89 | 56 (62·9) | 25 (28·1) | 8 (9) | 77 | 23 |
| Duodenal ulcer | 121 | 76 (62·8) | 37 (30·6) | 8 (6·6) | 78·1 | 21·9 |
| H. pylori + | 115 | 72 (62·6) | 36 (31·3) | 7 (6·1) | 78·3 | 21·7 |
| H. pylori− | 6 | 4 (66·7) | 1 (16·7) | 1 (16·7) | 75 | 25 |
| NSAID use + | 44 | 29 (65·9) | 14 (31·8) | 1 (2·3) | 81·8 | 18·2 |
| NSAID use − | 77 | 47 (61) | 23 (29·9) | 7 (9·1) | 75·9 | 24·1 |
| Gastric ulcer | 48 | 31 (64·6) | 16 (33·3) | 1 (2·1) | 81·2 | 18·8 |
| H. pylori + | 39 | 26 (66·7) | 12 (30·8) | 1 (2·5) | 82·1 | 17·9 |
| H. pylori− | 9 | 5 (55·6) | 4 (44·4) | – | 77·8 | 22·2 |
| NSAID use + | 39 | 24 (61·5) | 15 (38·5) | – | 80·8 | 19·2 |
| NSAID use − | 9 | 7 (77·8) | 1 (11·1) | 1 (11·1) | 83·3 | 16·7 |
n, Number of individuals.
Table 5.
Frequencies of the + 3954 IL-1B allele 2 carriage in healthy controls and peptic ulcer patients according to the carriage of IL-1RN allele 2
| (n) | Non-carriers IL-1B*2n (%) | Carriers IL-1B*2n (%) | OR | 95% CI | P | |
|---|---|---|---|---|---|---|
| Healthy controls | Carriers IL-1RN*2 (46) | 30 (65·2) | 16 (34·8) | 1·2 | 0·54–2·79 | 0·6 |
| Non-carriers IL-1RN*2 (53) | 32 (60·4) | 21 (39·6) | ||||
| Peptic ulcer | Carriers IL-1RN*2 (81) | 61 (75·3) | 20 (24·7) | 2·6 | 1·36–4·92 | 0·004 |
| Non-carriers IL-1RN*2 (98) | 53 (54·1) | 45 (45·9) | ||||
| Duodenal ulcer (DU) | Carriers IL-1RN*2 (51) | 41 (80·4) | 10 (19·6) | 4·1 | 1·77–9·45 | 0·0006 |
| Non-carriers IL-1RN*2 (70) | 35 (50) | 35 (50) | ||||
| NSAIDs use + (44) | ||||||
| Carriers IL-1RN*2 (17) | 14 (82·4) | 3 (17·6) | 3·7 | 0·8–16 | 0·1 | |
| Non-carriers IL-1RN*2 (27) | 15 (55·6) | 12 (44·4) | ||||
| NSAIDs use – (77) | ||||||
| Carriers IL-1RN*2 (34) | 27 (79·4) | 7 (20·6) | 4·4 | 1·5–12·3 | 0·004 | |
| Non-carriers IL-1RN*2 (43) | 20 (46·5) | 23 (53·5) | ||||
| Gastric ulcer (GU) | Carriers IL-1RN*2 (24) | 15 (62·5) | 9 (37·5) | 0·8 | 0·25–2·72 | 1 |
| Non-carriers IL-1RN*2 (24) | 16 (66·7) | 8 (33·3) |
n, Number of individuals; OR, odds ratio; 95% CI, 95 confidence of interval; IL-1RN*2, IL-1RN allele 2; IL-1B*2, IL-1B allele 2.
Of the environmental and genetic factors evaluated in this study, and after controlling for confounding factors, logistic regression analysis identified H. pylori infection and NSAIDs use as independent risk factors of peptic ulcer diseases whereas the simultaneous carriage of IL-1B+3954 allele 2 and IL-1RN allele 2 was an independent factor associated with reduced risk of duodenal ulcer (OR: 0·37, 95% CI = 0·14–0·9) (Table 6). Finally, no significant differences in carriage rate, genotype and allele frequencies of the VNTR IL-1RN and the IL-1B+3954 gene polymorphisms were found when patients were categorized according to gender, age of onset, smoking habit, past ulcer history and positive family history (data not shown).
Table 6.
Adjusted odds ratios and 95% confidence of intervals of peptic ulceration (duodenal and gastric ulcers) associated with different environmental and genetic factors by logistic regression
| Factor | Peptic ulcer | Duodenal ulcer | Gastric ulcer |
|---|---|---|---|
| H. pylori infection | 5·57 (2·43–12·7) | 10·2 (3·6–28·9) | n.s. |
| NSAID use | 15 (6·1–36·8) | 6·78 (2·7–16·8) | 49·3 (17·6–138) |
| Carriage of + 3954 IL-1B*2/IL-1RN *2 | n.s. | 0·371 (0·14–0·9) | n.s. |
n.s., Non-significant.
DISCUSSION
Different pathogenic mechanisms have been suggested to be involved in the development of peptic ulcer disease. While H. pylori infection has been proposed especially in duodenal ulcers [5,7], the use of NSAIDs is considered the major risk factor in gastric ulcers [4,37]. However, besides environmental factors, the genetic background of an individual may contribute to the development and final outcome of peptic ulcer disease. Family and epidemiological studies also support the role of genetic factors in the aetiology of peptic ulcer [38–40]. Some genetic markers such as blood group O, non-secretor status, hyperpepsinogenaemia and HLA antigens have been described as beind associated with peptic ulcer, although results have been conflicting so far [41–46].
We report in this paper the association of specific combinations of IL-1B+3954/IL-1RN variants with reduced risk of developing duodenal ulcer disease. Interestingly, no association of these polymorphic genes was found in gastric ulcer patients and in controls, which is in accordance with previous family and epidemiological studies supporting a different genetic background for the development of gastric and duodenal ulcers [2,38,41]. The lack of association between these gene polymorphisms found in our control group is in agreement with several studies performed in other European populations [13,35,36], suggesting no linkage disequilibrium between them. In the present study a key role for NSAIDs use was found in gastric ulcers. However, a different mechanism might be implicated in the pathogenesis of duodenal ulcers. Multivariate analysis identified the simultaneous carriage of IL-1B+3954 allele 2 and IL-1RN allele 2 as an independent protective factor for duodenal ulcer disease. A potential explanation of this finding could be provided by the fact that carriage of allele 2 of each of these polymorphisms has been related with high production of IL-1β [24,25], which through its acid inhibitory effects on the stomach could decrease the risk of developing duodenal ulcer disease, traditionally regarded as a high acid condition. Unfortunately, the real functional significance of this association is not clear and results concerning the effects of IL-1B+3954 and IL-1RN gene polymorphisms on IL-1β and IL-1ra production are still controversial [24–27,47]. This makes it difficult to elaborate a hypothesis correlating specific allele combinations with high or low producers of IL-1β and IL-1ra. Therefore, further studies are crucial in order to clarify the exact functional consequences of these polymorphisms.
Most of our peptic ulcer patients were infected by H. pylori (96% in DU and 81% in GU) and, therefore, the data regarding IL-1B/IL-1RN gene polymorphisms concern H. pylori-infected individuals. Although a large proportion of patients in our study had used NSAIDs, this is due largely to the inclusion of patients who had had a complication event, which is normal in the setting of a general hospital. However, the prevalence of infection in these patients was very high (95·9% for duodenal ulcer patients) and similar to that found in patients with uncomplicated ulcers. This suggests that NSAIDs have probably played a major role in the complication event, but a minor role in the induction of the ulcer itself. However, after controlling for confounding factors, the multivariate analysis identified that the simultaneous carriage of IL-1B+3954 allele 2 and IL-1RN allele 2 was an independent protective factor for duodenal ulcer disease, regardless the influence of other environmental factors.
In agreement with the results reported by Kunstmann et al. [12] and El-Omar et al. [13], we did not observe any differences in genotype and allele frequencies of IL-1RN and IL-1B +3954 gene polymorphisms between H. pylori-infected and non-infected subjects, patients and controls. Moreover, no differences in genotype frequencies were found between the total of H. pylori-infected (n = 235) and uninfected individuals (n = 43). Although the number of H. pylori-uninfected individuals was not large, the distribution of genotype and allele frequencies in this group was almost identical to the distribution in the group of H. pylori-infected individuals. In the former study, El-Omar and coworkers [13] have reported the association of specific interleukin-1 gene polymorphisms with increased risk of gastric cancer. According to these authors, IL-1B-31T + and IL1RN*2/*2 genotypes increase both the likelihood of a chronic hypochlorhydric response to H. pylori infection and the risk of gastric cancer, presumably by altering IL-1β levels in the stomach. We could then speculate that those genotypes, which predispose to gastric cancer, through producing hypochlorhydria would be protective against duodenal ulcer disease. In our study, IL1RN*2/*2 genotype was found to be less frequent in duodenal ulcer patients than in controls (5% versus 11%), although the value did not reach statistical significance.
Recently, the TNF-308 polymorphism located in the promoter region of the TNF gene has been associated with susceptibility to the development of duodenal ulcer [12]. Thus, H. pylori+ individuals with the TNF-α−308 G/G genotype have a higher risk for the development of duodenal ulcer than individuals with the TNF-α−308 G/A or A/A genotypes. This finding supports the hypothesis that, in addition to the IL-1 gene cluster, other cytokines genes such as TNF may play an important role in the development of peptic ulcer, probably by altering the intestinal mucosal cytokine ratio.
In summary, our results provide further evidence that genetic factors are important in the pathogenesis of peptic ulcer disease. We suggest that the carriage of the IL-1RN allele 2/IL-1B+3954 allele 2 combination in addition to bacterial and environmental factors may play a protective role in the development of duodenal ulcers disease. One of the major challenges for future research will be to further investigate the biological significance of this association as this may have direct implications for therapy. Genotyping of the IL-1RN/IL-1B+3954 polymorphisms could help to identify potential risk patients and contribute to a novel therapeutic approach. Since the state of knowledge about the involvement of cytokines genes in the pathogenesis of peptic ulcer is still at an early stage, further studies are needed in order to determine the influence of host genetic factors in the aetiology of the disease.
Acknowledgments
The authors would like to thank the support of AstraZeneca BV, the Netherlands and the ‘DGA-CAI (CM2/97)’ for financial support to M. A. García-González. This study was also supported in part by grants from the ‘Asociación de Investigaciones Gastroenterológicas de la Provincia de Zaragoza’ and the University of Zaragoza. We also like to thank the Chi-cuadrado group and Prof. Guillermo Marco of the Service of Epidemiology (UMI) for his invaluable assistance with the statistical analysis.
REFERENCES
- 1.Lam SK. Aetiological factors of peptic ulcer: perspectives of epidemiological observations this century. J Gastroenterol Hepatol. 1994;9:S93–8. doi: 10.1111/j.1440-1746.1994.tb01310.x. [DOI] [PubMed] [Google Scholar]
- 2.Kurata JH, Nogawa AN. Meta-analysis of risk factors for peptic ulcer. Nonsteroidal antiinflammatory drugs, Helicobacter pylori, and smoking. J Clin Gastroenterol. 1997;24:2–17. doi: 10.1097/00004836-199701000-00002. [DOI] [PubMed] [Google Scholar]
- 3.Soll AH, Weinstein WM, Kurata J, McCarthy D. Nonsteroidal anti-inflammatory drugs and peptic ulcer disease. Ann Intern Med. 1991;114:307–19. doi: 10.7326/0003-4819-114-4-307. [DOI] [PubMed] [Google Scholar]
- 4.Lanas A, Hirschowitz BI. Toxicity of NSAIDs in the stomach and duodenum. Eur J Gastroenterol Hepatol. 1999;11:375–81. doi: 10.1097/00042737-199904000-00003. [DOI] [PubMed] [Google Scholar]
- 5.Tytgat GN. Duodenal ulcer disease. Eur J Gastroenterol Hepatol. 1996;8:829–33. [PubMed] [Google Scholar]
- 6.Kuipers EJ, Thijs JC, Festen HP. The prevalence of Helicobacter pylori in peptic ulcer disease. Aliment Pharmacol Ther. 1995;9:59–69. [PubMed] [Google Scholar]
- 7.Hopkins RJ, Girardi LS, Turney EA. Relationship between Helicobacter pylori eradication and reduced duodenal and gastric ulcer recurrence: a review. Gastroenterology. 1996;110:1244–52. doi: 10.1053/gast.1996.v110.pm8613015. [DOI] [PubMed] [Google Scholar]
- 8.Sonnenberg A, Olson CA, Zhang J. The effect of antibiotic therapy on bleeding from duodenal ulcer. Am J Gastroenterol. 1999;94:950–4. doi: 10.1111/j.1572-0241.1999.992_o.x. [DOI] [PubMed] [Google Scholar]
- 9.Ng TM, Fock KM, Khor JL, et al. Non-steroidal anti-inflammatory drugs, Helicobacter pylori and bleeding gastric ulcer. Aliment Pharmacol Ther. 2000;14:203–9. doi: 10.1046/j.1365-2036.2000.00679.x. [DOI] [PubMed] [Google Scholar]
- 10.Ernst PB, Jin Y, Reyes VE, Crowe SE. The role of the local immune response in the pathogenesis of peptic ulcer formation. Scand J Gastroenterol Suppl. 1994;205:22–8. doi: 10.3109/00365529409091405. [DOI] [PubMed] [Google Scholar]
- 11.Uehara A, Namiki M. Immunopathology of ulcer disease. Ann NY Acad Sci. 1993;697:260–8. doi: 10.1111/j.1749-6632.1993.tb49939.x. [DOI] [PubMed] [Google Scholar]
- 12.Kunstmann E, Epplen C, Elitok E, et al. Helicobacter pylori infection and polymorphisms in the tumor necrosis factor region. Electrophoresis. 1999;20:1756–61. doi: 10.1002/(SICI)1522-2683(19990101)20:8<1756::AID-ELPS1756>3.0.CO;2-B. [DOI] [PubMed] [Google Scholar]
- 13.El-Omar EM, Carrington M, Chow W, et al. Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature. 2000;404:398–402. doi: 10.1038/35006081. [DOI] [PubMed] [Google Scholar]
- 14.Wallace JL, Keenan CM, Cucala M, Mugridge KG, Parente L. Mechanisms underlying the protective effects of interleukin 1 in experimental nonsteroidal anti-inflammatory drug gastropathy. Gastroenterology. 1992;102:1176–85. [PubMed] [Google Scholar]
- 15.Robert A, Olafsson AS, Lancaster C, Zhang WR. Interleukin-1 is cytoprotective, antisecretory, stimulates PGE2 synthesis by the stomach, and retards gastric emptying. Life Sci. 1991;48:123–34. doi: 10.1016/0024-3205(91)90405-z. [DOI] [PubMed] [Google Scholar]
- 16.Serrano MT, Lanas AI, Lorente S, Sainz R. Cytokine effects on pepsinogen secretion from human peptic cells. Gut. 1997;40:42–8. doi: 10.1136/gut.40.1.42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Beales IL, Calam J. Interleukin 1 beta and tumour necrosis factor alpha inhibit acid secretion in cultured rabbit parietal cells by multiple pathways. Gut. 1998;42:227–34. doi: 10.1136/gut.42.2.227. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Sartor RB. Cytokines in intestinal inflammation: pathophysiological and clinical considerations. Gastroenterology. 1994;106:533–9. doi: 10.1016/0016-5085(94)90614-9. [DOI] [PubMed] [Google Scholar]
- 19.Noach LA, Bosma NB, Jansen J, Hoek FJ, van Deventer SJ, Tytgat GN. Mucosal tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-8 production in patients with Helicobacter pylori infection. Scand J Gastroenterol. 1994;29:425–9. doi: 10.3109/00365529409096833. [DOI] [PubMed] [Google Scholar]
- 20.Molvig J, Baek L, Christensen P, et al. Endotoxin-stimulated human monocyte secretion of interleukin 1, tumour necrosis factor alpha, and prostaglandin E2 shows stable interindividual differences. Scand J Immunol. 1988;27:705–16. doi: 10.1111/j.1365-3083.1988.tb02404.x. [DOI] [PubMed] [Google Scholar]
- 21.Endres S, Cannon JG, Ghorbani R, et al. In vitro production of IL 1 beta, IL 1 alpha, TNF and IL2 in healthy subjects: distribution, effect of cyclooxygenase inhibition and evidence of independent gene regulation. Eur J Immunol. 1989;19:2327–33. doi: 10.1002/eji.1830191222. [DOI] [PubMed] [Google Scholar]
- 22.Nicklin MJ, Weith A, Duff GW. A physical map of the region encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist genes. Genomics. 1994;19:382–4. doi: 10.1006/geno.1994.1076. [DOI] [PubMed] [Google Scholar]
- 23.Tarlow JK, Blakemore AI, Lennard A, et al. Polymorphism in human IL-1 receptor antagonist gene intron 2 is caused by variable numbers of an 86-bp tandem repeat. Hum Genet. 1993;91:403–4. doi: 10.1007/BF00217368. [DOI] [PubMed] [Google Scholar]
- 24.Pociot F, Molvig J, Wogensen L, Worsaae H, Nerup J. A TaqI polymorphism in the human interleukin-1 beta (IL-1 beta) gene correlates with IL-1 beta secretion in vitro. Eur J Clin Invest. 1992;22:396–402. doi: 10.1111/j.1365-2362.1992.tb01480.x. [DOI] [PubMed] [Google Scholar]
- 25.Danis VA, Millington M, Hyland VJ, Grennan D. Cytokine production by normal human monocytes: inter-subject variation and relationship to an IL-1 receptor antagonist (IL-1Ra) gene polymorphism. Clin Exp Immunol. 1995;99:303–10. doi: 10.1111/j.1365-2249.1995.tb05549.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Andus T, Daig R, Vogl D, et al. Imbalance of the interleukin 1 system in colonic mucosa — association with intestinal inflammation and interleukin 1 receptor antagonist genotype 2. Gut. 1997;41:651–7. doi: 10.1136/gut.41.5.651. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Tountas NA, Casini-Raggi V, Yang H, et al. Functional and ethnic association of allele 2 of the interleukin-1 receptor antagonist gene in ulcerative colitis. Gastroenterology. 1999;117:806–13. doi: 10.1016/s0016-5085(99)70338-0. [DOI] [PubMed] [Google Scholar]
- 28.Mansfield JC, Holden H, Tarlow JK, et al. Novel genetic association between ulcerative colitis and the anti-inflammatory cytokine interleukin-1 receptor antagonist. Gastroenterology. 1994;106:637–42. doi: 10.1016/0016-5085(94)90696-3. [DOI] [PubMed] [Google Scholar]
- 29.Bioque G, Bouma G, Crusius JB, et al. Evidence of genetic heterogeneity in IBD. 1. The interleukin-1 receptor antagonist in the predisposition to suffer from ulcerative colitis. Eur J Gastroenterol Hepatol. 1996;8:105–10. [PubMed] [Google Scholar]
- 30.Blakemore AI, Watson PF, Weetman AP, Duff GW. Association of Graves' disease with an allele of the interleukin-1 receptor antagonist gene. J Clin Endocrinol Metab. 1995;80:111–5. doi: 10.1210/jcem.80.1.7530255. [DOI] [PubMed] [Google Scholar]
- 31.Blakemore AI, Cox A, Gonzalez AM, et al. Interleukin-1 receptor antagonist allele (IL1RN*2) associated with nephropathy in diabetes mellitus. Hum Genet. 1996;97:369–74. doi: 10.1007/BF02185776. [DOI] [PubMed] [Google Scholar]
- 32.Tarlow JK, Cork MJ, Clay FE, et al. Association between interleukin-1 receptor antagonist (IL-1ra) gene polymorphism and early and late-onset psoriasis. Br J Dermatol. 1997;136:147–8. doi: 10.1111/j.1365-2133.1997.tb08779.x. [DOI] [PubMed] [Google Scholar]
- 33.Lanas A, Sekar MC, Hirschowitz BI. Objective evidence of aspirin use in both ulcer and nonulcer upper and lower gastrointestinal bleeding. Gastroenterology. 1992;103:862–9. doi: 10.1016/0016-5085(92)90018-t. [DOI] [PubMed] [Google Scholar]
- 34.Blin N, Stafford DW. A general method for isolation of high molecular weight DNA from eukaryotes. Nucl Acids Res. 1976;3:2303–8. doi: 10.1093/nar/3.9.2303. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Bioque G, Crusius JB, Koutroubakis I, et al. Allelic polymorphism in IL-1 beta and IL-1 receptor antagonist (IL-1Ra) genes in inflammatory bowel disease. Clin Exp Immunol. 1995;102:379–83. doi: 10.1111/j.1365-2249.1995.tb03793.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Nemetz A, Kope A, Molnar T, et al. Significant differences in the interleukin-1beta and interleukin-1 receptor antagonist gene polymorphisms in a Hungarian population with inflammatory bowel disease. Scand J Gastroenterol. 1999;34:175–9. doi: 10.1080/00365529950173041. [DOI] [PubMed] [Google Scholar]
- 37.Hansen JM, Hallas J, Lauritsen JM, Bytzer P. Non-steroidal anti-inflammatory drugs and ulcer complications: a risk factor analysis for clinical decision-making. Scand J Gastroenterol. 1996;31:126–30. doi: 10.3109/00365529609031975. [DOI] [PubMed] [Google Scholar]
- 38.Raiha I, Kemppainen H, Kaprio J, Koskenvuo M, Sourander L. Lifestyle, stress, and genes in peptic ulcer disease: a nationwide twin cohort study. Arch Intern Med. 1998;158:698–704. doi: 10.1001/archinte.158.7.698. [DOI] [PubMed] [Google Scholar]
- 39.Brenner H, Rothenbacher D, Bode G, Adler G. The individual and joint contributions of Helicobacter pylori infection and family history to the risk for peptic ulcer disease. J Infect Dis. 1998;177:1124–7. doi: 10.1086/517410. [DOI] [PubMed] [Google Scholar]
- 40.Tarpila S, Samloff IM, Pikkarainen P, Vuoristo M, Ihamaki T. Endoscopic and clinical findings in first-degree relative of duodenal ulcer patients and control subjects. Scand J Gastroenterol. 1982;17:503–6. doi: 10.3109/00365528209182239. [DOI] [PubMed] [Google Scholar]
- 41.Hein HO, Suadicani P, Gyntelberg F. Genetic markers for peptic ulcer. A study of 3387 men aged 54–74 years: the Copenhagen Male Study. Scand J Gastroenterol. 1997;32:16–21. doi: 10.3109/00365529709025057. [DOI] [PubMed] [Google Scholar]
- 42.Odeigah PG. Influence of blood group and secretor genes on susceptibility to duodenal ulcer. East Afr Med J. 1990;67:487–500. [PubMed] [Google Scholar]
- 43.Rotter JI, Sones JQ, Samloff IM, et al. Duodenal-ulcer disease associated with elevated serum pepsinogen I. an inherited autosomal dominant disorder. N Engl J Med. 1979;300:63–6. doi: 10.1056/NEJM197901113000203. [DOI] [PubMed] [Google Scholar]
- 44.Kang JY, Doran T, Crampton R, McClenehan W, Piper DW. HLA antigens and peptic ulcer disease. Digestion. 1983;26:99–104. doi: 10.1159/000198874. [DOI] [PubMed] [Google Scholar]
- 45.Rotter JI, Rimoin DL, Gursky JM, Terasaki P, Sturdevant RA. HLA-B5 associated with duodenal ulcer. Gastroenterology. 1977;73:438–40. [PubMed] [Google Scholar]
- 46.Gough MJ, Rajah SM, Giles GR. HLA antigens in relationship to duodenal ulceration, gastric acid secretion and the clinical result following vagotomy. Br J Surg. 1982;69:105–7. doi: 10.1002/bjs.1800690216. [DOI] [PubMed] [Google Scholar]
- 47.Santtila S, Savinainen K, Hurme M. Presence of the IL-1RA allele 2 (IL1RN*2) is associated with enhanced IL-1beta production in vitro. Scand J Immunol. 1998;47:195–8. doi: 10.1046/j.1365-3083.1998.00300.x. [DOI] [PubMed] [Google Scholar]