Potential role of phosphodiesterase 7 in human T cell function: comparative effects of two phosphodiesterase inhibitors

Abstract

Even though the existence of phosphodiesterase (PDE) 7 in T cells has been proved, the lack of a selective PDE7 inhibitor has confounded an accurate assessment of PDE7 function in such cells. In order to elucidate the role of PDE7 in human T cell function, the effects of two PDE inhibitors on PDE7A activity, cytokine synthesis, proliferation and CD25 expression of human peripheral blood mononuclear cells (PBMC) were determined. Recombinant human PDE7A was obtained and subjected to cyclic AMP-hydrolysis assay. PBMC of Dermatophagoides farinae mite extract (Df)-sensitive donors were stimulated with the relevant antigen or an anti-CD3 monoclonal antibody (MoAb). PBMC produced IL-5 and proliferated in response to stimulation with Df, while stimulation with anti-CD3 MoAb induced CD25 expression and messenger RNA (mRNA) synthesis of IL-2, IL-4 and IL-5 in peripheral T cells. A PDE inhibitor, T-2585, which suppressed PDE4 isoenzyme with high potency (IC₅₀ = 0·00013 μm) and PDE7A with low potency (IC₅₀ = 1·7 μm) inhibited cytokine synthesis, proliferation and CD25 expression in the dose range at which the drug suppressed PDE7A activity. A potent selective inhibitor of PDE4 (IC₅₀ = 0·00031 μm), RP 73401, which did not effectively suppress PDE7A (IC₅₀ > 10 μm), inhibited the Df- and anti-CD3 MoAb-stimulated responses only weakly, even at 10 μm. PDE7 may play a critical role in the regulation of human T cell function, and thereby selective PDE7 inhibitors have the potential to be used to treat immunological and inflammatory disorders.

INTRODUCTION

Cyclic AMP (cAMP) has been recognized as an important second messenger regulating immune and inflammatory responses. Agents with the ability to elevate intracellular cAMP levels have been demonstrated to possess immonosuppressive and anti-inflammatory properties [1,2]. These effects are caused in part by the inhibition of various T cell functions including proliferation [3], cytokine production [4–6] and expression of activation markers on the cell surface [7].

One mechanism by which cAMP may be elevated within cells is by inhibition of phosphodiesterase (PDE). PDE comprises a family of enzymes, currently known to exist in at least 11 different isoenzyme forms which are characterized by a variety of properties, including their sensitivity to different inhibitors [8–12]. With regard to T cell function, the existence of three distinct cAMP-PDE isoenzymes, PDE3, 4 and 7, has been implicated [13–16]. However, earlier studies have not clarified the comparative roles of these isoenzymes in the degradation of intracellular cAMP in human T cells. PDE4 is one of the most convincing candidates for this role, as inhibition of various T cell functions by ‘so-called’ selective PDE4 inhibitors has been documented [14,16–19]. Nevertheless, several earlier studies are in apparent contradiction with the idea of a principle role for PDE4, as the potency of PDE4 inhibitors to suppress cytokine production and proliferation of human peripheral T cells was not correlated with their ability to suppress PDE4 activity [19–23]. Regarding PDE3, few reports support the contribution of PDE3 in the regulation of T cell function, and a lack of effect of various PDE3 inhibitors on T cell activation has been documented [16–19,22,23]. The existence of a rolipram-insensitive cAMP-PDE type enzyme in T cells was described first by Ichimura and Kase [13] and thereafter it was identified as PDE7A by Bloom and Beavo [24]. However, the role of PDE7 in T cell function is still unclear, as a selective PDE7 inhibitor had not been established.

We have generated a new PDE inhibitor, T-2585 (2-{4-2,3-bis(hydroxymethyl)-6,7-diethoxy-1-naphthalenyl}-2-pyridinyl]-4-(3-pyridinyl)-1(2H)-phthalazinone) [25]. This agent displays potent inhibitory activity against PDE4 (IC₅₀ = 0·00013 μm) and 14 000-fold greater selectivity compared with PDE3 [25]. Another PDE4 inhibitor, RP 73401 (3-cyclopentyloxy-N-(3,5-dichloro-4-pyridyl)-4-methoxybenzamide), has been evaluated to have similar potency of PDE4 suppression (IC₅₀ = 0·00031 μm) to T-2585 [25,26]. RP 73401 failed to suppress the activity of other PDE isoenzymes even at 10 μm[25–27].

In this study, we obtained an interesting result in that T-2585 suppressed PDE7A activity with an IC₅₀ of 1·7 μm, whereas RP 73401 suppressed it only weakly at 10 μm. This finding provides a useful insight into the significance of PDE7 in T cell function, since it is possible to predict the potential role of PDE7 by comparing the effects of the two PDE inhibitors. In this study, therefore, the effects of T-2585 and RP 73401 on various T cell functions were characterized using human peripheral blood mononuclear cells (PBMC).

MATERIALS AND METHODS

Materials

T-2585 and RP 73401 were synthesized by the Discovery Research Laboratory, Tanabe Seiyaku Co. (Osaka, Japan). Dermatophagoides farinae mite extract (Df; Torii Pharmaceutical Co., Tokyo, Japan), anti-CD3 monoclonal antibody (MoAb; Ortho, Raritan, NJ, USA), purified rat antimouse/human IL-5 monoclonal antibody (Pharmingen, San Diego, CA, USA), biotinylated rat antihuman IL-5 monoclonal antibody (Pharmingen), Cell Titer 96™ AQueous Non-Radioactive Cell Proliferation Assay kit (Promega, Madison, WI, USA), ISOGEN (Nippongene, Tokyo, Japan), murine Moloney leukaemia virus reverse transcriptase (Perkin-Elmer Cetus, Norwalk, CT, USA), GeneAmp® DNA polymerase (Perkin-Elmer Cetus), RT-PCR Amplimer Sets (Clontech, Palo Alto, CA, USA), fluorescein isocyanate (FITC)-labelled anti-CD25 antibody (Becton Dickinson, Franklin Lakes, NJ, USA), phycoerythrin (PE)-labelled anti-CD3 antibody (Becton Dickinson), Ficoll-Paque (Pharmacia, Uppsala, Sweden) and AIM-V medium (Gibco BRL, Gaithersburg, MD, USA) were used. All other reagents were obtained from Sigma (St Louis, MO, USA).

Expression of recombinant PDE7A protein

Recombinant human PDE7A was prepared as described previously [12]. The cDNA encoding human PDE7A (GeneBank accession no. Q13946) [28], amplified by polymerase chain reaction (PCR), was cloned in pFLAG expression vector (Amersham Pharmacia Biotech, Uppsala, Sweden). The correct sequence of the resulting construct, pFLAG-PDE7A, was verified by sequencing. The plasmid was transfected into COS-7 cells by LipofectAMINE 2000 (Gibco BRL) according to the manufacturer’s instructions. Forty-eight hours after transfection, cells were washed with ice-cold phosphate-buffered saline and scraped in ice-cold homogenization buffer (20 mm Tris-HCl, pH 7·4, 2 mm magnesium acetate, 0·3 mm CaCl₂, 1 mm dithiothreitol, 1·3 mm benzamidine and 1 mm NaN₃). The cell suspension was disrupted by a sonicator (TOMY Seiko, Tokyo, Japan) for 15 s (twice at 1-min intervals), and homogenates were centrifuged at 100 000 ×g for 60 min The resultant supernatant was collected and stored at 4°C until use. The protein concentration of the supernatant was determined by a DC protein assay kit (Bio-Rad, CA, USA) using bovine serum albumin as a standard.

Assay of cAMP-PDE activity

PDE activity was determined by a modification of the method of Thompson et al.[29]. The assay buffer contained 50 mm Tris-HCl, pH 8·0, 5 mm MgCl₂, 4 mm 2-mercaptoethanol, 0·33 mg/ml bovine serum albumin, 22 nm³H]cAMP and unlabelled cAMP. Reactions were started by adding 0·2–0·5 μl enzyme solution to 500 μl assay buffer, and incubated at 37°C for 30 min. After boiling for 90 s, the mixture was added to 100 μl of 1 mg/ml Crotalus atrox snake venom and incubated at 37°C for 30 min. Reactions were stopped by the addition of 500 μm methanol, and the resultant solutions were applied to Dowex (1 × 8–400) columns. Aqueous scintillation mixture was added to each eluate, and radioactivity was measured with a scintillation counter. In evaluation of the effects of PDE inhibitors, the agents examined were dissolved in dymethyl sulphoxide. Assays were performed in triplicate at three or four different concentrations, the mean of the determinations at each concentration was plotted, and IC₅₀ values were determined graphically.

Preparation of human PBMC

Adult male volunteers who were employees of Tanabe Seiyaku Co. were enlisted. All subjects gave written informed consent to the protocol as approved by the Company’s ethics committee. As a result of preliminary examination, we decided to enroll nine donors whose PBMC produced IL-5 and proliferated in response to Df antigen in this study. No subjects were receiving medication. Heparinized venous blood was taken between 9 and 10 a.m. PBMC were prepared by Ficoll-Paque density gradient centrifugation as described previously [20]. Cells were washed and suspended in AIM-V medium.

Cell cultures

PBMC suspended in AIM-V medium (2 × 10⁶/ml) were cultured in 24-well culture plates with or without Df for 6 days. In some experiments, PBMC were cultured with anti-CD3 MoAb (1 ng/ml) for the designated time periods. For cytokine assays, supernatants were harvested, and then frozen at – 70°C until used. Each test compound was added at the start of culture.

Quantification of IL-5 in culture supernatants

Concentration of IL-5 in the culture supernatant was measured by enzyme-immunoassay (EIA). Purified rat antimouse/human IL-5 MoAb and biotinylated rat antihuman IL-5 MoAb were used as the capture and detection antibodies, respectively. The range of detection of the assay system was 2 pg/ml to 10 ng/ml.

Cell proliferation assay

After PBMC (2 × 10⁵/well) were cultured for 6 days with Df and test compound in 96-well flat-bottomed culture plates, proliferation was assessed by the bioreduction of tetrazolium salt into formazan as previously described [30] with Cell Titer 96™ AQueous Non-Radioactive Cell Proliferation Assay kit according to the manufacturer’s manual. Briefly, 20 μl tetrazolium assay solution was added to 100 μl cell culture in each well. After incubation for 4 h at 37°C, the absorbance of each well at 515 nm was measured. Results were expressed as stimulation index, which was calculated as the ratio of the absorbance in stimulated culture to that in control culture.

Cytokine messenger RNA (mRNA)expression

Gene expression of IL-2, IL-4 and IL-5 was analysed by the reverse transcription-polymerase chain reaction (RT-PCR) method, as reported previously [31]. Briefly, RNA was extracted from the pelleted cells essentially following the one-step acid guanidinium isothiocyanate/phenol chloroform extraction method [32] using ISOGEN. cDNA was synthesized from 1 μg cytoplasmic RNA using random primers and murine Moloney leukaemia virus reverse transcriptase. PCR was performed using the following RT-PCR amplimer sets.

Il-2 5′-CATGCACTAAGTCTTGCACTTGTCA-3′

5′-CGTTGATATTGCTGATTAAGTCCCTG-3′

Il-4 5′-ATGGGTCTCACCTCCCAACTGCT-3′

5′-CGAACACTTTGAATATTTCTCTCTCAT-3′

Il-5 5′-GCTTCTGCATTTGAGTTTGCTAGCT-3′

5′-TGGCCGTCAATGTATTTCTTTATTAAG-3′

β-actin 5′-ATGGATGATGATATCGCCGCG-3′

5′CTAGAAGCATTTGCGGTGGAC GATGGGGGCC-3′

To 50 μl (final volume) amplification solution (50 mm KCl, 10 mm Tris-HCl (pH 8·3), 2 mm MgCl₂, 0·01% gelatin, 0·2 mm each deoxynucleotide triphosphate), 2 μl cDNA (corresponding to about 250 ng starting RNA material), 0·4 μm each primer, and 2 U GeneAmp® DNA polymerase were added. The mixture was heated at 95°C for 2 min, followed by 30 cycles, each consisting of incubation for 30 s at 95°C, 30 s at 60°C and 90 s at 73°C. The PCR products were analysed by 2% agarose gel electrophoresis in the presence of ethidium bromide. Expected sizes of PCR amplification products were 305, 456, 294, and 838 bp for IL-2, IL-4, IL-5 and β-actin, respectively.

Flow cytometric analysis of CD25 expression on cell surface of PBMC

After PBMC (2 × 10⁶/well) were cultured for 3 days with anti-CD3 MoAb (1 ng/ml), cells were harvested, washed and resuspended in staining buffer (PBS supplemented with 0·25% BSA and 0·1% NaN₃). After blocking with murine IgG for 1 h at 4°C, these cells were incubated with FITC-labelled anti-CD25 antibody or their control antibodies of appropriate isotype for 30 min at 4°C. In some experiments, cells were counter-stained with PE-labelled anti-CD3 antibody. After another two washes, cells were analysed using a FACScan® flow cytometer (Becton Dickinson, Mountain View, CA, USA). Dead cells were gated out by their forward and angle light scatter profile. Data were analysed using the CellQuest® program.

Statistics

All data are presented as mean or mean ± s.e. Statistical analysis was performed by paired or Student’s t-test for comparison between two groups and one-way anova with Bonferroni’s method for three groups or more. P < 0·05 was considered statistically significant.

RESULTS

Effects of PDE inhibitors on PDE7 activity

The first experiment was carried out to delineate the effects of T-2585 and RP 73401 on PDE7 activity, using purified recombinant human PDE7A. T-2585 inhibited PDE7A activity in a concentration-dependent manner (0·1–10 μm), and the IC₅₀ value of PDE7A inhibition by T-2585 was estimated to be 1·7 μm (Table 1). On the contrary, relatively weak suppression of PDE7A activity was obtained with the other PDE inhibitor, RP 73401, with maximum inhibition at 10 μm being only 35%.

Table 1.

 Effects of T-2585 and RP 73401 on PDE4 and 7 A activity

	IC50 (μm)
Isoenzyme	T-2585	RP 73401
PDE4*	0·00013	0·00031
PDE7A	1·7	>10

^*Recombinant human PDE7A was purified from pFLAG-PDE7A-transfected COS-7 cells and incubated in the presence of ³H]-cAMP with or without various concentrations of T-2585 or RP 73401. The radioactivity of hydrolysed ³H]-cAMP was then measured. IC₅₀ values were determined graphically from a concentration–inhibition curve.Data are cited from our previous report [25].

Effects of PDE inhibitors on IL-5 production by PBMC

The effects of T-2585 and RP 73401 on Df-induced IL-5 production by PBMC were determined. PBMC were incubated with Df, and the resulting supernatants were assayed for IL-5. IL-5 was produced spontaneously by PBMC of several individuals, while there was a significant increase in IL-5 production upon stimulation with Df, and the antigen-specific IL-5 production reached a maximum on day 6 (Fig. 1a). The optimal concentration of antigen was 1–10 μg/ml in most subjects. Other cytokines, IL-2 and IL-4, were hardly detected in the culture supernatants of PBMC incubated with or without antigen. T-2585 suppressed antigen-induced IL-5 production in a concentration-dependent manner (0·1–10 μm) (Fig. 1b). However, RP 73401 caused little inhibition of IL-5 production by PBMC even at 10 μm (22%). No concentrations of T-2585 or RP-73401 used in this study displayed cytotoxicity to PBMC (data not shown). We have previously demonstrated that IL-5 produced by PBMC is derived exclusively from CD4⁺ T cells [31], suggesting that T-2585 suppresses IL-5 production by CD4⁺ T cells.

Fig.1.

 Effects of T-2585 and RP 73401 on IL-5 production by human PBMC. PBMC (2 × 10⁶/ml) were incubated with or without Df (10 μg/ml) for 6 days. Various concentrations of T-2585 (•) or RP 73401 (□) were included throughout the culture period. The quantity of IL-5 in the culture supernatants was measured by EIA. Data from each individual subject (a) and the percentage inhibition of Df-induced IL-5 production by PBMC (b) are shown (n = 4–9). **P < 0·01 (paired t-test). #P < 0·05, compared with control cultures (Bonferroni’s method). ††P < 0·01, compared with RP 73401 (Student’s t-test).

Effects of PDE inhibitors on proliferation of PBMC

The effects of T-2585 and RP 73401 on another antigen-specific response of PBMC, proliferation, were examined next. As an antigen-specific proliferative response of PBMC was detected on day 2 and reached a maximum on day 6, proliferation was assessed on day 6. The stimulation index was highest at an antigen concentration of 10 μg/ml (2·1 ± 0·22, n = 6). As shown in Fig. 2, antigen-specific proliferation of PBMC was inhibited by T-2585 in a concentration-dependent manner. On the other hand, the maximum inhibition of PBMC proliferation obtained with 0·1–10 μm RP 73401 was only 20%. Almost 90% of the living cells present after 6 days of culture with Df antigen were determined to be CD4⁺ T cells by flow cytometric analysis (data not shown), suggesting that T-2585 inhibited the proliferation of CD4⁺ T cells.

Fig.2.

 Effects of T-2585 and RP 73401 on the proliferation of human PBMC. PBMC (2 × 10⁶/ml) were incubated with Df (10 μg/ml) in the presence or absence of T-2585 (•) or RP 73401 (□) for 6 days. The proliferation of PBMC was measured by a non-radioactive cell proliferation assay system. The percentage inhibition of Df-induced proliferation of PBMC is shown (n = 4). *P < 0·05, compared with control cultures (Bonferroni’s method). #P < 0·05, ##P < 0·01, compared with RP 73401 (Student’s t-test).

Effects of PDE inhibitors on cytokine mRNA expression in PBMC

The dose of T-2585 most effective at inhibiting proliferation (Fig. 2) was similar to that capable of inhibiting IL-5 production (Fig. 1), suggesting that the attenuation of IL-5 production by T-2585 was caused at least in part by the reduction in PBMC numbers. In order to evaluate whether T-2585 has a direct effect on cytokine synthesis, expression of cytokine mRNA in PBMC upon stimulation with anti-CD3 MoAb was examined. The CD3 molecule is associated with the T cell receptor, and the stimulation signal induced by anti-CD3 MoAb passes through this receptor. Anti-CD3 MoAb was therefore used to mimic the stimulus produced by a specific antigen. No obvious expression of any cytokine mRNA was obtained in unstimulated PBMC. Expression of IL-5 mRNA was induced in PBMC upon anti-CD3 MoAb (1 ng/ml) stimulation, and expression reached a maximum at 6 h (Fig. 3). Interestingly, mRNA for two other T cell cytokines, IL-2 and IL-4, was also expressed clearly upon anti-CD3 MoAb stimulation, even though neither cytokine was detected in the culture supernatant of PBMC stimulated with Df. IL-2 and IL-4 are T cell and/or B cell growth factors [33,34], and receptors for these two cytokines are expressed abundantly on the cell surface of PBMC, suggesting that both cytokines produced by peripheral T cells are quickly trapped by these receptors.

Fig. 3.

 Effects of T-2585 and RP 73401 on cytokine mRNA expression in human PBMC. PBMC (4 × 10⁶/ml) were incubated with anti-CD3 antibody (1 ng/ml) or PMA (20 nm) + ionomycin (1 μm) with or without T-2585 or RP 73401 for 6 h. Total RNA was then extracted, reverse transcribed and amplified by PCR. Lanes 1 and 5: no stimulation; 2–4: anti-CD3 antibody stimulation; 6–8: PMA + ionomycin stimulation; 3 and 7: + 10 μm T-2585; 4 and 8: + 10 μm RP 73401. This is one representative result from a total of three separate experiments.

As shown in Fig. 3, 10 μm T-2585 significantly diminished IL-2, IL-4 and IL-5 mRNA expression in anti-CD3 MoAb-stimulated PBMC. Suppression of mRNA expression of these cytokines by T-2585 was obtained even at 1 μm (data not shown). To confirm the specificity of the effect of T-2585, we next examined the possibility that T-2585 affects cytokine mRNA expression initiated by phorbol-ester and calcium ionophore. mRNA expression of IL-2, IL-4 and IL-5 was significantly up-regulated by stimulation with phorbol 12-myristate 13 acetate (PMA) + ionomycin. T-2585 (10 μm) did not, however, affect this PMA + ionomycin-induced cytokine mRNA expression at all (Fig. 3). Neither anti-CD3 MoAb- nor PMA + ionomycin-stimulated IL-2, IL-4 and IL-5 mRNA expression was affected by 10 μm RP 73401.

These findings suggest that T-2585 inhibits T cell receptor-mediated production of not only IL-5, but also IL-2 and IL-4 in human peripheral T cells at a point in the upstream signalling pathway leading to the regulation of gene transcription.

Effects of PDE inhibitors on CD25 expression of PBMC

We also examined the effects of T-2585 and RP 73401 on another T cell activation marker, CD25. CD25 is the IL-2 receptor α-chain and is expressed on the T cell surface membrane following cell activation. After PBMC had been stimulated with anti-CD3 MoAb, CD25 expression was determined by flow cytometry. CD25 was hardly expressed on the cell surface of unstimulated PBMC but its expression was clearly up-regulated by anti-CD3 MoAb (1 ng/ml) stimulation, reaching a maximum after 3 days of stimulation (21 ± 8·1% of PBMC, n = 3; Fig. 4a). As 60–70% of the CD25⁺ cells in PBMC were determined to be CD3⁺, (data not shown), the effect of the PDE inhibitors on CD25 expression was determined after the T cells in PBMC were gated by counter-staining with a PE-labelled CD3 antibody. As shown in Fig. 4b, T-2585 suppressed anti-CD3 MoAb-induced CD25 expression on human T cells in a concentration-dependent manner (0·1–10 μm). On the other hand, relatively weak inhibition of CD25 expression was obtained with RP 73401 (24–33%).

Fig.4.

 Effects of T-2585 and RP 73401 on CD25 expression of human T cells. PBMC (2 × 10⁶/ml) were incubated with anti-CD3 MoAb (1 ng/ml) with or without T-2585 (•) or RP 73401 (□) for 3 days. CD25 expression on PBMC was analysed by flow cytometry. (a) The histograms of PBMC correspond to representative experiments with (solid line) or without (bold line) stimulation. The dotted line indicates baseline fluorescence obtained with FITC-labelled control antibody. (b) Percentage inhibition of anti-CD3 MoAb-induced CD25 expression on CD3⁺ cells is shown (n = 3). *P < 0·05, compared with control cultures (Bonferroni’s method). #P < 0·05, compared with RP 73401 (paired t-test).

DISCUSSION

Our findings demonstrate that the PDE inhibitor, T-2585, acts on human peripheral T cells to suppress: IL-5 protein production; IL-2, IL-4 and IL-5 mRNA expression; cell proliferation; and CD25 expression in the dose range at which the drug inhibits PDE7A activity. However, another potent PDE inhibitor RP 73401, which does not inhibit PDE7A activity effectively (IC₅₀ = > 10 μm), suppressed only those T cell responses weakly at 10 μm. Since the IC₅₀ of RP73401 for PDE4 suppression is 0·00031 μm, this suggests that PDE7, but not PDE4, plays a substantial role in regulating human T cell function.

cAMP-elevating agents affect T cell function [1,4,35,36] and the inhibition of human cytokine production by such agents has been documented [5,6,20]. Prostaglandin E₂, forskolin and a cAMP-analogue, dibutyryl cAMP, have been shown to suppress IL-2, IL-4 and IL-5 production by T cell receptor-stimulated PBMC from atopic asthmatics [20]. The suppression of both CD25 expression and proliferation of human T cells by prostaglandin E₂ and other cAMP-affecting agents has also been reported [7,35,37,38]. In addition, several selective and nonselective PDE inhibitors suppress human T cell responses such as proliferation, mRNA expression and protein synthesis of cytokines [14,16–23]. We have reported previously that a PDE inhibitor that is structurally related to T-2585 inhibited cAMP-PDE activity in human PBMC and subsequently increased the level of intracellular cAMP [20]. Several groups have reported that cAMP suppresses Ca²⁺ release from intracellular stores [39,40]. Such suppression is mediated by the cAMP-activated protein kinase PKA acting on the signalling pathway downstream of the T cell receptor [40,41]. We demonstrated recently that prostaglandin E₂ suppresses both intracellular Ca²⁺ elevation and IL-5 production of human T cells stimulated by anti-CD3 MoAb [42]. This suggests that the suppression of T cell function by cAMP is caused, at least in part, by down-modulation of intracellular Ca²⁺ influx. This is consistent with the result that cytokine mRNA expression in PBMC induced by anti-CD3 MoAb, but not PMA + ionomycin, is suppressed by T-2585. Taken together, it is reasonable to propose that the inhibition of PDE7 activity by T-2585 results in the suppression of T cell function as a consequence of the increase in the level of intracellular cAMP.

Recently, Li et al. reported that PDE7 is induced in T cells upon stimulation with anti-CD3 and anti-CD28 antibody [43]. The significance of PDE7 for T cell function was implicated by the fact that a selective reduction in PDE7 expression by antisense oligonucleotide inhibits T cell proliferation. Our present findings support these findings and further demonstrate that PDE7 may modulate those T cell functions induced by stimulation with a specific antigen.

In apparent contradiction to our present findings, a number of earlier studies have demonstrated that PDE4 plays a role in the regulation of multiple T cell functions by using the selective PDE4 inhibitor, rolipram, which does not inhibit PDE7 activity [13,14,16–19]. However, in some reports, the effective dose of rolipram required to inhibit T cell activation was higher than that required to suppress PDE4 activity [21–23]. Interestingly, in our experiments, RP 73401 displayed very little suppression (10–30%) of most of the T cell functions examined (Figs 1–4) in the dose range at which the drug inhibits the activity of PDE4, but not PDE7A, completely (0·1–1 μm). Therefore, PDE4 may have a supplemental role in the regulation of the intracellular cAMP level in human T cells, and consequently in T cell function. It is possible that T-2585 inhibits the variety of T cell receptor initiated T cell functions via the combined effects on PDE4 and PDE7.

From our findings, a possible contribution of PDE3 inhibition to T-2585-mediated suppression of T cell function has not been completely ruled out, since the inhibitory potency of T-2585 on PDE3 activity isolated from guinea pig heart was similar to that on PDE7A activity [25]. Nevertheless, previous reports from at least three separate groups demonstrating that PDE3 inhibitors failed to affect cytokine mRNA expression and proliferation of human PBMC [16–19,22,23] rule against a critical role for PDE3 in T cell function. We also confirmed by preliminary experiments that IL-5 production was not inhibited by CI-930, a PDE3 inhibitor, in our experimental system (data not shown). In order to elucidate additional details of the comparative roles of PDE7 and other PDE isoenzymes in T cell function, it will be necessary to delineate the effects of currently existing PDE inhibitors on PDE7 activity in human T cells. Most importantly, the generation of a selective PDE7 inhibitor will be eagerly awaited.

It is significant that T-2585 but not RP 73401 effectively suppressed IL-5 production by PBMC because accumulating evidence suggests that IL-5 is the key cytokine involved in allergic diseases, such as asthma and atopic dermatitis, associated with eosinophilic inflammation. IL-5 is a lymphokine produced primarily by activated T cells and it enhances the proliferation, differentiation and survival of eosinophils [44,45]. Activated T cells expressing IL-5 mRNA were found in increased numbers in the bronchial mucosa of asthmatic patients [46] and the numbers were further increased upon antigen challenge [47]. Administration of an anti-IL-5 neutralizing antibody abrogated allergic eosinophilic inflammation in experimental allergic models [48–50]. Our present findings suggest that selective inhibitors for PDE7, but not PDE4, are promising drugs for the management of chronic allergic disorders. Furthermore, PDE7 inhibitors able to down-regulate total T cell function have the potential for treating a wide range of diseases associated with an abnormal T cell response.

In conclusion, PDE7 has the potential to regulate human T cell functions including cytokine production, proliferation and expression of activation markers. This suggests the possible management of various immunological diseases by treatment with selective PDE7 inhibitors.