Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2007 Apr 13;73(11):3595–3604. doi: 10.1128/AEM.02083-06

Functional Analysis of d-Alanylation of Lipoteichoic Acid in the Probiotic Strain Lactobacillus rhamnosus GG

Mónica Perea Vélez 1, Tine L A Verhoeven 1, Christian Draing 2, Sonja Von Aulock 2, Markus Pfitzenmaier 3, Armin Geyer 3, Ivo Lambrichts 4, Corinne Grangette 5, Bruno Pot 5, Jos Vanderleyden 1, Sigrid C J De Keersmaecker 1,*
PMCID: PMC1932685  PMID: 17434999

Abstract

Lipoteichoic acid (LTA) is a macroamphiphile molecule which performs several functions in gram-positive bacteria, such as maintenance of cell wall homeostasis. d-Alanylation of LTA requires the proteins encoded by the dlt operon, and this process is directly related to the charge properties of this polymer strongly contributing to its function. The insertional inactivation of dltD of the probiotic strain Lactobacillus rhamnosus GG (ATCC 53103) resulted in the complete absence of d-alanyl esters in the LTA as confirmed by nuclear magnetic resonance analysis. This was reflected in modifications of the bacterial cell surface properties. The dltD strain showed 2.4-fold-increased cell length, a low survival capacity in response to gastric juice challenge, an increased sensitivity to human beta-defensin-2, an increased rate of autolysis, an increased capacity to initiate growth in the presence of an anionic detergent, and a decreased capacity to initiate growth in the presence of cationic peptides compared to wild-type results. However, in vitro experiments revealed no major differences for adhesion to human intestinal epithelial cells, biofilm formation, and immunomodulation. These properties are considered to be important for probiotics. The role of the dlt operon in lactobacilli is discussed in view of these results.


The cell wall of gram-positive bacteria constitutes a protective barrier essential for survival, shape, and integrity. Proteins and teichoic acids (TAs) composed of wall teichoic acid (WTA) and/or lipoteichoic acid (LTA) are associated with this peptidoglycan-containing wall (33, 40). WTA is covalently linked to the peptidoglycan, whereas LTA is a macroamphiphile molecule with its glycolipid moiety anchored to the membrane and its polyglycerophosphate (Gro-P) chain extending into the wall (40). Together, TAs are the most abundant polyanions of gram-positive bacteria and represent up to 50% of the cell wall dry weight (24). Glycosyl substitutions in WTA and d-alanyl ester (d-Ala ester) substitutions in LTA are directly related to the charge properties of these polymers and strongly contribute to their function, as evidenced by the phenotypes of strains with genetic changes altering the glycosyl substitution and d-alanylation process (17, 33, 45, 57).

The d-Ala ester substitution of LTA requires four proteins encoded by the dlt operon. Two of these proteins are the d-alanyl carrier protein ligase (Dcl, encoded by dltA), which activates d-alanine by use of ATP, and the d-alanyl carrier protein (Dcp), which is encoded by dltC. DltB is a putative transmembrane protein predicted to be involved in the passage of the activated d-alanyl-Dcp complex across the glycerol phosphate backbone of LTA. Finally, the DltD membrane protein facilitates the binding of Dcp for ligation with d-Ala and additionally has thioesterase activity for removing mischarged d-alanyl carrier proteins (13, 40). Inactivation of genes within this operon in various gram-positive bacteria results in the decrease or complete absence of d-Ala esters from LTA (1, 18, 35, 46, 47). d-Ala-deficient mutants are found to exhibit a variety of phenotypic changes that could be attributed to the resulting charge modification of their cell surface. For instance, alterations of cell morphology associated with defects in septum formation (9, 41, 45), variations in modulation of the activity of autolysins (6, 19, 55, 58), differences in cation binding to the cell envelope required for enzyme function (33), alterations of the electromechanical properties of the cell wall (40), altered resistance to antimicrobial cationic peptides (8, 40), modified adhesion, epithelial cell invasion, and virulence (1, 35), effects on biofilm formation (7, 18, 23), and alterations in immune response (14, 22, 38, 39, 51) have been reported. While it is apparent that the d-Ala esters of LTA play an essential role in the physiology and properties of the cell surface of gram-positive bacteria, the genotype-phenotype relation of the dlt operon is complex and appears to be species dependent.

By construction of a dltD knockout mutant, this study aimed to determine first the role of the dltD gene in the d-alanylation of the LTA in the probiotic strain Lactobacillus rhamnosus GG. Probiotic bacteria are defined as “live microorganisms which, when administered in adequate amounts, confer a health benefit on the host” (20). L. rhamnosus GG is a well-studied probiotic strain (4, 21). For this reason, the second aim of this study was to investigate the role of the d-alanylation of the L. rhamnosus GG LTA in some morphological, membrane charge property, and probiotic characteristics, such as adherence to human intestinal epithelial cells, biofilm formation, resistance to gastric juice challenge, and immunomodulation of human intestinal epithelial cells and peripheral blood mononuclear cells.

MATERIALS AND METHODS

Bacterial strains, plasmids, media, and growth conditions.

The bacterial strains and plasmids used in this study are listed in Table 1. L. rhamnosus GG was routinely grown in nonshaken MRS medium (Difco) at 37°C. Escherichia coli cells were grown in Luria-Bertani (LB) medium with aeration at 37°C. When required, antibiotics were used at the following concentrations: 10 μg/ml tetracycline, 100 μg/ml ampicillin, and 5 μg/ml (L. rhamnosus GG) or 100 μg/ml (E. coli) erythromycin.

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid Relevant genotype or description Source or reference
Strains
    E. coli
        DH5α F φ80dlacZΔM15 Δ(lacZYA-argF)U169 deoR recA1 endA1 hsdR17(rK mK) supE44 λthi-1 gyrA96 relA1 Gibco-BRL
    S. enterica serovar Typhimurium
        SL1344 xyl hisG rpsL; virulent; Smr 26
    L. rhamnosus GG
        Wild type Human isolate ATCC 53103 (54)
        CMPG5540 dltD knockout mutant of L. rhamnosus GG; dltD::tetR This study
        CMPG5541 CMPG5540 complemented by pCMPG5227 This study
Plasmids
    pCRII-TOPO Cloning vector, ampicillin and kanamycin resistance Invitrogen
    pFAJ5301 Cloning vector, pUC18 derivative, erythromycin resistance Unpublished results
    pLAB1301 E. coli-Lactobacillus shuttle vector, ampicillin and erythromycin resistance 28
    pMD5057 Tetracycline resistance plasmid from Lactobacillus plantarum 5057 11
    pCMPG5221 pCRII-TOPO vector containing the 2,682-bp dltD gene and flanking regions from L. rhamnosus GG (Pro-230 and Pro-231) This study
    pCMPG5222 pFAJ5301 containing an HindIII-EcoRV fragment (dltD gene and flanking regions) This study
    pCMPG5223 Suicide vector to knock out the L. rhamnosus GG dltD gene through insertion of tetR gene from pMD5057 in the BbsI-NcoI site This study
    pCMPG5226 pCMPG5901 containing the functional dltD gene driven by the L. rhamnosus GG ldhL promoter This study
    pCMPG5227 PLAB1301 containing the functional dltD gene driven by the ldhL promoter This study
    pCMPG5901 PCRII-TOPO vector containing the ldhL promoter (176 bp) from L. rhamnosus GG amplified using primers Pro-127 and Pro-128 Unpublished results

DNA manipulations.

Routine molecular biology techniques were employed as described before (49). Primer sequences used in this study are listed in Table 2 (Eurogentec). Enzymes for molecular biology were purchased from New England Biolabs and used according to the instructions of the suppliers. Plasmid DNA from E. coli was prepared using QIAGEN Miniprep kits. Chromosomal DNA from L. rhamnosus GG was isolated as previously described (15).

TABLE 2.

Primer sequences used in this study

Bacterial primer Sequence (5′ to 3′)a
Pro-128 (NdeI) GTCATATGGATATCATCCTTTCTTATGTGCATGC
Pro-127 (SacI) CTGAGCTCCTTGTCACAGGATTCACAAGTCTTGC
Pro-221 (EcoRI) GAATTCGAGATTCCTTTACAAATATGCTCTTAC
Pro-222 (EcoRI) CGAATTCGTTCGGAATAGGTTATACTAGACAAAAG
Pro-230 GCCGGTTACAGTTTGTTCGCGG
Pro-231 ACAGGAGGCACAACATGGCAAAATC
Pro-261 TCCATGTCGGCCAACGTGCT
Pro-262 ATTGGCTTCCCGCCATTCCC
Pro-443 TCAAGTTTGTTAAGATGGAT
Pro-444 GGATAATTTTCCTGCTTGAA
Pro-445 TTTGTCGAAATTGCGTTACT
Pro-446 TCGAAACACCGATGAACTTT
a

Underlined sequences represent restriction sites indicated parenthetically.

Construction and analysis of the L. rhamnosus GG dltD mutant (CMPG5540).

The complete genome sequence of the dlt operon of Lactobacillus rhamnosus ATCC 7469 is published in the NCBI database under accession number AF192553 (13). Based on this sequence, a fragment of 2,682 bp containing the L. rhamnosus GG dltD gene and its 779-bp upstream and 635-bp downstream regions was amplified using primers Pro-230 and Pro-231 and cloned in pCRII-TOPO, yielding pCMPG5221. Subsequently, the dltD gene with its flanking regions was subcloned as a HindIII-EcoRV fragment in pFAJ5301, resulting in pCMPG5222. To inactivate the dltD gene, a BbsI-NcoI fragment from pCMPG5522 was replaced by the tetracycline resistance cassette tet(M) previously amplified from plasmid pMD5057 of L. plantarum 5057 (11) by use of primers Pro-221 and Pro-222. The resulting suicide vector, pCMPG5223, was electroporated into L. rhamnosus GG (15). Transformants were selected for resistance to 10 μg/ml of tetracycline. Confirmation of DNA recombination was performed by PCR using primers Pro-261 and Pro-231 and Southern hybridization using a dltD probe synthesized with primers Pro-261 and Pro-262. The dltD mutant was designated CMPG5540 and was further analyzed.

Complementation of the knockout dltD mutant.

For the construction of the complemented strain, the functional dltD gene was cloned under the control of the L. rhamnosus GG ldhL promoter in pCMPG5901, yielding pCMPG5226. Subsequently, an EclII136-NotI fragment containing the functional dltD gene and the ldhL promoter was subcloned into pLAB1301 (28). This construct was designated pCMPG5227 and introduced in CMPG5540 by electroporation as previously described (15). Transformants were selected for resistance to 10 μg/ml of tetracycline and to 5 μg/ml of erythromycin. The complemented strain, CMPG5541, was confirmed by PCR using primers Pro-127, Pro-262, and Pro-261 and included in all assays performed.

Cloning and analysis of the L. rhamnosus GG dlt operon.

Concomitantly, in order to sequence the additional genes within the dlt operon of L. rhamnosus GG, primers Pro-443, Pro-444, Pro-445, and Pro-446 were designed after selection on the DNA sequence of the dlt operon of L. rhamnosus ATCC 7469. The PCRs were carried out with Pfx (Invitrogen), a DNA polymerase with proofreading activity. The PCR fragments were cloned in pCRII-TOPO and sequenced by the chain termination dideoxynucleoside triphosphate method (50) with a BigDye Terminator V3.1 cycle sequencing kit, using an ABI PRISM 3100-Avant genetic analyzer (Applied Biosystems, Lennik, Belgium). Databases were screened for similarities by using BLAST (2, 3), and alignment of overlapping fragments was performed with Vector NTI Advance 10 ContigExpress software (Informax, Oxford, United Kingdom).

LTA purification.

For the LTA isolation, 11.83 g of lyophilized L. rhamnosus GG cells and 22.12 g of the dltD mutant (CMPG5540) cells were extracted using butanol and hydrophobic interaction chromatography as previously described (38), with minor modifications. Briefly, bacterial cells were disrupted for 15 min by sonication and resuspended in 50 ml of 0.1 M citrate buffer (pH 4.7). The bacterial lysate was mixed while being stirred with an equal volume of n-butanol (Merck, Darmstadt, Germany) for 20 min at room temperature. The suspension was then centrifuged at 8,300 × g for 40 min, resulting in a two-phase system. The lower aqueous phase was lyophilized and subsequently resuspended in 35 ml of chromatography start buffer (15% n-propanol in 0.1 M ammonium acetate; pH 4.7) followed by 60 min of centrifugation at 26,900 × g and sterilization by filtration (0.2 μm). The supernatant was subjected to hydrophobic interaction chromatography on an octyl-Sepharose column (2.5 by 11 cm) using a linear gradient of from 15% to 60% n-propanol in 0.1 M ammonium acetate (pH 4.7). LTA-containing fractions were identified by their phosphate content based on the formation of phosphomolybdenum blue from phosphate (52). The endotoxin contamination of the LTA preparations was assessed by the kinetic Limulus amoebocyte lysate assay (Charles River, Charleston, SC).

LTA structure analysis by NMR spectroscopy.

Nuclear magnetic resonance (NMR) spectra of the LTA samples were determined with a Bruker Avance 600 MHz spectrometer with a 5-mm probe at 300 K. Spectra were obtained using D2O solutions and 3-(trimethylsilyl)3,3,2,2-tetradeuteropropionic acid sodium salt (d4-TSPA) as an internal standard for 1H NMR (δH, 0.00 ppm) and acetone for chemical shifts of 13C (δC, 30.02 ppm). Assignments were taken from two-dimensional homonuclear double-quantum-filtered correlation spectroscopy, total correlated spectroscopy, and rotational nuclear Overhauser effect spectroscopy experiments using a water suppression technique and two-dimensional heteronuclear single-quantum correlation (1H to 13C) spectra. In the total correlated spectroscopy experiments the mixing times were 100 ms, and the rotational nuclear Overhauser effect spectroscopy experiments were performed with 200 ms of spinlock time. Data acquisition and processing were done using standard Bruker software. The average number of repeating units in the polyglycerophosphate backbone, the percentage of substitution, and the chain length of the fatty acids in the membrane anchor were calculated directly from the integrals of the proton spectra.

Transmission electron microscopy.

Bacteria were grown overnight (16 h at 37°C). Uncoated grids were used as a probe to adsorb bacterial cells. The grids were placed on a drop of bacterial suspension for 15 s, incubated in 0.25% phosphotungstenic acid (pH = 7) for 30 s, and washed three times, and excess liquid was drained. The bacteria were observed with a Philips EM 208S transmission electron microscope at 80 kV. Images were digitalized using an SIS image analysis system.

Analysis of autolysis.

Triton X-100 was used to study induced autolysis under nongrowing conditions as previously described (48), with minor modifications. Briefly, cells were grown overnight, harvested by centrifugation (4,000 × g for 20 min at 4°C), washed three times with equal volumes of phosphate buffer (pH 6.5; 10 mM), and resuspended (optical density at 600 nm [OD600] of ∼1.6) in phosphate buffer (pH 6.5; 200 mM) containing 0.05% (vol/vol) Triton X-100. The cell suspension was incubated at 37°C under agitation, and autolysis was monitored by examining the decrease of OD600 in time.

Growth in the presence of the cationic peptides nisin and polymyxin B.

Nisin and polymyxin B were purchased from Sigma-Aldrich. Overnight cultures containing about 108 to 109 CFU/ml of L. rhamnosus GG wild-type, dltD mutant, and complemented strain cells were diluted 15,000-fold in MRS medium containing either nisin at a concentration between 0.2 and 2.5 μg/ml or polymyxin B at a concentration between 8 and 1,000 μg/ml. Bacteria were grown at 37°C with continuous shaking in order to avoid cell aggregation, and the OD600 was measured automatically each 30 min during at least 80 h using a Bioscreen C instrument (Labsystems Ltd. Oy). Concomitantly, growth of L. rhamnosus GG, the dltD mutant, and the complemented strain in the presence of an anionic detergent (sodium dodecyl sulfate [SDS] at 0.01% and 0.015%) was assessed. Each run was performed at least in triplicate.

Human beta-defensin sensitivity assay.

L. rhamnosus GG wild-type and dltD mutant cells were tested for their sensitivity to 3 μg/ml human beta-defensin 1 (hBD1) and hBD2. After 3 h of incubation at 37°C, bacterial viability was measured by plating serial dilutions on MRS agar as previously described (15). The experiment was performed in triplicate.

Survival in simulated gastric juice.

Simulated gastric juice was prepared and survival tests were performed as previously described (10). The percentages of survival were calculated by comparing the cell numbers before and after addition to simulated gastric juice at 0, 30, 60, and 90 min. The experiment was performed in triplicate.

In vitro adhesion assay to Caco-2 and HT-29 human intestinal epithelial cell lines.

Caco-2 and HT-29 cells were purchased from ATCC (Rockville, MD). Cells were routinely grown in 75-cm2 culture flasks under conditions of 37°C, 5% CO2, and 90% relative humidity. For both cell lines, Dulbecco modified Eagle medium (DMEM)/F-12 (GibcoBRL) (1:1) supplemented with 10% fetal bovine serum (FBS; HyClone) but without antibiotics was used as the culture medium. Cells were passaged every 3 days (at 70 to 80% confluence) at a split ratio of 1 to 7. For adhesion experiments, epithelial cells were plated at a density of 40,000 cells/cm2 in 12-well plates (Cellstar). Confluence was reached within 3 to 4 days after seeding, and monolayers were used for the experiments 15 days after seeding. Adherence of L. rhamnosus GG wild-type, dltD mutant, and complemented strain cells to the epithelial cells was examined by adding 1.5 ml of DMEM containing 109 CFU/ml. After incubation at 37°C for 45 min, epithelial cells were washed two times with prewarmed phosphate-buffered saline (PBS). Subsequently, 100 μl of 1× trypsin-EDTA (Invitrogen) was added to each well and incubated for 10 min at 37°C. Finally, 900 μl of PBS was added and mixed, and serial dilutions were plated out. Plates were incubated at 37°C for 72 h. Adhesion of L. rhamnosus GG wild-type, dltD mutant, and complemented strain cells was tested in triplicate in three independent experiments.

In vitro biofilm assay.

In vitro biofilm formation was determined as previously described (16, 36), with minor modifications. Briefly, biofilm formation was assayed on polystyrene pegs hanging into microtiter plate wells. The pegs were placed in wells containing a bacterial concentration of 3 × 107 CFU in 200 μl AOAC medium (Difco) (36) and incubated in anaerobic jars for 72 h at 37°C. Medium was changed every day. Wells containing sterile AOAC medium and L. rhamnosus GG wild-type cells were included as negative and positive controls, respectively. Each experiment was performed in triplicate.

Immunomodulation of HT-29 cell line.

HT-29 cells were maintained as described above. L. rhamnosus GG wild-type and dltD mutant cells were grown overnight, centrifuged at 4,000 × g and 4°C for 20 min, and washed with cold PBS. Immunomodulation of HT-29 cells was examined by adding 1.5 ml of DMEM without FBS containing 5 × 106 CFU/ml of either L. rhamnosus GG wild-type or dltD mutant cells. Salmonella enterica serovar Typhimurium SL1344 cells in a concentration of 5 × 106 CFU/ml and interleukin-1 beta (IL-1β) (Sigma-Aldrich) (10 ng/ml) were used as positive controls, and DMEM without FBS was used as a negative control. After incubation at 37°C for 3.5 h (5% CO2 and 90% humidity), epithelial cells were washed two times with prewarmed PBS. Subsequently, 200 μl of PBS was added to each well and RNA extraction was performed by using a High Pure RNA isolation kit (Roche Molecular Biochemicals) and following the manufacturer's instructions. After isolation, RNA integrity was analyzed using an Agilent RNA 600 kit and 2100 bioanalyzer expert software. Cytokine gene expression was determined by real-time reverse transcriptase PCR using primers and probes as previously described (43).

Cytokine induction in peripheral blood mononuclear cells (PBMC).

Cytokine induction using a 24-h culture of bacterial cells, and using Streptococcus gordonii LMG17843 and E. coli TG1 cells as internal controls, was performed as previously described (22).

Nucleotide sequence accession number.

The dlt sequence of L. rhamnosus GG has been deposited in the NCBI database under GenBank accession number DQ906101.

RESULTS

Analysis of the dlt operon of L. rhamnosus GG.

Since the genome sequence of L. rhamnosus GG is unavailable, a homology strategy based on the dlt sequence of L. rhamnosus ATCC 7469 (AF192553) (13) was used to isolate the dlt genes within the dlt operon of L. rhamnosus GG cells. Based on this strategy, a continuous 5.8-kb sequence of L. rhamnosus GG genomic DNA was determined. The analysis of the sequence revealed four open reading frames (dltA, dltB, dltC, and dltD), as depicted in Fig. 1. Additionally, the in silico-translated protein sequences encoded by the L. rhamnosus GG dlt operon, i.e., those corresponding to DltA protein (506 amino acids [aa]), DltB protein (405 aa), DltC protein (81 aa), and DltD protein (423 aa), were used for screening databases using BLAST (2, 3). Homologies of these L. rhamnosus GG Dlt protein sequences to the Dlt protein sequences of L. rhamnosus ATCC 7469 and L. plantarum WCFS1 are summarized in Table 3.

FIG. 1.

FIG. 1.

Genetic organization of the L. rhamnosus GG dlt operon. A schematic representation of the dlt operon (∼5.8 kb) of L. rhamnosus GG as revealed by sequencing and BLAST analysis is presented. Open reading frames corresponding to dltA, dltB, dltC, and dltD are indicated with arrows. The putative promoter region (5′ end), represented in the figure by a flag, contains a −10 “TATTAA” region and a −35 “TGGTTT” region separated by 19 bp. The potential ribosome binding site “GGGGG” is located 8 bp upstream of the putative ATG start codon of dltA (not shown). A second potential ribosomal binding site, “AAAGAGG,” was found 9 bp upstream of the putative start codon of the dltC gene (not shown). dltB overlaps the stop codon of dltA by 1 bp, and dltD overlaps the stop codon of dltC by 4 bp. dltC and dltB are separated by a 69-bp intergenic region. The 3′ end of the operon reveals a putative terminator 99 bp downstream of the dltD stop codon, represented in the figure by a stem-loop. It is a 12-bp inverted repeat followed by a series of T residues (TTTATTTT).

TABLE 3.

Homology analysis of the translated L. rhamnosus GG Dlt proteins

Strain % Homology (GenBank accession no.)
Reference
DltA DltB DltC DltD
L. rhamnosus ATCC 7469 99 (AAF09201) 95 (AAF09202) 100 (AAF09203) 99 (AAF09204) 12
L. plantarum WCFS1 62 (NP_785546) 64 (NP_785546) 64 (NP_785544) 51 (NP_785543) 30

Finally, the dltD gene of L. rhamnosus GG which encodes a putative protein of 423 aa with a theoretical mass and pI of 47.987 kDa and 9.57, respectively, was successfully knocked out by the insertion of the tetracycline cassette from L. plantarum 5057. The correct insertion was confirmed by PCR and Southern hybridization as described in Materials and Methods (data not shown).

LTA purification and structure analysis.

After purification, different LTA-containing fractions were identified. For L. rhamnosus GG wild-type cells (Fig. 2A), fractions 41 to 49 were pooled, resulting in 14.81 mg LTA. For the dltD mutant cells (Fig. 2B), the phosphate determination revealed fractions 41 to 46 (represented by peak 1) and fractions 48 to 88 (represented by peak 2) with 9.56 mg LTA in peak 1 and 9.26 mg LTA in peak 2, respectively. Endotoxin contamination of all LTA extractions showed lipopolysaccharide contamination below 0.6 endotoxin units/mg LTA, i.e., less than 60 pg lipopolysaccharide per mg LTA.

FIG. 2.

FIG. 2.

LTA elution profiles and phosphate content of L. rhamnosus GG wild-type and mutant cells. The phosphate determination of the LTA fractions from L. rhamnosus GG wild-type (A) and dltD mutant (B) cells is plotted together with the correspondent propanol gradient of the fast protein liquid chromatography.

The molecular structure determined by NMR spectroscopy revealed that LTA from L. rhamnosus GG wild-type cells is constituted of Gro-P with d-alanyl esters as unique detectable substituents (74% d-Ala:Gro-P). LTA from the L. rhamnosus GG wild type is formed by average chains of 50 glycerophosphate residues (Fig. 3). For the dltD mutant, two fractions were eluted from the chromatography column as previously mentioned. The major peak (fractions 41 to 46) and the second peak (fractions 48 to 55) contain LTA molecules with average lengths of only 29 and 7 glycerophosphate residues, respectively. d-Alanyl ester substitution in the dltD mutant was completely abolished in both peaks. The analysis of the glycolipic moiety in the wild type reveals an average fatty acid chain of C14, with one double bond per fatty acid (two double bonds in every membrane anchor). The fatty acid chain in the dltD mutant was on average two carbon atoms longer (C16) in comparison to that seen in the parental strain. Likewise, as in the wild type, in the dltD mutant one double bond per fatty acid was present (data not shown).

FIG. 3.

FIG. 3.

Schematic representation of the structure of the LTA from the L. rhamnosus GG wild type determined from NMR spectroscopy analysis. The average number of repeating units in the polyglycerophosphate backbone, the average percentage of substitution, and the average chain length of the fatty acids in the membrane anchor were calculated directly from the integrals of the proton spectra. R1 and R2, fatty acid chains. d-Ala ester substitution of the wild type (R = D-Ala, OH) is replaced by OH groups in the dltD mutant.

Increase in cell length and defects in septum formation assessed by transmission electron microscopy.

Comparison of transmission electron micrographs of the L. rhamnosus GG wild-type and dltD mutant cells showed an increase in the length of the mutant of about 2.4-fold in comparison to the parental strain results (Fig. 4A). Additionally, morphological alterations at the level of the septum and defective cell separation in the dltD mutant were observed (Fig. 4B).

FIG. 4.

FIG. 4.

Effect of d-alanylation on cell length and septum formation. (A) Ultrastructural analysis of the cell morphology of L. rhamnosus GG wild-type and dltD mutant cells grown overnight in MRS medium and visualized with transmission electron microscopy at 80 kV. The cell length of the complemented strain was restored to wild-type values. (B) Defect in septum morphology. The arrow shows the altered cell wall around the septum in the dltD mutant.

Analysis of autolysis.

As shown in Fig. 5, the dltD mutant lyses to a greater extent than the parental strain. An OD600 decrease of 0.2 units for the dltD mutant corresponding to ∼108 CFU/ml was observed during the first hour of incubation in comparison to the OD600 value obtained for the wild type.

FIG. 5.

FIG. 5.

Effects of the mutation of the dltD gene on autolysis. Autolysis of the L. rhamnosus GG wild type (squares) and the dltD mutant (CMPG5540) (circles) was followed in time by incubation of the cells with a lysis inducer (Triton X-100). The values reported in the experiment did not differ by more than 5%. Therefore, single datum points are presented in the figure without standard deviation bars. OD600 values comparable to wild-type values were obtained for the complemented strain (CMPG5541).

Effects of the cationic peptides nisin and polymyxin B and the anionic detergent SDS on the growth of L. rhamnosus GG wild-type and dltD mutant cells.

The capacity of L. rhamnosus GG and the dltD mutant cells to grow in medium supplemented with the cationic peptides nisin and polymyxin B was evaluated. In general, a minimum of ∼10 h of lag-phase retardation was observed for the mutant grown in the presence of nisin at different concentrations compared to the wild-type results. However, the final cell densities reached were similar for the two strains (Fig. 6). For polymyxin B, the dltD mutant was found to have ∼10 h of lag-phase retardation even with a concentration of polymyxin B 100 times lower than that used for the wild type. Again, no differences were observed regarding final cell density (data not shown). Additionally, the ability of L. rhamnosus GG and the dltD mutant to grow in medium containing low concentrations of a strong anionic detergent (SDS) was evaluated. In this case, the dltD mutant was shown to be less affected by the action of SDS than the parental strain, reaching a higher optical density in the stationary phase (Fig. 7). The sensitivity of the dltD mutant to the tested cationic peptides and SDS was restored to wild-type levels when the mutant was complemented with the dltD gene (data not shown).

FIG. 6.

FIG. 6.

Effect of the cationic peptide nisin on the growth of L. rhamnosus GG wild-type and dltD mutant cells. No differences in growth in MRS medium between the L. rhamnosus GG wild type and the dltD mutant were observed. Therefore, average growth values for both strains are represented by squares (control). Values obtained for the growth of the L. rhamnosus GG wild type (triangles) versus that of the dltD mutant (CMPG5540) (circles) in medium containing 1.5 μg/ml nisin represent the average results of three independent runs.

FIG. 7.

FIG. 7.

Effect of SDS on the growth of the L. rhamnosus GG wild type and the dltD mutant. Values obtained for the growth of the L. rhamnosus GG wild type (cross and lines) versus that of the dltD mutant (CMPG5540) (triangles and squares) in medium containing either 0.01% or 0.015% SDS represent the average results of three independent runs.

Sensitivity of L. rhamnosus GG wild type and dltD mutant cells to human beta-defensins.

We investigated the effect of hBD1 and hBD2 on L. rhamnosus GG wild-type and dltD mutant cells (Fig. 8). While hBD1 showed no effect on L. rhamnosus GG wild-type or dltD mutant cells after 3 h of incubation, the cells were sensitive to hBD2. The dltD mutant was on average ∼50% more sensitive to cationic hBD2 than the parental strain (Fig. 8).

FIG. 8.

FIG. 8.

Sensitivity of the L. rhamnosus GG wild type (wt) and the dltD mutant to human beta-defensins. Bacterial viability of L. rhamnosus GG wild-type and dltD mutant cells after 3 h of contact with 3 μg/ml hBD1 (stippled white bars) or hBD2 (stippled gray bars) was determined by plate counting. The values represent percentages of survival of the initial numbers of L. rhamnosus cells. No human beta-defensins were added to the controls (black bars). The error bars indicate standard deviations of the results of three independent measurements.

Survival in simulated gastric juice.

The dltD mutant showed a strong reduction in the capacity to survive the in vitro gastric juice challenge, resulting in complete loss of viability after 30 min of incubation (Fig. 9). Additionally, the capacity to initiate growth under conditions of low pH (3.5, 4.0, and 4.5) was evaluated. Results confirmed that the acid tolerance of the dltD mutant was strongly diminished compared to that of the wild type (data not shown).

FIG. 9.

FIG. 9.

Comparison of survival of L. rhamnosus GG wild-type (wt) and dltD mutant cells in simulated gastric juice. Percentages of survival of L. rhamnosus GG (triangles) compared to the dltD mutant (CMPG5540) (squares) were calculated by comparing the cell numbers before and after addition to simulated gastric juice at 30-min intervals. Recovery of acid tolerance was restored to wild-type values in the complemented strain.

In vitro adhesion to Caco-2 and HT-29 human intestinal epithelial cell lines and biofilm formation.

No significant differences in adhesion to human intestinal epithelial cells (Fig. 10) and capacity to form biofilm in vitro were observed between the wild type and the dltD mutant (data not shown).

FIG. 10.

FIG. 10.

Adhesion of L. rhamnosus GG and the dltD mutant to human intestinal epithelial cells. The levels of bacteria initially added to the Caco-2 cells were set to 100%. Data shown are relative to this percentage. Similar percentages of adhesion were observed for the HT-29 and Caco-2 cell lines. Graphs show the values obtained for Caco-2 cells only.

Cytokine induction by HT-29 cells and PBMCs after L. rhamnosus GG and dltD challenge.

An increase in cytokine induction in HT-29 was observed after either bacterial challenge (L. rhamnosus GG wild type, dltD mutant, and S. enterica serovar Typhimurium SL1344) or cytokine stimulation (IL-1β) compared to the values obtained using the negative control (data not shown). However, no significant differences in cytokine induction were observed for the mutant and the parental strain challenge (Fig. 11A). As expected, the proinflammatory cytokines tested (IL-8 and tumor necrosis factor alpha [TNF-α]) were highly induced by the positive controls (IL-1β and S. enterica serovar Typhimurium SL1344) in comparison to the low levels detected for the negative control (medium) and for L. rhamnosus GG or the dltD mutant. Lack of d-Ala residues in the LTA of the L. rhamnosus GG dltD mutant did not result in significant differences in the levels of IL-10, IL-12, gamma interferon, and TNF-α released from PBMC in comparison to the wild-type strain results (Fig. 11B). The gram-negative control strain (E. coli) induced more IL-10 than the gram-positive bacteria (L. rhamnosus GG and S. gordonii), as previously reported (25) (data not shown).

FIG. 11.

FIG. 11.

Cytokine response of human HT-29 intestinal cells and PBMC to stimulation with L. rhamnosus GG and dltD mutant. (A) Bars represent the averages of triplicate results of three independent reverse transcriptase PCR experiments. Black bars, IL-8; stippled white bars, IL-15; stippled light gray bars, transforming growth factor β; stippled dark gray bars, TNF-α. (B) Results represent the cytokine responses of at least six individual donors as determined by enzyme-linked immunosorbent assays. Black bars, L. rhamnosus GG wild type; stippled white bars, dltD mutant.

DISCUSSION

Inactivation of the dltD gene in L. rhamnosus GG has a strong impact on LTA composition, resulting in a complete absence of d-alanyl ester content. This is in contrast to other lactic acid bacteria so far analyzed with respect to the dlt operon. A reduction in d-alanylation of LTA was previously reported for Lactococcus lactis (fivefold lower for the dltD mutant) and Lactobacillus plantarum NCIMB8826 (8- to 40-fold lower for the dltB mutant) (45, 55). A complete absence of d-alanylation of LTA has been reported for the dltA mutants of a number of gram-positive pathogens (1, 18, 35, 46, 47).

Recently, the function of the d-Ala ester substitution in LTA has been the subject of investigation for several genera of gram-positive bacteria. Previous results with d-Ala ester-deficient mutants have shown changes in cell morphology, in some cases associated with defective cell separation (41). For L. rhamnosus GG, electron micrographs showed an increase in cell length for the dltD mutant compared to the wild type. This observation can probably be related to defects in the septal region. For another L. rhamnosus strain (the ATCC 7469 dltD mutant), an increase in cell length was also reported compared to parental strain results. However, in this case no obvious alteration at the septum was reported (13). In a recent publication, elongated L. plantarum NCIMB8826 cells were observed as a consequence of the mutation in the dltB gene (45). Taking all of these data together, it is clear that for all the bacteria studied thus far, d-alanylation of LTA plays an important role in determining cell shape and cell septation.

In addition to the role of d-alanylation in determining morphology, this process also allows gram-positive bacteria to modulate surface charge. For example, LTA appears to play a crucial role in the control of autolysin activity (55), and d-Ala ester content seems to determine the number of anionic sites on LTA for autolysin binding (58). In accordance with these data, it was expected that the L. rhamnosus GG dltD mutant would show an increased rate of autolysis in the presence of Triton X-100 as a consequence of the complete absence of d-Ala ester residues in the LTA. Similar results have been reported for the L. lactis MG1363 dltD mutant (55). In addition to the role in autolysis, autolysins are also involved in cell division and separation (32). Therefore, the observation of elongated L. rhamnosus GG dltD mutant cells having defects in septum formation and showing increased autolysis is suggested to be the result of changes in electromechanical properties of the cell wall.

A second clear example of the role of d-alanylation in the modification of the surface charge is the correlation between d-Ala ester content and the action of cationic antimicrobial peptides (34, 40). For this reason, the capacity of L. rhamnosus GG wild-type and dltD mutant cells to initiate growth in the presence of two cationic peptides was evaluated. As expected, a significant difference between the dltD mutant and the parental strain was observed. On the other hand, it can be speculated that negatively charged compounds might be repelled to a greater extent in bacteria with a lower degree of d-alanylation. Our results indeed show that inactivation of the dltD gene in L. rhamnosus GG increases the capacity of the bacterium to grow in a medium containing SDS, a potent anionic detergent.

Human beta-defensins are cationic host defense peptides expressed by epithelial cells. It has been reported that constitutively expressed hBD1 can mediate epithelial interactions with the commensal flora whereas hBD2 may participate in the host defense response to enteric microbes that can breach the epithelial barrier (15). We have previously demonstrated that L. rhamnosus GG is not sensitive to hBD1, whereas it is very sensitive to hBD2 (15). Consequently, considering these data together with the charge-mediated mode of action of this antimicrobial peptide, it can be speculated that the increased sensitivity of the L. rhamnosus GG dltD mutant to hBD2 is likely the result of an increased net negative charge of the bacterial cell envelope as a consequence of the modification in the d-Ala content of the LTA (40).

In general, probiotic bacteria should survive gastric transit in order to confer beneficial effects on the host. A mutation in the dltD gene of L. rhamnosus GG causes a dramatic decrease in acid tolerance. This particular phenotype is interesting, taking into account that cell wall components, soluble factors, and genomic DNA from L. rhamnosus GG have been found to have a strong immunostimulatory capacity (27, 56). Consequently, after gastric transit, the dltD mutant could still exert immunological benefits as a result of release of cell wall components and DNA.

After colonization of the gastrointestinal tract, in vivo biofilm formation on the intact intestinal mucosa represents for the host an additional part of the mucosal barrier (31, 37, 44). In the present study we found no differences either in adhesion to the tested human intestinal epithelial cells or in biofilm formation between L. rhamnosus GG wild-type and dltD mutant cells.

The capacity of probiotic bacteria to stimulate or regulate the mucosal immune system and therefore maintain the gut immunological barrier has been widely studied (5, 22, 42, 53). Furthermore, the role of d-alanylation of the LTA in the anti-inflammatory properties of the probiotic strain L. plantarum NCIMB8826 was recently described (22). The immunomodulation of an L. plantarum dltB mutant was significantly different from that of the parental strain in the in vivo and in vitro model systems studied (IL-10/IL-12 ratio, 1.1 for wild type and 160.8 for the dltB mutant) (22). In the case of L. rhamnosus GG, cytokine stimulation of human intestinal epithelial cells and peripheral blood mononuclear cells was not significantly altered by the lack of d-Ala ester substitution in the dltD mutant of L. rhamnosus GG (IL-10/IL-12 ratio, 51.09 for the wild type and 4.33 for the dltD mutant), although the level of d-Ala content of the L. rhamnosus GG wild type is 1.8 times higher than that of the d-Ala content of the LTA from L. plantarum. These results are in agreement with the findings of B. Pot and C. Grangette that a dltD mutant of Lactococcus lactis MG1363 did not yield a considerable increase in anti-inflammatory potential either (unpublished data).

In addition to the differences in LTA d-Ala substitution results observed, the cell wall of L. rhamnosus contains only one type of TA, LTA (29), in contrast to L. plantarum, which contains two types of TAs, LTA and WTA. Although it has been reported that WTA from L. plantarum carries d-Ala and glucose residues in a strain-dependent ratio (40), no reports about the substitution of WTA in the particular strain NCIMB8826 have been published. However, it can be speculated that the degree of d-alanylation of WTA from L. plantarum NCIMB8826 is affected by the mutation in the dltB gene, since the d-Ala ester substituents of WTA are derived from those of LTA (40). Additionally, the LTA from the L. plantarum NCIMB8826 dltB mutant was shown to contain a large amount of glucose substitutions, whereas glucose substitutions were nearly undetectable in the LTA from the NCIMB8826 wild type (22). These differences in the LTA (and WTA) of L. plantarum and L. rhamnosus GG strains might well offer an explanation for the different immunological responses in challenges with the two different species.

Moreover, other structural features of the LTA need to be considered as key factors for immune stimulation. For instance, the LTA glycolipid anchor and the length of the Gro-P backbone, as they have been reported to have immunostimulatory potential in other gram-positive bacteria (14, 38), should be taken into account. Interestingly, the fatty acid chains of the glycolipid anchor of the L. rhamnosus GG dltD mutant showed an average increase in length of two carbon atoms compared to the length of fatty acid chains of the lipid anchor in the wild type. Additionally, the polyglycerophosphate chains, containing an average of 50 Gro-P residues in the L. rhamnosus GG wild type, were reduced to averages of 29 Gro-P and 7 Gro-P residues for the major and minor peaks of the dltD mutant, respectively. In contrast, the Gro-P backbone of the L. plantarum dltB mutant increased threefold in length compared to the backbone in the wild type. It can therefore be concluded from both studies that altering the d-Ala substitution of LTA, by either a dltD (L. rhamnosus GG) or a dltB (L. plantarum) mutation, also affects the other building blocks (glycolipid anchor and/or polyglycerophosphate chains) of LTA. This is of interest and needs to be taken into account for future studies of the immunomodulatory properties of LTA.

Conclusively, our study showed the importance of DltD of the probiotic strain Lactobacillus rhamnosus GG in the biosynthesis of the LTA. Lack of d-alanylation of the LTA affects a number of cell morphology and surface properties but does not affect important probiotic characteristics, including immunomodulation properties. On the other hand, it is very likely that the dltD mutant of L. rhamnosus GG will more easily lyse after administration than will the wild type. Therefore, as a follow-up study it will be interesting to compare immunomodulation effects in vivo.

Acknowledgments

M. Perea Vélez holds a Ph.D. grant from the Interfaculty Council for Development Cooperation of K. U. Leuven (IRO-16302). S. De Keersmaecker is a postdoctoral research associate of the Belgian Fund for Scientific Research (FWO-Vlaanderen). Additionally, this work was financially supported by the K. U. Leuven Research Council (IDO/03/005) and the Flemish Institute for the Promotion of Innovation by Science and Technology (IWT-Vlaanderen, Brussels, Belgium) through projects STWW-000162 and SBO-040073.

We thank Chantal Mathieu and Lutgart Overbergh for providing us with primers and probes and necessary equipment for the reverse transcriptase PCR analysis at the Laboratory for Experimental Medicine and Endocrinology (LEGENDO, Laboratory for Experimental Transplantation, University Hospital Gasthuisberg, K. U. Leuven), P. Augustijns for providing the Caco-2 cells used in this study, V. Dennin for help with the PBMC analysis, D. Valckx and W. Cockx for technical assistance, and M. Fauvart for his valuable graphical assistance.

Footnotes

Published ahead of print on 13 April 2007.

REFERENCES

  • 1.Abachin, E., C. Poyart, E. Pellegrini, E. Milohanic, F. Fiedler, P. Berche, and P. Trieu-Cuot. 2002. Formation of d-alanyl-lipoteichoic acid is required for adhesion and virulence of Listeria monocytogenes. Mol. Microbiol. 43:1-14. [DOI] [PubMed] [Google Scholar]
  • 2.Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410. [DOI] [PubMed] [Google Scholar]
  • 3.Altschul, S. F., T. L. Madden, A. A. Schaffer, J. H. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Alvarez-Olmos, M. I., and R. A. Oberhelman. 2001. Probiotic agents and infectious diseases: a modern perspective on a traditional therapy. Clin. Infect. Dis. 32:1567-1576. [DOI] [PubMed] [Google Scholar]
  • 5.Baken, K. A., J. Ezendam, E. R. Gremmer, A. de Klerk, J. L. Pennings, B. Matthee, A. A. Peijnenburg, and H. van Loveren. 2006. Evaluation of immunomodulation by Lactobacillus casei Shirota: immune function, autoimmunity and gene expression. Int. J. Food Microbiol. 112:8-18. [DOI] [PubMed] [Google Scholar]
  • 6.Bierbaum, G., and H. G. Sahl. 1985. Induction of autolysis of staphylococci by the basic peptide antibiotics Pep 5 and nisin and their influence on the activity of autolytic enzymes. Arch. Microbiol. 141:249-254. [DOI] [PubMed] [Google Scholar]
  • 7.Boyd, D. A., D. G. Cvitkovitch, A. S. Bleiweis, M. Y. Kiriukhin, D. V. Debabov, F. C. Neuhaus, and I. R. Hamilton. 2000. Defects in d-alanyl-lipoteichoic acid synthesis in Streptococcus mutans results in acid sensitivity. J. Bacteriol. 182:6055-6065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cao, M., and J. D. Helmann. 2004. The Bacillus subtilis extracytoplasmic-function σX factor regulates modification of the cell envelope and resistance to cationic antimicrobial peptides. J. Bacteriol. 186:1136-1146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Clemans, D. L., P. E. Kolenbrander, D. V. Debabov, Q. Zhang, R. D. Lunsford, H. Sakone, C. J. Whittaker, M. P. Heaton, and F. C. Neuhaus. 1999. Insertional inactivation of genes responsible for the d-alanylation of lipoteichoic acid in Streptococcus gordonii DL1 (Challis) affects intrageneric coaggregations. Infect. Immun. 67:2464-2474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Corcoran, B. M., C. Stanton, G. F. Fitzgerald, and R. P. Ross. 2005. Survival of probiotic lactobacilli in acidic environments is enhanced in the presence of metabolizable sugars. Appl. Environ. Microbiol. 71:3060-3067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Danielsen, M. 2002. Characterization of the tetracycline resistance plasmid pMD5057 from Lactobacillus plantarum 5057 reveals a composite structure. Plasmid 48:98-103. [DOI] [PubMed] [Google Scholar]
  • 12.Debabov, D. V., M. P. Heaton, Q. Zhang, K. D. Stewart, R. H. Lambalot, and F. C. Neuhaus. 1996. The d-alanyl carrier protein in Lactobacillus casei: cloning, sequencing, and expression of dltC. J. Bacteriol. 178:3869-3876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Debabov, D. V., M. Y. Kiriukhin, and F. C. Neuhaus. 2000. Biosynthesis of lipoteichoic acid in Lactobacillus rhamnosus: role of DltD in d-alanylation. J. Bacteriol. 182:2855-2864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Deininger, S., A. Stadelmaier, S. von Aulock, S. Morath, R. R. Schmidt, and T. Hartung. 2003. Definition of structural prerequisites for lipoteichoic acid-inducible cytokine induction by synthetic derivatives. J. Immunol. 170:4134-4138. [DOI] [PubMed] [Google Scholar]
  • 15.De Keersmaecker, S. C., K. Braeken, T. L. Verhoeven, M. Perea Vélez, S. Lebeer, J. Vanderleyden, and P. Hols. 2006. Flow cytometric testing of green fluorescent protein-tagged Lactobacillus rhamnosus GG for response to defensins. Appl. Environ. Microbiol. 72:4923-4930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.De Keersmaecker, S. C., C. Varszegi, N. van Boxel, L. W. Habel, K. Metzger, R. Daniels, K. Marchal, D. De Vos, and J. Vanderleyden. 2005. Chemical synthesis of (S)-4,5-dihydroxy-2,3-pentanedione, a bacterial signal molecule precursor, and validation of its activity in Salmonella typhimurium. J. Biol. Chem. 280:19563-19568. [DOI] [PubMed] [Google Scholar]
  • 17.Delcour, J., T. Ferain, M. Deghorain, E. Palumbo, and P. Hols. 1999. The biosynthesis and functionality of the cell-wall of lactic acid bacteria. Antonie Leeuwenhoek 76:159-184. [PubMed] [Google Scholar]
  • 18.Fabretti, F., C. Theilacker, L. Baldassarri, Z. Kaczynski, A. Kropec, O. Holst, and J. Huebner. 2006. Alanine esters of enterococcal lipoteichoic acid play a role in biofilm formation and resistance to antimicrobial peptides. Infect. Immun. 74:4164-4171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Fischer, W., P. Rosel, and H. U. Koch. 1981. Effect of alanine ester substitution and other structural features of lipoteichoic acids on their inhibitory activity against autolysins of Staphylococcus aureus. J. Bacteriol. 146:467-475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Food and Agriculture Organization of the United Nations and World Health Organization. 2001. Evaluation of health and nutritional properties of powder milk and live lactic acid bacteria. Food and Agriculture Organization of the United Nations and World Health Organization expert consultation report. Food and Agriculture Organization of the United Nations and World Health Organization, Rome, Italy.
  • 21.Gorbach, S. L. 2000. Probiotics and gastrointestinal health. Am. J. Gastroenterol. 95:S2-S4. [DOI] [PubMed] [Google Scholar]
  • 22.Grangette, C., S. Nutten, E. Palumbo, S. Morath, C. Hermann, J. Dewulf, B. Pot, T. Hartung, P. Hols, and A. Mercenier. 2005. Enhanced antiinflammatory capacity of a Lactobacillus plantarum mutant synthesizing modified teichoic acids. Proc. Natl. Acad. Sci. USA 102:10321-10326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Gross, M., S. E. Cramton, F. Gotz, and A. Peschel. 2001. Key role of teichoic acid net charge in Staphylococcus aureus colonization of artificial surfaces. Infect. Immun. 69:3423-3426. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hancock, I. C. 2001. Teichoic acids of Gram-positive bacteria, p. 79-92. In M. Sussman (ed.), Molecular medical microbiology. Academic Press, San Diego, CA.
  • 25.Hessle, C., L. A. Hanson, and A. E. Wold. 1999. Lactobacilli from human gastrointestinal mucosa are strong stimulators of IL-12 production. Clin. Exp. Immunol. 116:276-282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hoiseth, S. K., and B. A. Stocker. 1981. Aromatic-dependent Salmonella typhimurium are non-virulent and effective as live vaccines. Nature 291:238-239. [DOI] [PubMed] [Google Scholar]
  • 27.Iliev, I. D., H. Kitazawa, T. Shimosato, S. Katoh, H. Morita, F. He, M. Hosoda, and T. Saito. 2005. Strong immunostimulation in murine immune cells by Lactobacillus rhamnosus GG DNA containing novel oligodeoxynucleotide pattern. Cell Microbiol. 7:403-414. [DOI] [PubMed] [Google Scholar]
  • 28.Josson, K., T. Scheirlinck, F. Michiels, C. Platteeuw, P. Stanssens, H. Joos, P. Dhaese, M. Zabeau, and J. Mahillon. 1989. Characterization of a Gram-positive broad-host-range plasmid isolated from Lactobacillus hilgardii. Plasmid 21:9-20. [DOI] [PubMed] [Google Scholar]
  • 29.Kelemen, M. V., and J. Baddiley. 1961. Structure of the intracellular glycerol teichoic acid from Lactobacillus casei ATCC 7469. Biochem. J. 80:246-254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kleerebezem, M., J. Boekhorst, R. Van Kranenburg, D. Molenaar, O. P. Kuipers, R. Leer, R. Tarchini, S. A. Peters, H. M. Sandbrink, M. W. Fiers, W. Stiekema, R. M. Klein Lankhorst, P. A. Bron, S. M. Hoffer, M. N. Nierop Groot, R. Kerkhoven, M. De Vries, B. Ursing, W. M. de Vos, and R. J. Siezen. 2003. Complete genome sequence of Lactobacillus plantarum WCFS1. Proc. Natl. Acad. Sci. USA 100:1990-1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kleessen, B., B. Sykura, H. J. Zunft, and M. Blaut. 1997. Effects of inulin and lactose on fecal microflora, microbial activity, and bowel habit in elderly constipated persons. Am. J. Clin. Nutr. 65:1397-1402. [DOI] [PubMed] [Google Scholar]
  • 32.Koch, A. L. 2001. Autolysis control hypotheses for tolerance to wall antibiotics. Antimicrob. Agents Chemother. 45:2671-2675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Koprivnjak, T., V. Mlakar, L. Swanson, B. Fournier, A. Peschel, and J. P. Weiss. 2006. Cation-induced transcriptional regulation of the dlt operon of Staphylococcus aureus. J. Bacteriol. 188:3622-3630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kovács, M., A. Halfmann, I. Fedtke, M. Heintz, A. Peschel, W. Vollmer, R. Hakenbeck, and R. Bruckner. 2006. A functional dlt operon, encoding proteins required for incorporation of d-alanine in teichoic acids in gram-positive bacteria, confers resistance to cationic antimicrobial peptides in Streptococcus pneumoniae. J. Bacteriol. 188:5797-5805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kristian, S. A., V. Datta, C. Weidenmaier, R. Kansal, I. Fedtke, A. Peschel, R. L. Gallo, and V. Nizet. 2005. d-Alanylation of teichoic acids promotes group A Streptococcus antimicrobial peptide resistance, neutrophil survival, and epithelial cell invasion. J. Bacteriol. 187:6719-6725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lebeer, S., S. C. De Keersmaecker, T. L. Verhoeven, A. A. Fadda, K. Marchal, and J. Vanderleyden. 2007. Functional analysis of luxS in the probiotic strain Lactobacillus rhamnosus GG reveals a central metabolic role important for growth and biofilm formation. J. Bacteriol. 189:860-871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Macfarlane, G. T., E. Furrie, and S. Macfarlane. 2004. Bacterial milieu and mucosal bacteria in ulcerative colitis. Novartis Found. Symp. 263:57-64. [DOI] [PubMed] [Google Scholar]
  • 38.Morath, S., A. Geyer, and T. Hartung. 2001. Structure-function relationship of cytokine induction by lipoteichoic acid from Staphylococcus aureus. J. Exp. Med. 193:393-397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Morath, S., A. Stadelmaier, A. Geyer, R. R. Schmidt, and T. Hartung. 2002. Synthetic lipoteichoic acid from Staphylococcus aureus is a potent stimulus of cytokine release. J. Exp. Med. 195:1635-1640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Neuhaus, F. C., and J. Baddiley. 2003. A continuum of anionic charge: structures and functions of d-alanyl-teichoic acids in gram-positive bacteria. Microbiol. Mol. Biol. Rev. 67:686-723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Ntamere, A. S., D. J. Taron, and F. C. Neuhaus. 1987. Assembly of d-alanyl-lipoteichoic acid in Lactobacillus casei: mutants deficient in the d-alanyl ester content of this amphiphile. J. Bacteriol. 169:1702-1711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.O'Hara, A. M., P. O'Regan, A. Fanning, C. O'Mahony, J. Macsharry, A. Lyons, J. Bienenstock, L. O'Mahony, and F. Shanahan. 2006. Functional modulation of human intestinal epithelial cell responses by Bifidobacterium infantis and Lactobacillus salivarius. Immunology 118:202-215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Overbergh, L., A. Giulietti, D. Valckx, R. Decallonne, R. Bouillon, and C. Mathieu. 2003. The use of real-time reverse transcriptase PCR for the quantification of cytokine gene expression. J. Biomol. Tech. 14:33-43. [PMC free article] [PubMed] [Google Scholar]
  • 44.Palestrant, D., Z. E. Holzknecht, B. H. Collins, W. Parker, S. E. Miller, and R. R. Bollinger. 2004. Microbial biofilms in the gut: visualization by electron microscopy and by acridine orange staining. Ultrastruct. Pathol. 28:23-27. [PubMed] [Google Scholar]
  • 45.Palumbo, E., M. Deghorain, P. S. Cocconcelli, M. Kleerebezem, A. Geyer, T. Hartung, S. Morath, and P. Hols. 2006. d-Alanyl ester depletion of teichoic acids in Lactobacillus plantarum results in a major modification of lipoteichoic acid composition and cell wall perforations at the septum mediated by the Acm2 autolysin. J. Bacteriol. 188:3709-3715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Peschel, A., M. Otto, R. W. Jack, H. Kalbacher, G. Jung, and F. Gotz. 1999. Inactivation of the dlt operon in Staphylococcus aureus confers sensitivity to defensins, protegrins, and other antimicrobial peptides. J. Biol. Chem. 274:8405-8410. [DOI] [PubMed] [Google Scholar]
  • 47.Poyart, C., E. Pellegrini, M. Marceau, M. Baptista, F. Jaubert, M. C. Lamy, and P. Trieu-Cuot. 2003. Attenuated virulence of Streptococcus agalactiae deficient in d-alanyl-lipoteichoic acid is due to an increased susceptibility to defensins and phagocytic cells. Mol. Microbiol. 49:1615-1625. [DOI] [PubMed] [Google Scholar]
  • 48.Raychaudhuri, D., and A. N. Chatterjee. 1985. Use of resistant mutants to study the interaction of Triton X-100 with Staphylococcus aureus. J. Bacteriol. 164:1337-1349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
  • 50.Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Schär-Zammaretti, P., and J. Ubbink. 2003. The cell wall of lactic acid bacteria: surface constituents and macromolecular conformations. Biophys. J. 85:4076-4092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Schnitger, H., K. Papenberg, E. Ganse, R. Czok, T. Bucher, and H. Adam. 1959. Chromatographie phosphathaltiger Metabolite eines menschlichen Leberpunktats. Biochem. Z. 332:167-185. [PubMed] [Google Scholar]
  • 53.Sheil, B., J. Macsharry, L. O'Callaghan, A. O'Riordan, A. Waters, J. Morgan, J. K. Collins, L. O'Mahony, and F. Shanahan. 2006. Role of interleukin (IL-10) in probiotic-mediated immune modulation: an assessment in wild-type and IL-10 knock-out mice. Clin. Exp. Immunol. 144:273-280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Sherwood, L., and M. D. Gorbach. 1996. The discovery of Lactobacillus GG. Nutr. Today 31:2S-4S. [Google Scholar]
  • 55.Steen, A., E. Palumbo, M. Deghorain, P. S. Cocconcelli, J. Delcour, O. P. Kuipers, J. Kok, G. Buist, and P. Hols. 2005. Autolysis of Lactococcus lactis is increased upon d-alanine depletion of peptidoglycan and lipoteichoic acids. J. Bacteriol. 187:114-124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Tao, Y., K. A. Drabik, T. S. Waypa, M. W. Musch, J. C. Alverdy, O. Schneewind, E. B. Chang, and E. O. Petrof. 2006. Soluble factors from Lactobacillus GG activate MAPKs and induce cytoprotective heat shock proteins in intestinal epithelial cells. Am. J. Physiol. Cell Physiol. 290:C1018-C1030. [DOI] [PubMed] [Google Scholar]
  • 57.Volkman, B. F., Q. Zhang, D. V. Debabov, E. Rivera, G. C. Kresheck, and F. C. Neuhaus. 2001. Biosynthesis of d-alanyl-lipoteichoic acid: the tertiary structure of apo-d-alanyl carrier protein. Biochemistry 40:7964-7972. [PubMed] [Google Scholar]
  • 58.Wecke, J., M. Perego, and W. Fischer. 1996. d-Alanine deprivation of Bacillus subtilis teichoic acids is without effect on cell growth and morphology but affects the autolytic activity. Microb. Drug Resist. 2:123-129. [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES