Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2007 May 16;45(7):2316–2320. doi: 10.1128/JCM.00203-07

PCR-Restriction Fragment Length Polymorphism Analysis of Campylobacter jejuni Genes Involved in Lipooligosaccharide Biosynthesis Identifies Putative Molecular Markers for Guillain-Barré Syndrome▿

Peggy C R Godschalk 1,*, Alex van Belkum 1, Nicole van den Braak 1,†, Diana van Netten 1, C Wim Ang 1,‡, Bart C Jacobs 2,3, Michel Gilbert 4, Hubert P Endtz 1
PMCID: PMC1933017  PMID: 17507514

Abstract

Molecular mimicry of Campylobacter jejuni lipooligosaccharides (LOS) by gangliosides in peripheral nerve tissue probably triggers the Guillain-Barré syndrome due to the induction of cross-reactive antibodies. PCR-restriction fragment length polymorphism analysis of C. jejuni genes involved in the biosynthesis of LOS demonstrated that specific genes were associated with the expression of ganglioside mimics and the development of neuropathy.


Campylobacter jejuni probably triggers the Guillain-Barré syndrome (GBS) through molecular mimicry between lipo-oligosaccharides (LOS) in the bacterial cell wall and gangliosides in human peripheral nerve tissue (1). Various ganglioside-mimicking structures have been identified in the LOS fraction of the C. jejuni cell wall (9). This variation in LOS structure is the result of differences in the presence of LOS biosynthesis genes and of DNA sequence polymorphism within these genes (4). Based on the differences in gene content observed so far, eight different classes of the LOS biosynthesis gene locus can be identified (6, 10). However, only strains with a class A, B, or C LOS locus express ganglioside mimics (3). Previously, we demonstrated that class A and B LOS biosynthesis gene loci are associated with GBS and its variant, the Miller Fisher syndrome (MFS), and with the expression of ganglioside mimics (5). In search of other and/or more specific markers for GBS/MFS or the expression of ganglioside mimics, we describe a study in which the presence and heterogeneity of individual genes within the class A, B, and C LOS loci were studied by a comparative PCR-restriction fragment length polymorphism (RFLP) analysis of neuropathy-associated and control C. jejuni strains.

The C. jejuni strains used in this study have been described before and represent a genetically heterogeneous population (see Table 2) (5, 11). The presence of GM1-like, GQ1b-like, or “any” ganglioside mimics in the LOS of the strains has also been determined previously by mass spectrometry analysis or immunological methodologies (2, 3, 6). GD3-like or GD1c-like LOS structures were considered to be GQ1b-like mimics (6). Only strains with a class A, B, or C LOS locus express ganglioside mimics. Therefore, specific PCR tests were developed for the individual genes within the class A, B, and C LOS loci (Table 1). When necessary, primer sequences were selected for both class C and class A/B genes to cover intrinsic sequence variabilities as effectively as possible. PCR assays were performed using a Biomed thermal cycler (model 60; Theres, Germany) with a program consisting of 40 cycles of the following cycling protocol: 1 min at 94°C, 1 min at 55°C, 1 min at 72°C. For some amplifications, timing needed to be adapted. For RFLP analysis, PCR products were subjected to overnight incubation at 37°C with the enzymes AluI, DdeI, HindIII, and DraI (Boehringer-Mannheim) in separate reactions. Length determination of the PCR and the RFLP products was performed by agarose gel electrophoresis (1 to 3%, depending on the fragment size). Single band differences led to the introduction of a novel type. The differential presence of the genes was further confirmed by hybridization studies. PCR fragments were labeled with an ECL chemiluminescence kit (Amersham Pharmacia Biotech, Freiburg, Germany) according to the instructions of the manufacturer and hybridized to spot blots containing 200 ng of DNA from the various strains. In short, after 2 h of prehybridization, 500 ng of each PCR product was labeled and hybridized overnight at 42°C. After they were washed, blots were incubated for 1 min in 20 ml of detection reagent. Films were developed after 1-, 5-, and 30-min exposures. Statistical analysis was performed with Instat (version 2.05a; GraphPad Software, San Diego, CA). A P value of <0.05 was considered significant.

TABLE 2.

Characteristics of C. jejuni strains and results of the PCR-RFLP and hybridization analyses for the LOS biosynthesis locus

Straina Serotype(s)b LOS class Ganglioside epitopec
Gened
Any GM1 GQ1b 1 2 3 4 5 14 15 6 7ab 7c 8 9 5/10 10 11 16 17 12 13
GB2 UT A + + − + + + + + − − + + − + + − + + − − + +
GB3 19 A + + − + + + + + − − + + − + + − + + − − + +
GB11 2 A + + − + + + + + − − + + − + + − + + − − + +
GB16 13, 66 A + − + + + + + + − − + + − + + − + + − − + +
GB18 19 A + + − + + + + + − − + + − + + − + + − − + +
GB19 4, 50 A + − + + + + + + − − + + − + + − + + − − + +
GB21 13, 65 A + + − + + + + + − − + + − + + − + + − − + +
GB22 13, 64 A + + − + + + + + − − + + − + + − + + − − + +
GB23 4, 13, 43 A + − − + + + + + − − + + − + + − + + − − + +
GB26/27 1, 44 A + − − + + + + + − − − + − + + − + + − − + +
GB28 19, 38 A + + − + + + + + − − + + − + + − + + − − + +
OH4382 19 A + − + + + + + + − − + + − + + − + + − − + +
GB5 4, 64 B − − − + + + + + − − + + − + + − + + − − + +
MF6 4, 64 B + − + + + + + + − − − + − + + − + + − − + +
MF7 35 B + − + + + + + + − − − + − + + − + + − − + +
MF8 23, 36 B + − + + + + + + − − + + − + + − + + − − + +
GB17 4, 13, 64 B + − + + + + + + − − + + − + + − + + − − + +
MF20 2 B + − + + + + + + − − − + − + + − + + − − + +
GB25 2 B + − + + + + + + − − + + − + + − + + − − + +
GB1 1 C − − − + + + + + + + + − + + + + − − + + + +
GB13/14 2 C + + − + + + + + + + + − + + + + − − + + + +
GB15 5, 34 F − − − + + + − − − − − − − − − − − − − − + +
GB24 31 K − − − + + + − − − − − − − − − − − − − − + +
GB4 37 P − − − + + − − + − − − − − − − − − − − − + +
HS:4 4 A + + − + + + + + − − + + − + + − + + − − + +
HS:10 10 A + − + + + + + + − − + + − + + − + + − − + +
HS:19 19 A + + − + + + + + − − + + − + + − + + − − + +
HS:23 23 B − − − + + + + + − − − + − + + − + + − − + +
HS:35 35 B − − − + + + + + − − − + − + + − + + − − + +
HS:36 36 B + − − + + + + + − − + + − + + − + + − − + +
HS:1 1 C + − − + + + + + + + + − + + + + − − + + + +
HS:2 2 C + − − + + + + + + + + − + + + + − − + + + +
11168 2 C + + − + + + + + + + + − + + + + − − + + + +
HS:64 64 D − − − + + + − − − − + − − + + − − − − − + +
HS:3 3 H − − − + + + − − − − + − − + + − − − − − + +
E98-652 2 B + + + + + − − + − − − + − + + − + + − − + +
E98-1033 10 B + + − + + + + + − − + + − + + − + − − − + +
E98-682 1 C + + − + + + + + + + + − + + + + − − + + + +
E98-1087 1, 10, 44 C + + − + + + + + + + − − + − + − − − + + + +
E98-706 31, 63 D − − − + + + − − − − − + − − − − − − − − + +
E98-623 6, 57 E − − − + + − − + − − − + − + + − + − − − + +
E98-624 22, 57 E − − − + + − − + − − − − − − − − − − − − + +
No. of RFLP typese 17 17 1-2 1-1 1 1 1 3-10 8 1 2-9 1-8 1 7 1 1 2 1-6 9
a

Neuropathy-associated strains: GBxx and OH4382, GBS-associated isolates; MFxx, MFS-associated isolates. Enteritis-associated strains: Exx, isolates from enteritis patients; HS:xx, Penner (HS) type strains; 11168, NCTC 11168 genome strain.

b

Penner (HS) serotypes; UT, untypeable.

c

+, present, −, absent. The presence of ganglioside epitopes was determined previously by immunological methods or, when available, mass spectrometry (2, 3, 6).

d

Gene numbers are open reading frame (ORF) numbers (as shown in Table 1). +, detected by PCR/hybridization analysis; −, not detected by PCR/hybridization analysis.

e

Data represent the number of RFLP types detected per gene. In cases in which the PCR analysis was performed with two primer sets, two numbers are displayed; the first is the number of RFLP types based on NCTC 11168 primer set PCR, and the second is the number of RFLP types based on HS:19 (OH4384) primer set PCR.

TABLE 1.

Survey of Campylobacter jejuni NCTC 11168 and HS:19 LOS biosynthesis genes, including primers for amplification of the respective genes

Codea Geneb Positionsc Size (bp) Proposed function Primer sequences (5′-3′)d
Cj1133, ORF1 waaC 126680-127708 1,029 Heptosyl transferase I TAATGAAAATAGCAATTGTTCGT
<1-360 GATACAAAAATCACTTTTATCGA
Cj1134, ORF2 htrB 127698-128585 888 Lipid A biosynthesis acyltransferase ACGCGTATAGAAGAAGAAGATAT
350-1237 888 AGATTCATTTGCATCCTTGTA
Cj1135, ORF3 128582-130129 1,548 Two-domain glucosyltransferase ATGAATCTAAAGCAAATAAGTGCTATTATC
1234-2490 1,257 TACATTGTATATGGGGATTACTACACCTAC
ATGAATCTAAAACAAATAAGCGTTATTATC (class A/B)
CGATAATCATCTTTGTTTAAAATTTCTTCG
Cj1136, ORF4 130133-131305 1,173 β-1,3-Galactosyltransferase ATGAAAAAAGTAGGTGTAGTAATCC
2786-3955 1,170 TCAATGATAGATAAAATCATTTTGCAAGT
ATGAAGAAAATAGGTGTAGTTATACC (class A/B)
TTAAATATTTTTTATTTTTTGCC
ORF5 cgtA 4025-5068 1,044 β-1,4-N-Acetylgalactosaminyltransferase ATGCTATTTCAATCATACTTTGTG
TTAAAACAATGTTAAGAATATTTTTTTAG
Cj1137c, ORF14 131289-132284 996 Putative glycosyltransferase CAACTTTGCAAAATGATTTTATCTATCATT
ATGCAAATACAACAAAACAATTC
Cj1138, ORF15 132342-133511 1,170 Putative glycosyltransferase AACATAGAAGGTAATAATCCTTATG
AGGGTTTTAATAGTTGCAATTTCTC
Cj1139c, ORF6 wlaN, cgtB 133500-134411 912 β-1,3-Galactosyltransferase ATGAAATTTTTAATATCTTTACGGAATTAA
5054-5959 906 ATGAGTCAAATTTCCATCATACTACCAACT
ATGTTTAAAATTTCAATCATCTTACC (class A/B)
TATTTATTTTAGCTAACAATGTAACC
Cj1140, ORF7 cst-II, cst-III 134466-135350 885 α-2,3- or α-2,3/α2,8-sialyltransferase ATGAGTATGAATATTAATGCTTTGG
6048-6923 876 TTATCTATTTTTATTTGCATATTTTTC
ATGAAAAAAGTTATTATTGCTGGAAATG (class A/B)
TTATTTTCCTTTGAAATAATGCTTTATTC
Cj1141, ORF8 neuB1 135331-136362 1,032 Sialic acid synthetase ATGCAAATAAAAATAGATAAATTAACTAT
6924-7964 1,041 TCATTCAAAATCATCCCATGTCTTTGCACT
ATGAAAGAAATAAAAATACAAAATATAATC (class A/B)
CGCAAAATCCTCATAGCTTAACTGAGTATC
Cj1142, ORF9 neuC1 136359-137474 1,116 N-Acetylglucosamine-6P 2-epimerase ATGAAAAAAATAGTTTTTGTTAGCGGAACT
8021-9079 1,059 TCATTTTTTATCCATGAATATTTTTTGCTT
GTGAAAAAAATCCTTTTTATAACAGG (class A/B)
GTGTGTTAAGTTTAAAAAATTCTCCGC
ORF10 9076-9741 666 CMP-sialic acid synthetase ATGAGCTTAGCAATAATCCCTGCTC (class A/B)
TTATTTTTTCCATATCTGTTCAGCC
ORF11 9729-10562 834 Sialate-O-acetyltransferase ATGGAAAAATAACCTTAAAATGC (class A/B)
AAATAGATTAAAAATTTTTTTTGATTTTAG
Cj1143, ORF5/10 neuA1 137471-139081 1,611 β-1,4-N-Acetylgalactosaminyltransferase, CMP-sialic acid synthetase ATGACTTTGTTTTATAAAATTATAGC
TTATAAGAAGCTTATATTATTAACAC
Cj1144c, ORF16 139076-139669 594 Hypothetical protein GAGTTAATAATATAAGCTTCTTTATAA
GGATCTGGAGTAGCAGCGTTTAGTGA
Cj1145c, ORF17 139605-139922 318 Hypothetical protein TAAACATATCATATCAAGATCTACCCATAC
TTGAATTAAAAGATGCAAATGAAATTGTTC
Cj1146c, ORF12 waaV 139906-140730 822 Putative glycosyltransferase ATGCCACAACTTTCTATCATAATCCCGC
10554-11366 813 CTAATTTCTTTGCTTCATCAACCCTTC
ATGCCACAACTTTCTATCATAATCCCGC (class A/B)
TTTTAATCTATTTTTCACCCCTGCTTC
Cj1148, ORF13 waaF 140789-141748 960 Heptosyltransferase II ATGAAAATTTTTATACATCTTCCCACCTGGT
11347->11474 AGATCATAGATGAGAGTTTTTAAGTAAATT
a

The codes represented in the form Cjxxxx correspond to the gene numbering of strain NCTC 11168. The codes representing open reading frame x (ORFx) correspond to the gene numbering by Gilbert et al. (4).

b

Gene nomenclature as found in the literature.

c

Nucleotide positions are based on strain NCTC 11168 (GenBank accession numbers AL139077 and AL139078) and/or on strain OH4384 (GenBank accession number AF130984).

d

Primer sequences are based either on strain NCTC 11168 or on strain OH4384 (indicated by the addition of “class A/B” following the forward primer sequence). For some genes two primer sets were used.

The results of the PCR-RFLP and confirmatory hybridization analyses are summarized in Table 2. In 17% of all positive hybridization signals (the percentage varied per gene), we observed a negative corresponding PCR. In these cases, we considered the gene to be present because sequence heterogeneity at the primer site may result in a negative PCR. For strains with a class A, B, or C LOS locus, the gene content, as determined by PCR and hybridization analyses, was largely in accordance with the expected gene content based on the type of LOS locus. However, there were some discrepancies. orf6 could not be detected in 8 out of 34 (24%) strains with a class A, B, or C LOS locus, although its presence was expected based on the type of LOS locus. A possible explanation may be a failure to detect orf6 due to extensive sequence heterogeneity within orf6, as reflected by the large number of different RFLP types (Table 2). On the other hand, it is also possible that orf6 is really absent in these strains. In five strains with a LOS class other than A, B, or C, one or more genes considered to be unique for class A, B, or C strains gave a positive PCR and hybridization signal. Further analysis is needed to determine whether these positive signals were caused by the actual presence of the target genes in the LOS locus or by the presence of the gene (or a homologue) elsewhere in the genome. Indications for both forms of LOS cluster heterogeneity were documented previously by Parker et al. (10).

Table 3 shows the putative association of the various LOS biosynthesis genes with neuropathy. orf11, encoding a sialate-O-acetyltransferase, was detected significantly more frequently in neuropathy-associated strains and particularly in strains associated with ophthalmoplegia (GBS and MFS) than in controls (Table 3). orf10, located next to orf11 and encoding a CMP-sialic acid synthetase, also occurred more frequently in strains associated with ophthalmoplegia than in controls, but the difference was not statistically significant in the total group of neuropathy-associated strains (Table 3). Because both orf10 and orf11 are unique for classes A and B LOS loci, these findings are in accordance with our previous observations that the class A and B LOS loci are associated with neuropathy. We also demonstrated previously that orf10, but not orf11, is necessary for the biosynthesis of ganglioside mimics and the induction of antiganglioside antibodies in mice (5). Very recently, it was demonstrated that the product of orf11 has sialate-O-acetyltransferase activity and catalyzes the transfer of O-acetyl groups onto oligosaccharide-bound sialic acid (7). However, whether or not this sialate-O-acetyltransferase plays a functional role in the pathogenesis of GBS remains to be determined.

TABLE 3.

Association of gene presence with disease potency as determined for GBS/MFS-associated strains versus controlsa

Genomic region No. (%) of strains associated with:
No. (%) of controls (n = 18) P valueb
GBS-O (n = 17) GBS + O/MFS (n = 7) GBS/MFS (n = 24)
ORF3 16 (94) 7 (100) 23 (96) 15 (83) NS
ORF4 14 (82) 7 (100) 21 (88) 14 (78) NS
ORF5 15 (88) 7 (100) 22 (92) 17 (94) NS
ORF14 2 (12) 0 (0) 2 (8) 5 (28) NS
ORF15 2 (12) 0 (0) 2 (8) 5 (28) NS
ORF7a 12 (71) 7 (100) 19 (79) 10 (56) NS/NS (0.06)/ NS
ORF7b 2 (12) 0 (0) 2 (8) 5 (28) NS
ORF8 14 (82) 7 (100) 21 (88) 15 (83) NS
ORF9 14 (82) 7 (100) 21 (88) 16 (89) NS
ORF5/10 2 (12) 0 (0) 2 (8) 4 (22) NS
ORF10 12 (71) 7 (100) 19 (79) 9 (50) NS/0.027/NS (0.1)
ORF11 12 (71) 7 (100) 19 (79) 7 (39) 0.09/0.008/0.011
ORF16 2 (12) 0 (0) 2 (8) 5 (28) NS
ORF17 2 (12) 0 (0) 2 (8) 5 (28) NS
a

GBS-O, GBS without ophthalmoplegia; GBS + O/MFS, GBS with ophthalmoplegia or MFS; GBS/MFS, all neuropathies. orf1, orf2, orf12, and orf13 were detected in all strains and therefore were not relevant for statistical analysis. orf6 was not subjected to statistical analysis because its detection with PCR/hybridization techniques was not reliable, probably due to cross-hybridization with gene homologues and sequence heterogeneity. ORF, open reading frame.

b

GBS-O, GBS + O/MFS, and GBS/MFS versus controls were tested, respectively. Only p values of ≤0.1 are given. NS, not significant.

We also investigated the correlation between the presence of individual LOS biosynthesis genes and the expression of ganglioside-like structures. Three genes were associated with the occurrence of a GQ1b-like epitope in the bacterial LOS, orf7ab (cst-II), orf10, and orf11 (Table 4). Thus, the previously described association between the cst-II gene and the expression of a GQ1b-like epitope was confirmed in the present study (8, 11). Furthermore, we found that all genes that are unique for classes A and B or class A, B, and C LOS loci were significantly associated with the expression of a ganglioside mimic (Table 4), which is concordant with the observation that only the class A, B, and C LOS loci contain the genes that are necessary for the biosynthesis of ganglioside mimics.

TABLE 4.

Association of gene presence with the expression of ganglioside mimics on the LOSa

Genomic region Expression of ganglioside mimics
GM1-like epitope
P value GQ1b-like epitope
P value Any ganglioside epitope
P value
+ (n = 15) − (n = 27) + (n = 11) − (n = 31) + (n = 30) − (n = 12)
ORF3 14 24 NS 10 28 NS 29 9 NS (0.06)
ORF4 14 19 NS 10 23 NS 29 4 <0.001
ORF5 15 22 NS 11 26 NS 30 7 <0.001
ORF14 4 3 NS 0 7 NS 6 1 NS
ORF15 4 3 NS 0 7 NS 6 1 NS
ORF7a 11 18 NS 11 18 0.009 24 5 0.026
ORF7b 4 3 NS 0 7 NS 6 1 NS
ORF8 14 22 NS 11 25 NS 29 7 0.005
ORF9 15 22 NS 11 26 NS 30 7 <0.001
ORF5/10 3 3 NS 0 6 NS 5 1 NS
ORF10 11 17 NS 11 17 0.008 24 4 0.009
ORF11 10 16 NS 11 15 0.003 23 3 0.004
ORF16 4 3 NS 0 7 NS 6 1 NS
ORF17 4 3 NS 0 7 NS 6 1 NS
a

Only P values of <0.1 are given. P values of <0.05 are considered significant. NS, not significant. orf1, orf2, orf12, and orf13 were detected in all strains and therefore were not relevant for statistical analysis. orf6 was not subjected to statistical analysis because its detection with PCR/hybridization techniques was not reliable, probably due to cross-hybridization with gene homologues and sequence heterogeneity. ORF, open reading frame. Values are number of strains with presence (+) or absence (−) of indicated ganglioside mimics on LOS.

Variation in gene content is only one of the five known mechanisms that allow C. jejuni to vary the structure of its LOS (4). Other mechanisms, which include phase variation due to homopolymeric tract polymorphism and single or multiple mutations, may be detected by RFLP analysis of the LOS biosynthesis genes. This approach enables the screening of large groups of strains for polymorphism in multiple genes. The number of RFLP types that were found in the current study varied strongly per gene (Table 2). Interestingly, most genes in the class C strains were very homogeneous, with only one or two different RFLP types. This is in contrast with the large number of RFLP types that were observed for many genes in the class A and B strains. It is possible that the class C locus has evolved more recently than the less homogeneous class A and B loci (3). Considerable heterogeneity with more than six RFLP types per gene was detected in orf1 (waaC), orf2, orf6 (cgtB), orf7ab (cst-II), orf9 (neuC), orf10 (neuA), orf12, and orf13 (waaF). These genes are involved in different steps of LOS biosynthesis, including the biosynthesis and transfer of sialic acid, a crucial component of gangliosides (Table 1). Such variation on the genetic level may imply functional differences in the products of these genes, leading to qualitative or quantitative variation in expression of ganglioside mimics. It has been demonstrated previously that specific polymorphism in the cst-II gene determines whether the LOS contains mono-NeuAc (the “GM1-like”) or di-NeuAc (the “GQ1b-like”) ganglioside (4). However, in this study, we did not detect an association between the cst-II RFLP type and the mono- or disialylated LOS (results not shown). This may be due to the limited sensitivity of RFLP analysis compared with that of DNA sequence analysis. For the other genes, we did not find either a specific RFLP type that was associated with neuropathy or the expression of ganglioside mimics (results not shown). It may, therefore, be necessary to perform elaborate DNA sequence analysis to determine the putative role of point mutations in the expression of ganglioside mimics and pathogenesis of post-Campylobacter infection neuropathy.

In conclusion, PCR-RFLP analysis demonstrated considerable variation in gene content and overall sequence heterogeneity in the C. jejuni LOS biosynthesis locus. We confirmed and extended previous observations that specific LOS biosynthesis genes are associated with neuropathy and the biosynthesis of ganglioside mimics. RFLP analysis did not demonstrate sequence heterogeneity within genes that was associated with neuropathy or the expression of ganglioside mimics. This technique may not be suitable to detect such polymorphism due to its limited sensitivity.

Acknowledgments

This study was supported by grants from The Netherlands Organization for Scientific Research (920-03-225) to P.C.R.G. and from the Human Frontier Science Program (RGP 38/2003).

Footnotes

▿

Published ahead of print on 16 May 2007.

REFERENCES

  • 1.Ang, C. W., B. C. Jacobs, and J. D. Laman. 2004. The Guillain-Barré syndrome: a true case of molecular mimicry. Trends Immunol. 25:61-66. [DOI] [PubMed] [Google Scholar]
  • 2.Ang, C. W., J. D. Laman, H. J. Willison, E. R. Wagner, H. P. Endtz, M. A. de Klerk, A. P. Tio-Gillen, N. van den Braak, B. C. Jacobs, and P. A. van Doorn. 2002. Structure of Campylobacter jejuni lipopolysaccharides determines antiganglioside specificity and clinical features of Guillain-Barré and Miller Fisher patients. Infect. Immun. 70:1202-1208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Gilbert, M., P. C. R. Godschalk, C. T. Parker, H. P. Endtz, and W. W. Wakarchuk. 2005. Genetic bases for the variation in the lipooligosaccharide outer core of Campylobacter jejuni and possible association of glycosyltransferase genes with post-infectious neuropathies, p. 219-248. In J. M. Ketley and M. E. Konkel (ed.), Campylobacter: molecular and cellular biology, 1st ed. Horizon Bioscience, Pullman, WA.
  • 4.Gilbert, M., M.-F. Karwaski, S. Bernatchez, N. M. Young, E. Taboada, J. Michniewicz, A.-M. Cunningham, and W. W. Wakarchuk. 2002. The genetic bases for the variation in the lipo-oligosaccharide of the mucosal pathogen, Campylobacter jejuni. Biosynthesis of sialylated ganglioside mimics in the core oligosaccharide. J. Biol. Chem. 277:327-337. [DOI] [PubMed] [Google Scholar]
  • 5.Godschalk, P. C. R., A. P. Heikema, M. Gilbert, T. Komagamine, C. W. Ang, J. Glerum, D. Brochu, J. Li, N. Yuki, B. C. Jacobs, A. van Belkum, and H. P. Endtz. 2004. The crucial role of Campylobacter jejuni genes in anti-ganglioside antibody induction in Guillain-Barré syndrome. J. Clin. Investig. 114:1659-1665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Godschalk, P. C. R., M. L. Kuijf, J. Li, F. St. Michael, C. W. Ang, B. C. Jacobs, M.-F. Karwaski, D. Brochu, A. Moterassed, H. P. Endtz, A. van Belkum, and M. Gilbert. 2007. Structural characterization of Campylobacter jejuni lipooligosaccharide outer cores associated with Guillain-Barré and Miller Fisher syndromes. Infect. Immun. 75:1245-1254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Houliston, R. S., H. P. Endtz, N. Yuki, J. Li, H. C. Jarrell, M. Koga, A. van Belkum, M. F. Karwaski, W. W. Wakarchuk, and M. Gilbert. 2006. Identification of a sialate O-acetyltransferase from Campylobacter jejuni: demonstration of direct transfer to the C-9 position of terminal alpha-2,8-linked sialic acid. J. Biol. Chem. 281:11480-11486. [DOI] [PubMed] [Google Scholar]
  • 8.Koga, M., M. Takahashi, M. Masuda, K. Hirata, and N. Yuki. 2005. Campylobacter gene polymorphism as a determinant of clinical features of Guillain-Barré syndrome. Neurology 65:1376-1381. [DOI] [PubMed] [Google Scholar]
  • 9.Moran, A. P. 1997. Structure and conserved characteristics of Campylobacter jejuni lipopolysaccharides. J. Infect. Dis. 176:S115-121. [DOI] [PubMed] [Google Scholar]
  • 10.Parker, C. T., S. T. Horn, M. Gilbert, W. G. Miller, D. L. Woodward, and R. E. Mandrell. 2005. Comparison of Campylobacter jejuni lipooligosaccharide biosynthesis loci from a variety of sources. J. Clin. Microbiol. 43:2771-2781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.van Belkum, A., N. van den Braak, P. Godschalk, W. Ang, B. Jacobs, M. Gilbert, W. Wakarchuk, H. Verbrugh, and H. Endtz. 2001. A Campylobacter jejuni gene associated with immune-mediated neuropathy. Nat. Med. 7:752-753. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES