Skip to main content
Molecular Biology of the Cell logoLink to Molecular Biology of the Cell
. 2003 Jun;14(6):2226–2236. doi: 10.1091/mbc.E02-11-0752

Pex15p of Saccharomyces cerevisiae Provides a Molecular Basis for Recruitment of the AAA Peroxin Pex6p to Peroxisomal Membranes

Ingvild Birschmann *,†, An K Stroobants ‡,†, Marlene van den Berg ‡, Antje Schäfer *, Katja Rosenkranz *, Wolf-H Kunau *,§, Henk F Tabak ‡
Editor: Pamela A Silver
PMCID: PMC194873  PMID: 12808025

Abstract

The gene products (peroxins) of at least 29 PEX genes are known to be necessary for peroxisome biogenesis but for most of them their precise function remains to be established. Here we show that Pex15p, an integral peroxisomal membrane protein, in vivo and in vitro binds the AAA peroxin Pex6p. This interaction functionally interconnects these two hitherto unrelated peroxins. Pex15p provides the mechanistic basis for the reversible targeting of Pex6p to peroxisomal membranes. We could demonstrate that the N-terminal part of Pex6p contains the binding site for Pex15p and that the two AAA cassettes D1 and D2 of Pex6p have opposite effects on this interaction. A point mutation in the Walker A motif of D1 (K489A) decreased the binding of Pex6p to Pex15p indicating that the interaction of Pex6p with Pex15p required binding of ATP. Mutations in Walker A (K778A) and B (D831Q) motifs of D2 abolished growth on oleate and led to a considerable larger fraction of peroxisome bound Pex6p. The nature of these mutations suggested that ATP-hydrolysis is required to disconnect Pex6p from Pex15p. On the basis of these results, we propose that Pex6p exerts at least part of its function by an ATP-dependent cycle of recruitment and release to and from Pex15p.

INTRODUCTION

Eukaryotic cells sequester different cellular functions within distinct membranes and membrane-bound organelles. This highly compartmentalized nature of the eukaryotic cell requires specific mechanisms to sort and deliver proteins vectorially and efficiently from their common site of synthesis to their diverse destinations.

One of these compartments is the peroxisome, which catalyzes a large number of different metabolic reactions (van den Bosch et al., 1992). The functional importance of peroxisomes in human cells is underscored by the existence of peroxisomal disorders (Moser, 1993; Braverman et al., 1995; Wanders et al., 1995; Fujiki, 1997). Those which are caused by defects in peroxisome biogenesis are also referred to as peroxisome biogenesis disorders (Gould and Valle, 2000).

The maintenance of peroxisomes appears to be a complex process involving a relatively large number of distinct proteins. Genetic analysis in different yeast species (Lazarow, 1993), CHO cells, and cells of patients (Fujiki, 2000) has led to the identification of 29 PEX genes that are required for the assembly and maintenance of this organelle (http://www.mips.biochem.mpg.de/proj/yeast/reviews/pex_table.html). Some of the encoded proteins contribute to targeting of newly synthesized proteins to peroxisomes and the transport of these folded proteins across the membrane (Hettema et al., 1999; Subramani et al., 2000). For other proteins their precise role is less well characterized and clues must be derived from conserved structural amino acid motifs, such as SH3 and RING finger domains (Erdmann et al., 1997).

Two peroxins, Pex1p and Pex6p, are members of the large AAA protein family (Patel and Latterich, 1998; Vale, 2000), which has been defined on the basis of an ∼220-amino acid region, termed the AAA cassette (Beyer, 1997), which stands for ATPases associated with a wide range of cellular activities (Kunau et al., 1993). This cassette contains Walker A and B motifs typical of P-loop–containing nucleoside triphosphatases. There are two types of AAA proteins known. The members of type I contain one AAA cassette; those of type II are characterized by two of them. In type II AAA proteins the two AAA cassettes, denoted as D1 and D2, are conserved to a different degree and apparently have different functions (Matveeva et al., 1997; Hattendorf and Lindquist, 2002; Zakalskiy et al., 2002). An especially well-characterized example is NSF/Sec18p, which participates in heterotypic membrane fusion events (Whiteheart and Kubalek, 1995; Vale, 2000).

The function of Pex1p and Pex6p, both type II AAA proteins, within peroxisomal biogenesis is still unclear. It has been reported that in the yeast Yarrowia lipolytica both AAA peroxins have distinct roles in priming and docking of early peroxisomal vesicle populations before fusion (Titorenko and Rachubinski, 2000). However, it is also possible that Pex1p and/or Pex6p provide the molecular basis for the reported ATP-dependence of matrix protein import into peroxisomes (Bellion and Goodman, 1987; Imanaka et al., 1987; Rapp et al., 1993; Wendland and Subramani, 1993; Dodt et al., 1995), because these are the only two peroxins thus far known to bind ATP. This notion has recently been supported by an epistasis analysis in Pichia pastoris, which suggested that Pex1p and Pex6p act in the terminal steps of peroxisomal matrix protein import (Collins et al., 2000).

In our research to define the composition and mode of action of the protein machinery required for peroxisome biogenesis, we identified the membrane-bound peroxin Pex15p (Elgersma et al., 1997; Stroobants et al., 1999) as a membrane anchor of Pex6p in Saccharomyces cerevisiae. Pex15p is a peroxisomal integral membrane protein with most of its sequence including the N-terminus facing the cytosol. The intrinsic binding capacity between Pex15p and Pex6p is modulated via the action of the AAA cassettes of Pex6p. We propose that their opposite effect on the interaction leads to a process of binding and release of Pex6p to and from the peroxisomal membrane.

MATERIALS AND METHODS

Strains and Culture Conditions

The yeast strains used in this study were S. cerevisiae wild-type BJ1991 (MATa; leu2, trp1, ura3-251, prb1-1122, pep4-3, gal2), pex6Δ and pex15Δ (same as BJ1991 except pex6/15::Leu2 (Hettema et al., 1999; Elgersma et al., 1997). Yeast strains used for two-hybrid experiments were PCY2 (MATα, gal4Δ, gal80Δ, URA3::GAL1-lacZ, lys2-801amber, his3-Δ200, trp1-Δ63, leu2 ade2-101ochre; Chevray and Nathans, 1992), pex1Δ (same as PCY2 except pex1::kanMX4; this work), and HF7c (MATa, ura3-52, his3-200, lys2-801, ade2-101, trp1-901, leu2-3/112, gal4-542, gal80-538, LYS2::GAL1-HIS3, URA3::(GAL4 17mers)3-CYC1-lacZ). Complete and minimal media used for yeast culturing have been described elsewhere (Erdmann et al., 1989). YNO medium contained 0.1% oleic acid, 0.05% Tween 40, 0.1% yeast extract, and 0.67% yeast nitrogen base without amino acids, adjusted to pH 6.0. Escherichia coli used for cloning were DH5α (recA, hsdR, supE, endA, gyrA96, thi-1, relA1, lacZ) and for protein expression strain BL21(DE3) (F-, ompTrB-mB-[hsdS gal(λcIts857 ind1 Sam7 nin5 lacUV5-T7 gene1)]).

Construction of a PEX1 Null Allele

The kanMX4 gene of PEX1 was amplified by PCR using primers KU681 and KU682 (Wach et al., 1994) and transformed into S. cerevisiae wild-type PCY2. Correct replacement of the genomic PEX1 open reading frame (ORF) by the kanMX4 gene was confirmed by PCR using primers KU484 and KU711.

Plasmids

The primers used are listed in Table 1. The PEX15 orf including 5′- and 3′-flanking regions was amplified by PCR using primers KU217 and KU218 and genomic DNA as template resulting into plasmid pWG15/1. The PEX6 ORF and additional 5′ (471 bp)and 3′ (243 bp)-flanking regions were amplified from PAS8-YCplac33 (Voorn-Brouwer et al., 1993) by PCR using the primers KU146 and KU145. The resulting product was subcloned into BamHI/KpnI-digested pRS416, resulting in plasmid pBM34.

Table 1.

Primers used for different Pex1p, Pex6p, and Pex15p constructs

KU142 5′GGAGGATCCGTCGACAATGACGACGACCAAGA3′
KU143 5′TCTAAGCTTGAGCTCTTTCACATAAGGGAGAGTCG3′
KU144 5′TTAGGATCCGTCGACTATGAAGGCATCGCTTACG3′
KU145 5′CCGGGTACCTCTAGAATCTGCACGGATATCGAG3′
KU146 5′GCAGGATCCGTCGACAAAGCTCACTGATAGACGAAGA3′
KU234 5′GCGGATCCCCAGGACTCGAAACAGTAATATCATTGTT3′
KU296 5′ACCCCGGGTTGAATTCAGATGGCTGCAAGTGAGATA3′
KU484 5′CTGTACATAGGTGGCTGTC3′
KU542 5′GAAAGATACGCAGTCTCTGTGC3′
KU544 5′GTGTGGATGGCTTCCGC3′
KU549 5′CCCGCATGCGTCGACAGCACCTTCAAAATTAGCTC3′
KU569 5′CGGTCTCGCATGAAGGCATCGCTTACG3′
KU626 5′CCGCATGCGGCCGCTCATTCGTTCCTAGCTTTCGAAG3′
KU654 5′GCGAATTCGGATCCGGAATGGCTGCAAGTGAG3′
KU660 5′CCTTTAACAAAATCAATACCATCGATATCATCCCAAGTTACG3′
KU661 5′CAGGAACTACATTTGTTGGCTCCG3′
KU662 5′AGTACTAGTTAGGGTAATGGTCTTCTGTTAG3′
KU663 5′CAGCTGTCGACGATGATCACTAACAGAAGACCATTACCC3′
KU664 5′CAGCTGTCGACGATGGATTTATCAAAAGCTACTTCG3′
KU665 5′GCATGCGGCCGCTTAAGCACCTTCAAAATTAGCTC3′
KU670 5′GCATGCGCGGCCGCCTAAAGGGAACAAAAGCTGG3′
KU681 5′GGACGGCAGTAACAAGAAACACCTGAGGAACTGCTCTTTCAACAGCTGAAGCTTCGTACGCT3′
KU682 5′CAGCCGCATTTTTTGCCCTTTAAAGGGAAACGCGCTTTGTTCATAGGCCAAGTGGATCTG3′
KU698 5′CGTGTTAACTAGTTTAAGCACCTTCAAAATT3′
KU707 5′AGGGARCCGACGTGTAACAGTGTTAAACCTAATTTGG3′
KU708 5′TACCCGGGTAGAATTCGCATGCTGCAGAGTGAGATTTTG3′
KU709 5′AGGGATCCGAGCTCTAAGGGTTTTTTATGATGCAG3′
KU710 5′TACCCGGGTAGAATTCGCATGAAACCCTCACCGAATATG3′
KU711 5′GTCCTGCGTGCTCGCACA3′
KU727 5′ATCCGCGGATCCGGGTAATGGTCTTCTGTTAG3′
KU728 5′CCGAATTCGGATCCGATTTATCAAAAGCTACTTCG3′
KU746 5′TACCCGGGTAGAATTCGCATGGTGAACCTTTTCATAAAAAG3′
KU747 5′AGGGATCCGAGCTCTAAAGTTAAGTTAAACTGAATAACC3′
KU1353 5′CTACAAACAATGTGGGCGCCGCTACAATGGTGAGATTTGC3′
KU1354 5′GCAAATCTCACCATTGTAGCGGCGCCCACATTGTTTGTAG3′
AS1 5′CCACCGGGTACAGGTGCAACTCTAATGGCTAAGG3′
AS2 5′CCTTAGCCATTAGAGTTGCACCTGTACCCGGTGG3′
AS3 5′CCTTGTGTCATATTTTTCGATCAAATCGATTCAGTAGCACCC3′
AS4 5′GGGTGCTACTGAATCGATTTGATCGAAAAATATGACACAAGG3′
AS5 5′GGATCCATGGCTGCAAGTGAGATAATGAAC3′
AS6 5′AAAGCTCCACCGCGGTGG3′

Further expression constructs were based on YEplac33 (Gietz and Sugino, 1988), with the PEX6 or the PEX5 promoter cloned in EcoRI/SacI, the GFP fusion protein in SacI/BamHI, and the PEX6 (wild-type or mutated) in BamHI/SalI. The NH-Pex15p construct was based on YCplac22 (Gietz and Sugino, 1988), with the catalase promoter between the EcoRI and SacI site, the NH-tag in SacI/BamHI, and the PEX15 ORF in BamHI/HindIII. Mutations were introduced using the Stratagene QuickChange site-directed mutagenesis kit, primers were AS1 and AS2 introducing the K778A mutation (named pIB6/39), AS3 and AS4 introducing the E832Q mutation (pIB6/40), and KU1353 and KU1354 introducing the PEX6K489A mutation (pIB6/38). ORFs and promoter sequences were amplified by PCR using specific primers introducing restriction sites (Elgersma et al., 1997). Cloning of pex15.1 and pex15.3 in an expression vector was performed by digestion with BamHI and PstI and by cloning of the resulting insert in a YCplac22-based vector that contained the wild-type PEX15 (BamHI/HindIII) preceded by the catalase promoter (in EcoRI site). An expression construct of pex15.2 was generated by transforming both a BamHI/HindIII pex15.2 ORF and the PstI-linearized vector (same as for pex15.1 and pex15.3) to pex15Δ cells. Homologous recombination of the two fragments resulted in an expression plasmid, which was rescued from yeast and analyzed for the presence of the pex15.2 mutations by sequencing.

For two-hybrid studies the PEX15 and PEX6 ORFs and fragments of both were cloned into the DNA-binding domain containing plasmid pPC86 and the transcription activation domain containing pPC97 (Chevray and Nathans, 1992). PEX15 fragment encoding aa1–315 was amplified by PCR using primers KU296/KU234 and pWG15/1 as template and subcloned EcoRI/SacI into pPC86. The PEX6 ORF was amplified by PCR using primers KU144 and KU145 (template pBM34) and cloned into pPC97 by a SalI site derived from the primer and a genomic SpeI site downstream of the stop codon (pBM21). For PEX6A1 the BglII/SpeI fragment from plasmid pIB6/38 was used to replace the corresponding fragment of plasmid pIB6/4, resulting in plasmid pIB6/18. The PEX6A2 was cloned in pPC97 replacing SpeI/BglII fragment of plasmid pIB6/39 by the corresponding fragment of plasmid pIB6/4, resulting in the plasmid pIB6/11. For PEX6B2 the NcoI/SpeI fragment of plasmid pIB6/40 was used to replace the corresponding fragment of plasmid pBM21, resulting in plasmid pIB6/4.

Truncated versions of PEX6 were created as follows: The N-terminus (aa1–428), the first domain (aa421–716), and the second domain (aa704–1030) of the PEX6 ORF were amplified from pBM34 using the primers KU144 and KU662, KU663 and KU626, KU664 and KU665, respectively. The PCR fragments, which were used for expression of the N-terminus and the second domain, were digested at the primer derived SalI/SpeI sites. SalI and NotI were used for subcloning the first domain. All fragments were inserted into the corresponding sites of the plasmid pIB6/4. The resulting plasmids were designated pIB6/21, pIB6/22, and pIB6/23, respectively. Three further truncated versions of PEX6 were generated by combining the N-terminus and first domain (pIB6/33), the N-terminus and second domain (pIB6/28), and the first and second domain (pIB6/29). Plasmid pIB6/33 was obtained by NdeI/NotI digestion of plasmid pIB6/22 and ligation with NdeI/NotI-digested plasmid pIB6/4. For plasmid pIB6/28 the N-terminal part of Pex6p was amplified using primers KU144 and KU727. The coding sequence for the second domain was amplified using primers KU728 and KU698. Subcloning of the two parts into the SalI/SpeI-digested pPC97 was performed using SalI and BamHI (N-terminus) and BamHI and SpeI (D2). For plasmid pIB6/29 the first domain of Pex6p was amplified using primers KU663 and KU660 and the second domain using KU544 and KU698. Subcloning of the two parts into the SalI/SpeI-digested pPC97 was performed using SalI and EcoRI (D1) and EcoRI and SpeI (D2).

Truncated versions of PEX15 were created after restriction with EcoRI/SacI of PCR products made with the following primers using pWG15/1 as template: PEX15(aa1–103) KU296-KU707, PEX15(aa103–207) KU708-KU709, PEX15(aa206–315) KU710-KU234, PEX15(aa103–315) KU708-KU234, PEX15(aa1–207) KU296-KU709, PEX15(aa49–151) KU746-KU747, PEX15(aa49–207) KU746-KU709, PEX15(aa1–151) KU296-KU747, and PEX15(aa49–103) KU746-KU707. All fragments were inserted in the corresponding sites of the two-hybrid vector pPC86. A library of randomly mutagenized PEX15(aa1–329) was created by gap repair (Bottger et al., 2000). PCR was performed with primers AS5 and AS6, and pPC86-pex15ΔC55 (Elgersma et al., 1997) was used as a template. The PCR product was transformed into HF7c cells together with a linearized plasmid pPC86 with overlapping regions of the pex15ΔC55 (Elgersma et al., 1997) resulting in circular plasmids produced by homologous recombination. The colonies that failed to grow in the absence of histidine were selected, and PEX15 mutant plasmids were rescued from these colonies for further analysis.

The PEX1 ORF was amplified from pRC123 (Erdmann et al., 1991) by PCR using the primers Ku142 and Ku143 and was cloned by primer derived SalI and SacI sites into pPC86 (pIB1/31).

To construct PEX6-His6 (pIB6/9) two PEX6-fragments were amplified by PCR using KU569 and KU542 and KU549 and Ku661 and pBM34 as template. After restriction with BsaI and NdeI and SalI and NdeI, respectively, the fragments were ligated with the NcoI/SalI fragment of pET21d. GST-Pex15p(aa1–315) (pIB15/1) was constructed using the primer derived BamHI and NotI restriction sites (KU654 and KU670 and pWG15/1 as template) and replacing the corresponding BamHI/NotI fragment of pGEX-4T-3 (Amersham Biosciences, Freiburg, Germany).

For overexpression of GFP-GST fusion protein, the GFP ORF was subcloned SmaI/EcoRI from pGFP (BD Biosciences, Erembodegem, Belgium) into pbluescript (Stratagene, La Jolla, CA), resulting into plasmids pSkG3, and from there finally cloned SmaI/XhoI into pGEX-4T-3 (Amersham Biosciences), resulting in plasmid pGEXGFP. The fusion protein was overexpressed in E. coli TG1 and purified as soluble fusion-protein according to the manufacturer's instructions (Amersham Biosciences).

All point mutations used were confirmed by DNA sequencing. Recombinant DNA techniques, including enzymatic modification of DNA, fragment purification, bacterial transformation, and plasmid isolation were performed as described elsewhere (Maniatis et al., 1982; Ausubel et al., 1992).

Antibodies

Rabbit polyclonal anti-Pex6p antibodies were raised against a synthetic peptide (KLLYLGIPDTDTKQLN) corresponding to amino acids 895–910 generated by Eurogentec (Seraing, Belgium).

Anti-GFP was kindly provided by J. Fransen (Nijmegen, the Netherlands) and anti-NH by P. van der Sluijs (Utrecht, the Netherlands). Rabbit polyclonal antibodies to GST-GFP were produced by Eurogentec according to standard methods (Harlow and Lane, 1988). A further antibody used was anti-Pex15p (Elgersma et al., 1997). The secondary antibody used was anti-rabbit IgG-coupled HRP (Sigma, Taufkirchen, Germany) for Pex6p and GST detection.

Two-hybrid Analysis

The two-hybrid assay was based on the described method (Fields and Song, 1989). Cotransformation of two-hybrid vectors into the strain PCY2 was performed according to Gietz and Woods (1994). Transformed yeast cells were plated onto SD synthetic medium without tryptophane and leucine. β-Galactosidase filter assays were performed as described elsewhere (Rehling et al., 1996).

The library of randomly mutagenized PEX15(aa1–329) in pPC86 and pBM21 (PEX6 in pPC97) was transformed in HF7c. The presence of both plasmids was selected on glucose plates lacking leucine and tryptophane. The colonies that grew well on these plates were replica plated to plates lacking histidine. The growth on histidine-lacking plates was tested at 34°C to include possible temperature-sensitive mutants. The colonies that did not grow on these latter plates contained a mutated PEX15, which was unable to interact with Pex6p. To select for full-length PEX15 mutants, TCA lysates of these cells were made and analyzed by SDS-PAGE and Western blotting with antibodies against Pex15p. Three full-length PEX15 mutants in pPC86 were rescued from these yeast cells, and their sequences were analyzed.

In Vitro Protein Binding Assays

GST, GST-Pex15p(aa1–315), and Pex6p-His6 were expressed in E. coli BL21(DE3) and isolated as follows: Cells were harvested and diluted in PBS buffer (phosphate-buffered saline: 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.4 mM KH2PO4, pH 7.3), containing protease inhibitors (240 μg/ml PMSF, 2 μg/ml aprotinin, 5 μg/ml antipain, 1 μg/ml pepstatin, 2.5 μg/ml leupeptin, 6 μg/ml chymostatin, 0.21 mg/ml NaF), 0.5 mM DTT, 1 mM ATP, and 25 mM MgCl2). Cells were broken using a french press, and cell debris was removed after centrifugation (100,000 × g, 45 min). The supernatant containing the soluble proteins including GST-Pex15p or GST was loaded directly on a glutathione-Sepharose 4B (Amersham Biosciences) column equilibrated with PBS buffer. After intensive washing (PBS buffer), supernatant containing Pex6p-His6 was loaded on the column and after further intensive washing steps, the proteins were eluted from the column with 10 mM glutathione.

Microscopy

For immuno-electron microscopy (immuno-EM) experiments, oleate-induced cells were fixed with 2% paraformaldehyde and 0.5% glutaraldehyde. Immunolabeling of ultrathin cryosections with antibodies against GFP and NH was performed as described elsewhere (Gould et al., 1990).

Fractionations

Oleate-induced cells were subcellularly fractionated as described previously (Hettema et al., 1999). The sorbitol/phosphate and MES buffers used contained usually no EDTA. Fractionations were performed by centrifugation of lysed spheroplasted cells at 30,000 × g, at 4°C for 30 min.

RESULTS

Interaction between Pex6p and Pex15p

Over the last couple of years 29 proteins have been described to contribute to the biogenesis or maintenance of peroxisomes (http://www.mips.biochem.mpg.de/proj/yeast/reviews/pex_table.html). In a search to find possible interactions between these proteins (peroxins) in S. cerevisiae using the two-hybrid technique, we observed that Pex6p interacted with the cytoplasmic part (aa1–315) of Pex15p. Activation of the reporter gene lacZ, indicated by blue colonies on X-Gal medium, was observed when PEX6-GAL4-BD was coexpressed with PEX15-GAL4-AD in S. cerevisiae PCY2 cells (Figure 1A). The controls showed that coexpression of either of the fusion proteins, together with the respective Gal4p domains encoded by pPC86 and pPC97, did not support transcription activation of the reporter genes. The interaction between Pex6p and Pex1p, which was described for Pichia pastoris (Faber et al., 1998), Homo sapiens (Tamura et al., 1998), and Hansenula polymorpha (Kiel et al., 1999), could be detected in S. cerevisiae as well (our unpublished results). Furthermore in the absence of Pex1p (in PCY2 pex1Δ) Pex15p and Pex6p still showed interaction in the two-hybrid assay (Figure 1A).

Figure 1.

Figure 1.

Pex6p and Pex15p(1–315) interaction. (A) Two-hybrid interaction of Pex6p and Pex15p(aa1–315). PCY2 (rows 1, 3, and 4) and PCY2 pex1Δ (row 2) transformants expressing the indicated fusion protein combination of Pex6p or Pex15p were analyzed for β-galactosidase activity by a filter assay using X-gal as substrate. Three representative independent double transformants are shown (lanes 1–3). (B) In vitro binding studies using bacterially expressed Pex15p(aa1–315) and Pex6p fusion proteins. GST-Pex15p(aa1–315), Pex6p-His6, and GST were expressed in E. coli. GST and GST-Pex15p(aa1–315) were bound to glutathione-Sepharose and then the columns were incubated with E. coli extracts containing Pex6p-His6. Whole cell extracts (lanes 1 and 2) as well as proteins bound to and eluted from the column (lanes 3 and 4) were separated on SDS-PAGE and subjected to immunoblot analysis with antibodies against GST and Pex6p. Glutathione, 10 mM, was used for elution.

Because the interaction between Pex6p and Pex15p was detected in a homologous context, it was important to prove a direct interaction and exclude the possibility of a third partner acting as a bridge between Pex6p and Pex15p. We therefore synthesized a His-tagged PEX6 gene and expressed it in E. coli using the expression vector pET9d. The cytosolic part of Pex15p(aa1–315) was produced in E. coli as a fusion protein to glutathione-S-transferase (GST). GST-Pex15p(aa1–315) was bound to glutathione-agarose and was incubated with an extract containing overproduced Pex6p-His6. After washing with buffer, protein complexes were eluted from the column with glutathione and analyzed by Western blotting. The results presented in Figure 1B indicated that Pex6p-His6 exclusively bound to the GST-Pex15p(aa1–315) fusion protein. No binding was observed in control experiments, using GST bound to glutathione-Sepharose. These data demonstrate that the Pex6p/Pex15p interaction is a direct one and that it does not require an intermediary yeast protein.

Regions of Pex6p and Pex15p Involved in the Interaction

To find regions in Pex6p and Pex15p that are responsible for interaction, a number of different mutations were made and the effects on the mutual interaction were studied.

Various truncated parts of Pex6p (Figure 2A) were tested for their ability to bind the cytoplasmic part of Pex15p(aa1–315) in the two-hybrid system: the N-terminus (N, aa1–428), the first AAA cassette (D1, aa421–716) and the second AAA cassette (D2, aa704–1030). As judged by a low but significant lacZ gene expression, the N-terminus of Pex6p can mediate binding to Pex15p(aa1–315) (Figure 2A). The D1 or D2 domains of Pex6p showed no interaction (Figure 2B). Additionally, a Pex6p fragment consisting of the N-terminus and the first AAA cassette (N-D1) gave rise to a lacZ gene activation even stronger to that obtained with wild-type Pex6p (Figure 2A). In contrast a Pex6p fragment consisting of the N-terminus and the second AAA cassette (N-D2) showed the same weak lacZ gene activation as obtained with the N-terminus of Pex6p alone (Figure 2A).

Figure 2.

Figure 2.

Two-hybrid interaction of Pex6p and Pex15p(aa1–315). (A) PCY2 transformants expressing the indicated fusion protein combination of Pex6p truncations and Pex15p(aa1–315). The interactions were analyzed for β-galactosidase activity by filter assay using X-gal as substrate. Two representative independent double transformants are shown (lanes 1 + 2). (B) Schematic representation of two-hybrid interaction between Pex15p(aa1–315) and truncated versions of Pex6p. The two-hybrid constructs of N-terminal fragment, D1 fragment and D2 fragment overlap by 8 and 13 amino acids, respectively. For simplicity these amino acids are not indicated in the schematic presentation of these fragments.

Similar studies with truncated versions of Pex15p showed that the N-terminal part of Pex15p(aa1–151) is sufficient for interacting with Pex6p (Figure 3A). To complement the protein truncation mutants with more subtle point mutations, a mutant library was made by error prone PCR of the first part of Pex15p(aa1–329). PEX15 mutants defective in interaction with Pex6p in the two-hybrid trap were selected, and mutants were chosen that still gave rise to full-length protein on the basis of Western blot analysis. This screen resulted in two temperature-sensitive mutants (pex15.1/pex15.3) that showed a disturbed growth phenotype at 34°C and one that did not grow on oleate at both temperatures (18°C and 34°C) (pex15.2; Figure 3B). The plasmids containing a mutated PEX15 gene were rescued from yeast and their sequence was determined. All mutations were found in the smallest fragment (aa1–151) of Pex15p (Table 2), which still interacted with Pex6p in the two-hybrid assay. Moreover, this result indicates that the amino acids at positions 22, 47, and/or 50 of Pex15p are important for the interaction of Pex15p with Pex6p.

Figure 3.

Figure 3.

Effects of different Pex15p mutants. (A) Two-hybrid interaction of Pex6p and Pex15p truncations. PCY2 transformants expressing the indicated fusion protein combination of Pex15p truncations and Pex6p. The interactions were analyzed for β-galactosidase activity by filter assay using X-gal as substrate. Three representative independent double transformants are shown (lanes 1–3). (B) Growth on selective oleate of wild-type (pex15Δ cells with plasmid based expression of PEX15), pex15Δ cells and pex15Δ cells with plasmid based expression of pex15.1, 15.2 and 15.3 at 18°C and 34°C. Equal amounts of cells were spotted.

Table 2.

Mutations found in 3 PEX15 mutants that lost their capacity to interact with Pex6p in a two-hybrid assay

Mutant name nt Mutation aa Mutation Change in aa
Mutant 15.1 nt 66 A→T aa 22 L→F Small→big
Mutant 15.2 nt 65 T→C aa 22 L→S Apolar→polar
nt 393 A→G aa 131 K→K
Mutant 15.3 nt 140 T→A aa 47 Q→L Hydrophilic→hydrophobic
nt 149 T→C aa 50 V→A Small difference

Different Effects of the Two AAA Domains of Pex6p on the Interaction with Pex15p

The contribution of Pex6p and Pex15p to peroxisome biogenesis is well established on the basis of the phenotypes of the null mutants. Both pex6Δ (Hettema et al., 1999) and pex15Δ (Elgersma et al., 1997) mutants show a characteristic pex phenotype with only residual, ghost-like peroxisomal structures. Here we analyzed the effects of more subtle alterations in Pex6p and Pex15p.

The AAA peroxin Pex6p contains two AAA cassettes (D1 and D2) and thus two consensus ATP-binding sites. To determine whether these cassettes are essential for peroxisome biogenesis we used site-directed mutagenesis to create mutants with point mutations in Walker A (A mutants) or Walker B (B mutants) motifs of either the first or the second cassette. The resulting mutants were designated: Pex6pA1(K489A), Pex6pA2(K778A), and Pex6pB2(D831Q/E832Q). It was not necessary to create a B1 point mutation because wild-type Pex6p contains an alanine instead of the critical aspartate (aa548) strongly suggesting that D1 can bind but not hydrolyze ATP.

We tested the mutant constructs with (Figure 4A) or without (our unpublished results) a GFP fusion protein using the oleate plate assay (functional test for peroxisome biogenesis) for their ability to complement the pex phenotype of the pex6 null mutant. Addition of this fusion protein does not influence the function of Pex6p because GFP-Pex6p is fully capable of restoring growth on oleate in a strain with a pex6 deletion. As demonstrated in Figure 4A, the pex6 null mutant expressing Pex6p mutated at the first ATP-binding site (A1) showed the wild-type phenotype with respect to growth on oleic acid medium. In contrast, the pex6 null mutants expressing Pex6p mutated at the second ATP-binding or -hydrolysis site (A2 and B2) were not able to grow on oleic acid as sole carbon source (Figure 4A). Although some small colonies can be observed, oleate consumption is completely abolished (halo formation). This was confirmed by growth on oleate in liquid culture (our unpublished results).

Figure 4.

Figure 4.

Effects of mutated PEX6. (A) Growth behavior on oleic acid medium (YNO) of wild-type, pex6Δ and pex6Δ expressing wild-type or point mutated GFP-Pex6p. Growth on YNO agar plates is indicated by a typical halo reflecting the consumption of oleic acid. (B) Two-hybrid interaction between Pex6p point mutations and Pex15p(aa1–315). PCY2 transformants expressing the indicated fusion protein combination of Pex6p point mutations and Pex15p(aa1–315) were analyzed for β-galactosidase activity by filter assay using X-gal as substrate. Three representative independent double transformants are shown (lanes 1–3).

To investigate whether ATP-binding and/or -hydrolysis is critical not only for growth on oleate but also for the described Pex6p/Pex15p interaction we introduced the various mutant forms of Pex6p carrying point mutations in the ATP-binding and -hydrolysis sites of both AAA cassettes into two-hybrid vectors and tested the interaction with Pex15p(aa1–315). Compared with wild-type Pex6p, only the A1 mutation of the Walker A motif in the first AAA domain (D1) resulted in a clearly reduced interaction with Pex15p(aa1–315) (Figure 4B). These results demonstrate that the ability of the first AAA cassette of Pex6p to bind ATP, considerably strengthened the interaction of Pex6p and Pex15p.

Interplay between Pex6p and Pex15p in Relation to Their Cellular Location

Endogenous (full-length) Pex15p can only be detected on peroxisomal membranes (Elgersma et al., 1997). The localization of Pex6p as studied in several organisms by various techniques is controversial. Pex6p contains two putative transmembrane domains and some reports describe it as a membrane or membrane-associated protein; others, however, as a partially cytosolic protein. To distinguish between these alternatives, we used two distinct techniques employing Pex6p fused to GFP at its N-terminus.

First, we fractionated pex6Δ cells expressing GFP-Pex6p in a 30,000 × g organellar pellet and a cytosolic supernatant. GFP-Pex6p was found to be mainly (∼90%) present in the supernatant (Figure 5). This suggests that Pex6p is for the largest part or period of time cytosolic and for a smaller part or period bound to or inside organelles. Fractionation experiments were also carried out with strains carrying mutations in the ATP-binding sites of Pex6p. The membrane-bound fraction of GFP-Pex6pA1 (∼1%) was even considerably smaller than that of GFP-Pex6p. After fractionation of GFP-Pex6pA2 or GFP-Pex6pB2 cells, however, larger fractions of Pex6p were pelletable (25 and 32%, respectively; Figure 5). The same was true when Pex15p was overexpressed (Figure 5). Thus, a larger fraction of Pex6p is organelle bound when either the A2 or B2 mutation or an excess of Pex15p is present.

Figure 5.

Figure 5.

Localization of mutated PEX6. (A) PNS prepared from oleate-grown pex6Δ cells expressing GFP-tagged Pex6p, Pex6pA1, Pex6pA2, Pex6pB2 or both GFP-Pex6p and NH-Pex15p was subjected to centrifugation. Equal volumes of PNS, 30,000 × g pellet (30,000 × g P) or supernatant (30,000 × g S) were loaded on each lane and analyzed by Western blot analysis with antibody to Pex6p. (B) Densitometric analysis of signal intensity for Western blots depicted in A. For each yeast strain pellet and supernatant together were set to 100%. Dark bars represent the 30,000 × g pellet (P) and gray bars the 30,000 × g supernatant (S). The results represent the mean of three independent experiments.

Second, we studied the localization of Pex6p with immuno-EM (Figure 6). With antibodies against the GFP fusion protein we visualized wild-type and mutated GFP-Pex6 proteins (Figure 6, A–D), which were expressed under control of the weak PEX5 promoter in pex6Δ cells (when using the PEX6 promoter, no labeling could be achieved). GFP-Pex6p (Figure 6A) and GFP-Pex6pB2 (Figure 6B) were located in the area of cells in which peroxisomes and peroxisomal ghosts, respectively, were present; however, no labeling was seen on the peroxisomal membranes themselves. GFP-Pex6p and GFP-Pex6pB2 might be present in the cytosol or in/on membrane structures distinct from peroxisomes or peroxisomal ghosts, which we indicate as “clouds” of GFP-Pex6p. When the amount of Pex15p was increased (by expressing NH-Pex15p under the control of the catalase promoter) in pex6Δ cells containing GFP-Pex6p (Figure 6C) or GFP-Pex6pB2 (Figure 6D), the localization of GFP-Pex6 proteins changed: they were mainly on peroxisomal membranes. In addition to this effect on Pex6 protein localization we also noticed that the peroxisomes (Figure 6C) were often surrounded by double membranes. GFP-Pex6p was found on double as well as on single peroxisomal membranes. Overexpressed NH-Pex15p, visualized by anti-NH antibodies, was found on very similar structures as GFP-Pex6p (Figure 6E) and GFP-Pex6pB2 (Figure 6F). These results confirm that in vivo the level of Pex15p has an effect on the cellular distribution of Pex6p and are in line with the conclusion that Pex15p provides a membrane anchor for Pex6p.

Figure 6.

Figure 6.

Electron microscopic analysis of the location of Pex6p in oleate-grown pex6Δ cells expressing GFP-Pex6p (A, C, and E) and GFP-Pex6pB2 (B, D, and F) without (A and B) and with coexpression of NH-Pex15p behind the catalase promoter (C–F). The localization of NH-Pex15p is shown (E and F). Immuno-EM was performed with anti-GFP (A–D) and anti-NH (E and F). Bar, 0.25 μm.

Combined, these results support the notion that Pex6p has a dual localization: it is partially peroxisome bound via Pex15p, whereas the largest part is cytosolic. Whether this cytosolic part represents free or structurally bound Pex6p, for instance in the form of very small vesicles, could not be established unambiguously.

DISCUSSION

Insight into the mode of action of the AAA peroxin Pex6p is an important step toward a molecular understanding of peroxisome biogenesis and especially toward the energy requirements of this process. A central result is that Pex6p is targeted to peroxisomal membranes by binding to the cytoplasmic part of the integral peroxisomal membrane protein Pex15p. This is supported by the following evidence: 1) The N-terminal cytoplasmic part of Pex15p(aa1–315) interacted in the yeast two-hybrid assay with the N-terminal region of Pex6p (N in Figure 7), whereas the D1, D2, and D1+ D2 fragments gave negative results. The binding site for this interaction in Pex15p could be limited to amino acid residues 1–151. This result is supported by the location of three point mutations, which were all located within this area. These temperature-sensitive mutants showed no interaction with Pex6p and exhibited no growth on oleate at the nonpermissive temperature. 2) This interaction is direct because it could be reconstituted in vitro with proteins expressed in E. coli. This central finding functionally interconnects the hitherto unrelated two peroxins Pex6p and Pex15p by showing that they are physical partners in one of the many distinct steps of peroxisome biogenesis.

Figure 7.

Figure 7.

Schematic representation of interaction between Pex15p and Pex6p. The N-terminus of Pex15p interacts with the N-terminal part of Pex6p, an interaction which is stimulated by ATP-binding to the first AAA domain (A1) of Pex6p. On the other side hydrolysis of ATP by the second AAA domain of Pex6p (B2) stimulates release of Pex6p from Pex15p.

The binding of Pex15p and Pex6p was analyzed in further depth by a combination of specific mutations in Pex6p and their in vivo effect on growth on oleate. From the two-hybrid interaction studies it is clear that although the N-terminal part of Pex6p alone shows weakened but demonstrable intrinsic binding activity to Pex15p, a longer version of Pex6p, containing both the N-terminal part and D1, interacts even stronger than complete Pex6p. In contrast, the mutation A1, replacing the conserved lysine by a glutamate in the D1 Walker A motif of full-length Pex6p, lowers the binding activity of Pex6p to Pex15p to the intrinsic level of the N-terminal region alone. This is apparently good enough for residual function in vivo because this mutation does not affect the growth of the mutant cells on oleate. Because wild-type Pex6p does not have the critical active-site residue (D replaced by A) from the Walker B motif of D1, we conclude from our findings that ATP bound to D1 acts as an allosteric activator to increase the binding capacity to Pex15p.

Two different mutations were chosen to inactivate the D2 cassette of Pex6p in analogy to reported mutations of NSF (Whiteheart and Kubalek, 1995): one preventing ATP-binding (A2), and the other preventing ATP-hydrolysis (B2). Functionally, we could not distinguish between them. Both mutations in D2 completely abolish growth on oleate, but did not reduce the binding of Pex6p and Pex15p found in the yeast two-hybrid assay. In addition, we observed that cells carrying a PEX6 allele with either one of the two mutations (A2 or B2) after fractionation contain more Pex6p in the crude organellar fraction, suggesting that ATP-hydrolysis catalyzed by D2 is required to dissociate Pex6p from Pex15p. Taking together, these findings demonstrate that D1 and D2 have not only different functions in the overall process of peroxisome biogenesis but also in the binding of Pex6p and Pex15p.

Although we have not strictly proven the reversibility of the interaction between Pex15p and Pex6p, the following observations favor this proposal: (a) In cell fractionation experiments the amount of structurally bound Pex6p correlates with the amount of Pex15p in cells. Furthermore, Pex6p with a mutation in the first ATP-binding cassette (D1) behaves almost exclusively as a cytosolic protein. (b) These observations are qualitatively confirmed by morphological observations with immuno-EM. Membrane-bound Pex6p correlates with the amount of Pex15p. Because Pex15p is an integral peroxisomal membrane protein (Elgersma et al., 1997), it is very likely that the membrane-bound Pex6p is associated with peroxisomal membranes.

On the basis of our data and published work, we would like to propose that Pex6p exerts at least part of its function by an ATP-dependent cycle of binding to and release from Pex15p (Figure 7). The three parts of Pex6p have distinct roles in this interaction. Although the N-terminal part provides the binding site for Pex15p, the two AAA cassettes have opposing roles. ATP-binding to D1 is needed to strengthen the interaction of Pex6p with Pex15p, whereas ATP-hydrolysis by D2 is required to disconnect Pex6p from Pex15p. Interestingly, the interaction of the membrane protein Pex15p with Pex6p and its various mutants observed using the two-hybrid technique was independent of Pex1p. However, this does not exclude the possibility that the latter could be involved in vivo.

A comparison of our proposal and the function established for NSF (May et al., 2001), one of the best studied member of the AAA family, suggests the possibility that, in analogy to the dissociation of SNAREs mediated by NSF, Pex6p dissociates Pex15p from a membrane-bound complex in an ATP-dependent manner and that unassembled Pex15p fulfills an essential function. An ATP-dependent binding and release of Pex6p from a peroxisomal vesicle population was recently reported in Y. lipolytica (Titorenko and Rachubinski, 2000) and shown to lead to the priming of a distinct peroxisomal vesicle population required for a subsequent fusion event.

As an alternative to involvement in vesicle fusion it is also conceivable that Pex6p alone or via Pex15p is associated with a proposed import complex (Collins et al., 2000) and may thus provide the reported ATP-dependence of peroxisomal import of matrix proteins (Bellion and Goodman, 1987; Rapp et al., 1993; Wendland and Subramani, 1993). These possibilities are fertile ground for future research aimed to understand the processes that are supported by the interaction between Pex6p and Pex15p.

Acknowledgments

We thank Wolfgang Girzalsky (Bochum), Ben Distel (Amsterdam), and Ewald Hettema (Amsterdam) for helpful discussions. We are indebted to Sigrid Wüthrich for technical help. This work was supported by the SFB 480 (Teilprojekt B1) and a grant from the Netherlands Organization of Scientific Research (NWO).

References

  1. Ausubel, F.J., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. (1992). Current protocols in molecular biology. New York: Greene Publishing Associates.
  2. Bellion, E., and Goodman, J.M. (1987). Proton ionophores prevent assembly of a peroxisomal protein. Cell 48, 165-173. [DOI] [PubMed] [Google Scholar]
  3. Beyer, A. (1997). Sequence analysis of the AAA protein family. Protein Sci. 6, 2043-2058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bottger, G., Barnett, P., Klein, A.T., Kragt, A., Tabak, H.F., and Distel, B. (2000). Saccharomyces cerevisiae PTS1 receptor Pex5p interacts with the SH3 domain of the peroxisomal membrane protein Pex13p in an unconventional, non-PXXP-related manner. Mol. Biol. Cell 11, 3963-3976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Braverman, N., Dodt, G., Gould, S.J., and Valle, D. (1995). Disorders of peroxisome biogenesis. Hum. Mol. Genet. 4, 1791-1798. [DOI] [PubMed] [Google Scholar]
  6. Chevray, P.M., and Nathans, D. (1992). Protein interaction cloning in yeast: identification of mammalian proteins that react with the leucine zipper of Jun. Proc. Natl. Acad. Sci. USA 89, 5789-5793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Collins, C.S., Kalish, J.E., Morrell, J.C., McCaffery, J.M., and Gould, S.J. (2000). The peroxisome biogenesis factors pex4p, pex22p, pex1p, and pex6p act in the terminal steps of peroxisomal matrix protein import. Mol. Cell. Biol. 20, 7516-7526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dodt, G., Braverman, N., Wong, C., Moser, A., Moser, H.W., Watkins, P., Valle, D., and Gould, S.J. (1995). Mutations in the PTS1 receptor gene, PXR1, define complementation group 2 of the peroxisome biogenesis disorders. Nat. Genet. 9, 115-125. [DOI] [PubMed] [Google Scholar]
  9. Elgersma, Y., Kwast, L., van den Berg, M., Snyder, W.B., Distel, B., Subramani, S., and Tabak, H.F. (1997). Overexpression of Pex15p, a phosphorylated peroxisomal integral membrane protein required for peroxisome assembly in S. cerevisiae, causes proliferation of the endoplasmic reticulum membrane. EMBO J. 16, 7326-7341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Erdmann, R., Veenhuis, M., and Kunau, W.-H. (1997). Peroxisomes: organelles at the crossroads. Trends Cell Biol. 7, 400-407. [DOI] [PubMed] [Google Scholar]
  11. Erdmann, R., Veenhuis, M., Mertens, D., and Kunau, W.-H. (1989). Isolation of peroxisome-deficient mutants of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 86, 5419-5423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Erdmann, R., Wiebel, F.F., Flessau, A., Rytka, J., Beyer, A., Fröhlich, K.U., and Kunau, W.-H. (1991). PAS1, a yeast gene required for peroxisome biogenesis, encodes a member of a novel family of putative ATPases. Cell 64, 499-510. [DOI] [PubMed] [Google Scholar]
  13. Faber, K.N., Heyman, J.A., and Subramani, S. (1998). Two AAA family peroxins, PpPex1p and PpPex6p, interact with each other in an ATP-dependent manner and are associated with different subcellular membranous structures distinct from peroxisomes. Mol. Cell. Biol. 18, 936-943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fields, S., and Song, O.K. (1989). A novel genetic system to detect protein-protein interactions. Nature 340, 245-246. [DOI] [PubMed] [Google Scholar]
  15. Fujiki, Y. (1997). Molecular defects in genetic diseases of peroxisomes. Biochim. Biophys. Acta 1361, 235-250. [DOI] [PubMed] [Google Scholar]
  16. Fujiki, Y. (2000). Peroxisome biogenesis and peroxisome biogenesis disorders. FEBS Lett. 23791, 1-5. [DOI] [PubMed] [Google Scholar]
  17. Gietz, R.D., and Sugino, A. (1988). New yeast-E. coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74, 527-534. [DOI] [PubMed] [Google Scholar]
  18. Gietz, R.D., and Woods, R.A. (1994). High efficiency transformation in yeast. In: Molecular Genetics of Yeast: Practical Approaches, ed. J.A. Johnston, New York: Oxford University Press, 121-134.
  19. Gould, S.J., Keller, G.A., Schneider, M., Howell, S.H., Garrard, L.J., Goodman, J.M., Distel, B., Tabak, H., and Subramani, S. (1990). Peroxisomal protein import is conserved between yeast, plants, insects and mammals. EMBO J. 9, 85-90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gould, S.J., and Valle, D. (2000). Peroxisome biogenesis disorders. Trends Genet. 16, 340-345. [DOI] [PubMed] [Google Scholar]
  21. Harlow, E., and Lane, D. (1988). Antibodies: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
  22. Hattendorf, D.A., and Lindquist, S.L. (2002). Cooperative kinetics of both Hsp104 ATPase domains and interdomain communication revealed by AAA sensor-1 mutants. EMBO J. 21, 12-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hettema, E.H., Distel, B., and Tabak, H.F. (1999). Import of proteins into peroxisomes. Biochim. Biophys. Acta 1451, 17-34. [DOI] [PubMed] [Google Scholar]
  24. Imanaka, T., Small, G.M., and Lazarow, P.B. (1987). Translocation of acyl-CoA oxidase into peroxisomes requires ATP hydrolysis but not a membrane potential. J. Cell Biol. 105, 2915-2922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kiel, J.A., Hilbrands, R.E., van der Klei, I.J., Rasmussen, S.W., Salomons, F.A., van der Heide, M., Faber, K.N., Cregg, J.M., and Veenhuis, M. (1999). Hansenula polymorpha Pex1p and Pex6p are peroxisome-associated AAA proteins that functionally and physically interact. Yeast 15, 1059-1078. [DOI] [PubMed] [Google Scholar]
  26. Kunau, W.-H., Beyer, A., Franken, T., Götte, K., Marzioch, M., Saidowsky, J., Skaletz-Rorowski, A., and Wiebel, F.F. (1993). Two complementary approaches to study peroxisome biogenesis in Saccharomyces cerevisiae: forward and reversed genetics. Biochimie 75, 209-224. [DOI] [PubMed] [Google Scholar]
  27. Lazarow, P.B. (1993). Genetic approaches to study peroxisome biogenesis. Trends Cell Biol. 157, 105-132. [DOI] [PubMed] [Google Scholar]
  28. Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
  29. Matveeva, E.A., He, P., and Whiteheart, S.W. (1997). N-ethylmaleimide-sensitive fusion protein contains high and low affinity ATP-binding sites that are functionally distinct. J. Biol. Chem. 272, 26413-26418. [DOI] [PubMed] [Google Scholar]
  30. May, A.P., Whiteheart, S.W., and Weis, W.I. (2001). Unraveling the mechanism of the vesicle transport ATPase NSF, the N-ethylmaleimide-sensitive factor. J. Biol. Chem. 276, 21991-21994. [DOI] [PubMed] [Google Scholar]
  31. Moser, H.W. (1993). Peroxisomal diseases. Adv. Hum. Genet. 21, 1-106 and 443-451. [PubMed] [Google Scholar]
  32. Patel, S., and Latterich, M. (1998). The AAA team: related ATPases with diverse functions. Trends Cell. Biol. 8, 65-71. [PubMed] [Google Scholar]
  33. Rapp, S., Soto, U., and Just, W.W. (1993). Import of firefly luciferase into peroxisomes of permeabilized Chinese hamster ovary cells: a model system to study peroxisomal protein import in vitro. Exp. Cell Res. 205, 59-65. [DOI] [PubMed] [Google Scholar]
  34. Rehling, P., Marzioch, M., Niesen, F., Wittke, E., Veenhuis, M., and Kunau, W.-H. (1996). The import receptor for the peroxisomal targeting signal 2 (PTS2) in Saccharomyces cerevisiae is encoded by the PAS7 gene. EMBO J. 15, 2901-2913. [PMC free article] [PubMed] [Google Scholar]
  35. Stroobants, A.K., Hettema, E.H., van den Berg, M., and Tabak, H.F. (1999). Enlargement of the endoplasmic reticulum membrane in Saccharomyces cerevisiae is not necessarily linked to the unfolded protein response via Ire1p. FEBS Lett. 453, 210-214. [DOI] [PubMed] [Google Scholar]
  36. Subramani, S., Koller, A., and Snyder, W.B. (2000). Import of peroxisomal matrix and membrane proteins. Annu. Rev. Biochem. 69, 399-418. [DOI] [PubMed] [Google Scholar]
  37. Tamura, S., Shimozawa, N., Suzuki, Y., Tsukamoto, T., Osumi, T., and Fujiki, Y. (1998). A cytoplasmic AAA family peroxin, Pex1p, interacts with Pex6p. Biochem. Biophys. Res. Commun. 245, 883-886. [DOI] [PubMed] [Google Scholar]
  38. Titorenko, V.I., and Rachubinski, R.A. (2000). Peroxisomal membrane fusion requires two AAA family ATPases, Pex1p and Pex6p. J. Cell Biol. 150, 881-886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Vale, R.D. (2000). AAA proteins. Lords of the ring. J. Cell Biol. 150, F13-F19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. van den Bosch, H., Schutgens, R.B., Wanders, R.J., and Tager, J.M. (1992). Biochemistry of peroxisomes. Annu. Rev. Biochem. 61, 157-197. [DOI] [PubMed] [Google Scholar]
  41. Voorn-Brouwer, T., van der Leij, I., Hemrika, W., Distel, B., and Tabak, H.F. (1993). Sequence of the PAS8 gene, the product of which is essential for biogenesis of peroxisomes in Saccharomyces cerevisiae. Biochem. Biophys. Acta 1216, 325-328. [DOI] [PubMed] [Google Scholar]
  42. Wach, A., Brachat, A., Pöhlmann, R., and Philippsen, P. (1994). New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10, 1793-1808. [DOI] [PubMed] [Google Scholar]
  43. Wanders, R.J., Schutgens, R.B., and Barth, P.G. (1995). Peroxisomal disorders: a review. J. Neuropathol. Exp. Neurol. 54, 726-739. [DOI] [PubMed] [Google Scholar]
  44. Wendland, M., and Subramani, S. (1993). Cytosol-dependent peroxisomal protein import in a permeabilized cell system. J. Cell Biol. 120, 675-685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Whiteheart, S.W., and Kubalek, E.W. (1995). SNAPs and NSF: general members of the fusion apparatus. Trends Cell Biol. 5, 64-68. [DOI] [PubMed] [Google Scholar]
  46. Zakalskiy, A., Hogenauer, G., Ishikawa, T., Wehrschutz-Sigl, E., Wendler, F., Teis, D., Zisser, G., Steven, A.C., and Bergler, H. (2002). Structural and enzymatic properties of the AAA protein Drg1p from Saccharomyces cerevisiae. Decoupling of intracellular function from ATPase activity and hexamerization. J. Biol. Chem. 277, 26788-26795. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Biology of the Cell are provided here courtesy of American Society for Cell Biology

RESOURCES