Abstract
Aspergillus fumigatus excretes the fusarinine-type siderophore desferri-triacetylfusarinine C (DF-TafC) to mobilize iron. DF-TafC is a cyclic peptide consisting of three N5-cis-anhydromevalonyl-N5-hydroxy-N2-acetyl-l-ornithine residues linked by ester bonds; these linkages are in contrast to peptide linkages found for ferrichrome-type siderophores. Subsequent to the binding of iron and uptake, triacetylfusarinine C (TafC) is hydrolyzed, the cleavage products are excreted, and the iron is transferred to the metabolism or to the intracellular siderophore desferri-ferricrocin (DF-FC) for iron storage. Here we report the identification and characterization of the TafC esterase EstB, the first eukaryotic siderophore-degrading enzyme to be characterized at the molecular level. The encoding gene, estB, was found to be located in an iron-regulated gene cluster, indicating a role in iron metabolism. Deletion of estB in A. fumigatus eliminated TafC esterase activity of cellular extracts and caused increased intracellular accumulation of TafC and TafC hydrolysis products in vivo. Escherichia coli-expressed EstB displayed specific TafC esterase activity but did not hydrolyze fusarinine C, which has the same core structure as TafC but lacks three N2-acetyl residues. Localization of EstB via enhanced green fluorescent protein tagging suggested that TafC hydrolysis takes place in the cytoplasm. EstB abrogation reduced the intracellular transfer rate of iron from TafC to DF-FC and delayed iron sensing. Furthermore, EstB deficiency caused a decreased radial growth rate under iron-depleted but not iron-replete conditions. Taken together, these data suggest that EstB-mediated TafC hydrolysis optimizes but is not essential for TafC-mediated iron uptake in A. fumigatus.
Aspergillus fumigatus is a ubiquitous saprobic fungus, normally associated with decaying organic matter (3, 13). In addition, A. fumigatus has become the most important airborne fungal pathogen, causing life-threatening disease, particularly in immunocompromised patients (28).
The ability to acquire iron is essential for all fungi during both saprobic and pathogenic growth. While iron is one of the most abundant metals on earth, in aerobic environments it is present mostly as nearly insoluble compounds such as oxyhydroxide polymers. Consequently, the concentration of ferric iron in solution at neutral pH is probably not greater than 10−18 M (14). However, an excess of iron within cells can be deleterious, because of its potential to catalyze the generation of cell-damaging reactive oxygen species. Therefore, microbes have developed various highly regulated systems for the uptake and storage of iron (7, 23). A. fumigatus employs two high-affinity iron uptake systems, reductive iron assimilation and siderophore-assisted iron mobilization (27). Siderophores are low-molecular-mass ferric iron-specific chelators, and most fungi also utilize siderophores for intracellular iron storage (7). Recently, the siderophore system was shown to be essential for the virulence of A. fumigatus in a mouse model of invasive aspergillosis (27) as well as for the virulence of the plant pathogens Cochliobolus heterostrophus, Cochliobolus miyabeanus, Fusarium graminearum, and Alternaria brassicicola on different hosts (17). These findings sparked new interest in this poorly characterized fungal iron homeostasis-maintaining system.
A. fumigatus produces two major hydroxamate-type siderophores: the fusarinine desferri-triacetylfusarinine C (DF-TafC) is excreted to mobilize extracellular iron, and the ferrichrome desferri-ferricrocin (DF-FC) is employed for intracellular iron storage (4, 5, 7, 16, 27). Production of both siderophores is up-regulated by iron starvation, and the A. fumigatus siderophore production resembles that of Aspergillus nidulans (16, 27). TafC is a cyclic tripeptide consisting of three N5-cis-anhydromevalonyl-N5-hydroxy-N2-acetyl-l-ornithine residues linked by ester bonds; these linkages are in contrast to peptide linkages found for ferrichromes such as DF-FC (Fig. 1). DF-FC is a cyclic hexapeptide with the structure Gly-Ser-Gly-(N5-acetyl-N5-hydroxy-l-ornithine)3 (7). Subsequent to the binding of iron and its uptake by specific ferric siderophore transporters (7, 19, 30), the ester bonds of triacetylfusarinine C (TafC) are hydrolyzed, the cleavage products (fusarinines) are excreted, and the iron is transferred to the metabolism or to the intracellular siderophore DF-FC for iron storage (Fig. 1). Hydrolysis of cyclic fusarinines decreases the affinity of the siderophore to iron and was therefore proposed to be required for intracellular iron release (6). Corresponding enzyme activities have been identified for Fusarium roseum, Penicillium chrysogenum, Mycelia sterilia EP-76, and A. nidulans (1, 6, 16). Production of the hydrolyzing esterases was found to be repressed by iron, but the respective enzymes have not been further characterized so far.
Release of iron by intracellular degradation of the chelating siderophore is also known for bacteria. Hydrolysis of the ester bonds of the catecholate enterobactin, a 2,3-dihydroxybenzoylserine macrotrilactone produced by enteric bacteria such as Escherichia coli and Salmonella enterica (25), by the esterase Fes is necessary for iron release, to make it available for general cell metabolism (2, 11, 12). Moreover, the Fes homologues IroD and IroE from S. enterica hydrolyze salmochelins, C-glycosylated enterobactin analogues (12, 33). Another Fes homologue from Erwinia chrysanthemi, CbsH, is involved in the cleavage of chrysobactin but is not essential for iron removal from this catecholate-type siderophore (24).
In this study we report the molecular analysis of the TafC esterase EstB and its role in the siderophore system of A. fumigatus.
MATERIALS AND METHODS
Growth conditions.
Generally, A. fumigatus strains (Table 1) were grown at 37°C in Aspergillus minimal medium (AMM) according to the work of Pontecorvo et al. (20); AMM contained 1% glucose as the carbon source, 20 mM glutamine as the nitrogen source, and 10 μM FeSO4 (+Fe). For iron-depleted conditions (−Fe), iron was omitted. Shake flask cultures were performed with 200 ml of medium in 1.0-liter Erlenmeyer flasks inoculated with 108 conidia.
TABLE 1.
Strain | Genotype | Source |
---|---|---|
WT | ATCC 46645 | American Type Culture Collection |
ΔestB | ATCC 46645; estB::hph | This work |
estBR | ΔestB; ΔestB::estB ble | This work |
estBgfp | ATCC 46645; estB::estB-egfp hph | This work |
Analysis of siderophore production.
Siderophores were isolated from A. fumigatus as described previously (16). Analysis of siderophore synthesis was performed by high-performance liquid chromatography (HPLC) analysis according to the work of Konetschny-Rapp et al. (9) as described previously (16).
Northern analysis.
RNA was isolated using TRI reagent (Sigma-Aldrich). Ten micrograms of total RNA was electrophoresed on 1.2% agarose-2.2 M formaldehyde gels and blotted onto Hybond N membranes (Amersham Biosciences). The hybridization probes used in this study were generated by PCR using the oligonucleotides oAfmirB1me and oAfmirB2me for Afu3g03640, oAfAt1me and oAfAt2me for Afu3g03650, oEstAf1 and oEstAf2 for Afu3g03660 (estB), oAbc4-1me and oAbc4-2me for Afu3g03670, and oTubfum1 and oTubfum2 for Afu5g11940 (tubA encoding β-tubulin). All oligonucleotides used in this study are listed in Table 2.
TABLE 2.
Gene | Oligonucleotide | Sequence (5′-3′)a | Gene reference |
---|---|---|---|
Afu3g03640 | oAfmirB1me | AAGCCGAGAAAAAGGGGG | 15 |
oAfmirB2me | AACCCAGATGAAGCCCAG | ||
Afu3g03650 | oAfAt1me | ACAATCAAGGCTCAGCCC | 15 |
oAfAt2me | ACTTCGAGTCATGCTGGG | ||
Afu3g03670 | oAbc4-1me | TGGAGCAGAGGTTGTCG | 15 |
oAbc4-2me | CCCGCCACTAATGAGATG | ||
Afu5g11940 | oTubfum1 | ATATGTTCCTCGTGCCGTTC | 15 |
oTubfum2 | CCTTACCACGGAAAATGGCA | ||
Afu3g03660 | oEstAf1 | CCGTCACCATGGGGGACAGGCCAAC1 | 15 |
oEstAf2 | GGTGGAGATCTCCCCGACTGGTGGAATG2 | ||
oEstAf3 | CAACCCACCTGTGCCTTC | ||
oEstAf4 | GTCAAGAGCTCTCGCCCC3 | ||
oEstAf9 | CAAGAATGGAGCAGCCTG | ||
oEstAf11 | GTGGCCATGGACCCCGACTGG1 | ||
oEstAf12 | CCAGTAAGCTTGAGTCTCCACCCGCGTTT4 | ||
oEstAf13 | GGCTGGTACCGACGGGAAGAGAAGCCTG5 |
Introduced restriction enzyme sites are underlined as follows: 1, NcoI; 2, BglII; 3, SacI; 4, HindIII; 5, KpnI.
Generation of A. fumigatus mutant strains.
A schematic presentation of the generation of the A. fumigatus mutant strains used in this study is given in Fig. 2.
For the inactivation of estB, a 3.9-kb fragment containing A. fumigatus estB was amplified from genomic DNA by PCR using primers oEstAf3 and oEstAf4. After cleavage with HindIII and SacI, the amplification product was inserted into the respective restriction enzyme site of the plasmid pBluescript-KS (Stratagene), yielding vector pEstB. An internal 0.35-kb NotI-StuI fragment was replaced by a 2.4-kb NotI-EcoRV fragment from pHph (a 2.3-kb AvrII-XbaI fragment carrying hph from plasmid pAN7-1 subcloned into the compatible restriction enzyme site SpeI from pBluescript), carrying the hygromycin B resistance marker gene hph (22). A gel-purified 5.8-kb SacI-HindIII fragment was used to transform the A. fumigatus wild type (WT) (Fig. 2A). Hygromycin-resistant estB-negative transformants (ΔestB strain) were used for further analysis.
For the reconstitution of the ΔestB strain with a functional estB copy, a 3.8-kb AvrII-ClaI fragment of pEstB was subcloned into the compatible restriction enzyme sites XbaI and NarI of plasmid pAN8-1 carrying the phleomycin resistance marker gene ble (21). The resulting 9.7-kb plasmid pEstphleo was linearized with BamHI and used to transform A. fumigatus ΔestB protoplasts. Phleomycin-resistant transformants with homologous reconstitution of the estB gene (estBR strain) were selected by PCR (data not shown) and Southern blot analysis. The hybridization probe for Southern blot analysis of ΔestB and estBR strains was generated by PCR using the oligonucleotides oEstAf1 and oEstAf2 (Fig. 2B and Table 2).
In order to subcellularly localize EstB, an in-frame estB-egfp (enhanced green fluorescence protein-encoding gene) fusion was generated. Therefore, a 2.2-kb SmaI-SacI egfp-encoding fragment was subcloned from plasmid pUCGH (10) into the compatible EcoRV-SacI sites of plasmid pGEM-5zf(+) (Promega), yielding plasmid pGfp. The 5′-flanking region and the open reading frame of estB were PCR amplified by using oligonucleotides oEstAf9 and oEstAf11 (including a restriction enzyme site for NcoI, which replaces the stop codon). After cleavage with SphI and NcoI, the amplification product was inserted into the respective restriction enzyme sites of pGfp, resulting in plasmid pEstBgfp. A 2.5-kb BssHII fragment carrying hph from pHph was cloned into the compatible restriction enzyme site MluI from pEstBgfp, resulting in plasmid pEstBgfphph. In a final step, the 5′-flanking region of estB was PCR amplified by using oligonucleotides oEstAf12 and oEstAf13. After cleavage with HindIII and KpnI, the amplification product was inserted into the respective restriction enzyme sites of pEstBgfphph. A gel-purified 9-kb DraI-KpnI fragment was used to transform A. fumigatus WT. Hygromycin-resistant transformants containing an in-frame fusion of the estB and EGFP-encoding genes (estBgfp strain) were selected and used for the subcellular localization of EstB. The hybridization probe for Southern blot screening of the estBgfp strain was generated by PCR using the oligonucleotides oEstAf1 and oEstAf11 (Fig. 2C and Table 2).
Transformation of A. fumigatus was carried out as described by Tilburn et al. (29). In order to obtain homokaryotic transformants, colonies from single homokaryotic spores were picked and single genomic integration was confirmed by PCR (data not shown) and Southern blot analysis (Fig. 2D). Plasmids were propagated in E. coli DH5α (Life Technologies). Standard molecular techniques were performed as described by Sambrook et al. (26). A. fumigatus DNA was isolated as described previously (32).
Fluorescence microscopy.
A. fumigatus strains (105 conidia) were grown on eight-well chambered cover glasses in 200 μl of AMM with (+Fe) or without (−Fe) iron for 15 h. The intracellular localization of the expressed fusion protein in the fungal hyphae was analyzed by light and fluorescent confocal microscopy performed with a microlens-enhanced Nipkow disk-based confocal system UltraVIEW RS (Perkin Elmer) mounted on an Olympus IX-70 inverse microscope (Olympus). EGFP fluorescence was visualized using 488/568-nm excitation/emission. Images were acquired using the UltraVIEW RS software.
Production and purification of recombinant A. fumigatus EstB in E. coli.
The coding sequence of estB from fungal cDNA was amplified using oligonucleotides oEstAf1 and oEstAf2. After cleavage with NcoI and BglII, the resulting fragment was inserted into the respective restriction enzyme sites of pQE-60 (QIAGEN). Subsequently, E. coli M15 cells were transformed with the generated recombinant expression construct. Induction with isopropyl-β-d-thiogalactopyranoside led to the expression of the recombinant EstB (rEstB) with a six-histidine affinity tag at the C terminus, allowing purification of the protein via Talon metal resin affinity chromatography using a 15 to 50 mM imidazole gradient for elution. Eluted proteins were dialyzed against 10 mM Tris, pH 8.0, and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Coomassie brilliant blue staining.
TafC esterase assay.
A fusarinine esterase enzyme activity assay based on the fact that EDTA cannot dissociate ferric iron from trihydroxamic acids but can effectively compete with monohydroxamic acids and dihydroxamic acids has been described by Emery (6). We established a new assay which is faster and more reliable: due to the difference in hydrophobicities, TafC and its degradation products can be separated by chloroform extraction (Fig. 3A). A. fumigatus cellular extracts or E. coli-expressed rEstB was incubated with 0.3 mM TafC or DF-TafC, respectively, in 0.1 M Na-phosphate buffer, pH 6.5, in a total volume of 1 ml at 37°C. After incubation for the indicated periods of time, the assay solution was extracted with 0.5 ml chloroform to separate TafC and its degradation products. In the presence of iron, both TafC and the degradation products form orange-colored chelates, which were quantified by photometric detection at 440 nm (Fig. 3B). A large percentage (87% ± 5% [mean ± standard deviation {SD} from three experiments]) of the total TafC amount accumulates in the chloroform phase, whereas the degradation products are found exclusively in the aqueous phase (Fig. 3C). In case of DF-TafC degradation, FeCl3 was added to a final concentration of 0.4 mM after the incubation with cellular extracts or the purified enzyme before the extraction. For determination of hydrolysis of fusarinine C, chloroform was replaced by phenol in the extraction step. The enzyme activity of cellular extracts was normalized to the protein content of the sample. The purification of TafC and DF-TafC and the preparation of cellular extracts were performed as described previously (16).
RESULTS
Molecular characterization of estB.
In filamentous fungi, genes encoding proteins which are involved in a common metabolic pathway tend to be genomically clustered. The genome sequence of A. fumigatus has recently been released (15), and screening of the genome for putative siderophore transporter-encoding genes combined with expression analysis of adjacent genes identified an iron-regulated gene cluster, which is localized on chromosome III (http://www.cadre.man.ac.uk) and potentially encodes a siderophore transporter (Afu3g03640), an acetyltransferase (Afu3g03650), an esterase (estB) (Afu3g03660), and an ABC transporter (Afu3g03670) (Fig. 4).
Taken together, these data indicated a role of the estB gene product in iron metabolism. The estB cDNA sequence was analyzed by reverse transcription-PCR using RNA isolated from iron-starved mycelia. The comparison of cDNA and genomic sequences revealed the presence of a single intron of 64 bp in length. The deduced EstB protein consists of 292-amino-acid residues with a predicted molecular mass of 32.7 kDa. EstB contains an alpha/beta hydrolase fold (COG2819) and belongs to the esterase protein superfamily. The alpha/beta hydrolase fold is common to several hydrolytic enzymes of widely differing phylogenetic origins and catalytic functions (18).
Putative EstB homologues are present in several fungal species (Table 3). However, other fungi, including Neurospora crassa, Saccharomyces cerevisiae, and Candida albicans, as well as all nonfungal eukaryotes, appear to lack EstB homologues. In contrast, limited similarity can be found to various bacterial proteins, including E. coli IroD, IroE, and Fes as well as S. enterica IroD and IroE (Table 3).
TABLE 3.
Sequence ID | Sequence title | Organism | E value |
---|---|---|---|
gi 67901628 | Hypothetical protein AN7801.2 | A. nidulans | 2e-50 |
gi 46111093 | Hypothetical protein FG02428.1 | Gibberella zeae | 7e-42 |
gi 88179653 | Hypothetical protein CHGG_03740 | Chaetomium globosum | 3e-30 |
gi 46115802 | Hypothetical protein FG03743.1 | G. zeae | 2e-24 |
gi 88184645 | Hypothetical protein CHGG_00348 | C. globosum | 4e-24 |
gi 14594881 | IroE protein | E. coli | 2e-04 |
gi 2738251 | IroE protein | S. enterica | 3e-04 |
gi 16761558 | Putative ferric enterochelin esterase | S. enterica | 0.014 |
gi 25987937 | IroD | E. coli | 0.052 |
gi 16128568 | Ferric enterobactin esterase (Fes) | E. coli | 0.12 |
gi 62179187 | Enterochelin esterase | S. enterica | 0.15 |
Selected putative EstB homologues (derived by a BLASTP search at http://www.ncbi.nlm.nih.gov/BLAST/) of fungal species, E. coli, and S. enterica are listed.
Disruption of estB.
In order to characterize the function of EstB, the region encoding amino acid residues 71 to 187 was replaced by the hygromycin B resistance marker gene hph in A. fumigatus WT as described in Materials and Methods and as depicted in Fig. 2A. The two independently isolated disruption mutants (ΔestB strain) displayed the same phenotype in all assays performed (data not shown). To prove that the phenotypic changes of the ΔestB strain are a direct result of the loss of estB, a single estB copy was integrated at the estB locus in the ΔestB strain as described in Materials and Methods and as drafted in Fig. 2B. In all assays performed, the reconstituted strain, the estBR strain, was indistinguishable from the WT (data not shown).
EstB is a TafC esterase.
Due to its sequence similarity to esterases, we analyzed the putative role of EstB in the degradation of TafC. In a first step, we established a new TafC esterase assay based on the fact that TafC and its degradation products can be separated by chloroform extraction due to their differing hydrophobicities (Fig. 3A to C). In this assay, the entire TafC content was hydrolyzed within 0.5 h by cellular extracts derived from WT mycelia grown for 24 h under iron-depleted conditions. In contrast, TafC esterase activity could not be detected in cellular extracts from the iron-starved ΔestB strain, even after incubation for 24 h. In agreement with the estB expression pattern, TafC degradation was reduced by 90% in cellular extracts derived from A. fumigatus grown under iron-replete conditions compared to what was seen for iron-depleted conditions (data not shown). These analyses demonstrate that TafC hydrolysis by A. fumigatus cell extracts is associated with the presence of EstB.
E. coli-expressed rEstB specifically hydrolyzes TafC.
To further characterize the enzymatic activity of EstB, the encoding cDNA was expressed as a C-terminally His-tagged protein in E. coli, using the pQE system, and purified via Talon metal resin affinity chromatography as described in Materials and Methods (Fig. 3D). Consistent with the genetic data, purified rEstB displayed TafC esterase activity (Fig. 3A and B) and was therefore employed to characterize the enzymatic activity in more detail. rEstB-catalyzed TafC degradation followed Michaelis-Menten kinetics, resulting in a Km of 0.4 mM. rEstB showed maximal enzyme activity at pH 6.0 to 7.0 and at 25°C to 37°C. TafC and DF-TafC were hydrolyzed with similar efficiencies (data not shown). Remarkably, rEstB was not able to hydrolyze fusarinine C, which is distinguished from TafC by the lack of three N2-acetyl residues (data not shown).
Deletion of estB increases intracellular accumulation of TafC.
In order to study the role of EstB in vivo, A. fumigatus WT and ΔestB strains were grown in liquid shake flask cultures for 22 h under iron-depleted conditions to activate siderophore uptake. Subsequently, the mycelia were harvested and shifted for 2 h into minimal medium containing 30 μM of TafC as the iron source. Determination of the TafC content of the culture supernatant at the end of the shift period demonstrated that both strains had taken up about 80% of the available TafC, indicating similar TafC uptake rates (data not shown). The intracellular accumulation of siderophores was analyzed before and after the shift by reversed-phase HPLC (Fig. 5).
Under iron-depleted conditions, WT and ΔestB strains contained minor amounts of DF-TafC. Notably, the ΔestB strain displayed a 1.8-fold increase in DF-TafC content under iron-depleted conditions. After 2 h of incubation with TafC, the DF-TafC was barely detectable in both WT and ΔestB strains, but TafC and its degradation products appeared. Reversed-phase HPLC analysis of intracellular in vivo TafC degradation in a ΔsidA strain, which is unable to produce siderophores but is still able to utilize TafC (27), confirmed that the detected products are indeed degradation products derived from TafC (data not shown). Remarkably, in the ΔestB strain, the TafC content was increased 6.0-fold, whereas the TafC degradation products were increased only 1.9- to 2.7-fold. These data suggest that EstB deficiency results in increased intracellular accumulation of TafC due to decreased hydrolysis, as the ratio between TafC and its degradation products largely increases in the ΔestB strain from what is seen for the WT. However, these results also indicate that A. fumigatus is able to hydrolyze TafC into the very same degradation products independent of EstB, although with less efficiency. In this respect, the in vivo analysis of TafC degradation differs from the in vitro analysis using cellular extracts. In the latter analysis, EstB-independent TafC hydrolysis was not evident (see above). This difference might indicate the inactivation of the EstB-independent mechanism by the preparation of cellular extracts.
EstB deficiency delays iron sensing.
The HPLC analysis of the intracellular siderophore also revealed that A. fumigatus WT and ΔestB strains accumulate about the same amounts of DF-FC under iron-depleted conditions (Fig. 5). Two hours after the shift into 30 μM TafC, 85% of the DF-FC pool was converted to FC in the WT, but only 52% was converted in the ΔestB strain. These data indicate that the decreased TafC hydrolysis rate caused by EstB deficiency results in a slower transfer of iron from TafC to DF-FC.
In order to simulate the transfer of iron from TafC to DF-FC in vitro, we employed the established TafC esterase assay containing 0.6 mM DF-FC in addition to 0.3 mM TafC. After incubation for 4 h, cross-chelation of TafC-iron by DF-FC was not detected in the absence of EstB. In contrast, the entire amount of iron transferred from TafC and its degradation products to DF-FC in the presence of 1 μg rEstB (data not shown). These data emphasize that the hydrolysis of TafC enables the efficient transfer of iron from TafC to DF-FC and that the affinity of FC to iron is higher than that of the TafC hydrolysis products.
To further analyze the consequences of the reduced release of iron from TafC, expression levels of the iron-repressed gene Afu3g03640, a putative siderophore transporter gene, were compared for WT and ΔestB strains during the shift from iron-depleted to iron-replete conditions (Fig. 6). Consistent with the decreased release of iron from TafC, the down-regulation of Afu3g0640 expression was delayed in the ΔestB strain compared to what was seen for the WT, suggesting that a deficiency in EstB causes a delay in the sensing of iron.
EstB deficiency reduces the growth rate under iron-depleted conditions.
Comparison of the growth rates of ΔestB and WT strains displayed no difference under iron-replete conditions (data not shown). However, the growth rate of the ΔestB strain was slightly reduced under iron-depleted conditions (data not shown), and it was significantly reduced under iron-depleted conditions in the presence of 200 μM bathophenanthroline disulfonic acid (BPS) (Fig. 7). In the presence of BPS, the siderophore system constitutes the only functional iron uptake system in A. fumigatus, because BPS is a ferrous iron specific chelator and therefore inhibits reductive iron assimilation (27). Consequently, these data suggest that EstB is essential for the optimal function of TafC-mediated iron utilization.
EstB is localized in the cytoplasm.
To determine the cellular localization of EstB, estB was fused in frame at the 3′ end with the EGFP-encoding gene, yielding the estBgfp strain (Fig. 2C). In vitro and in vivo analysis of TafC hydrolysis (data not shown) and determination of the growth rate (Fig. 7) of the estBgfp strain demonstrated that EGFP-tagged EstB is biologically functional. Fluorescence microscopy revealed that EstB is localized in the cytoplasm, and consistent with the Northern analysis EstB-EGFP was detectable for iron-depleted conditions but to a much lesser extent during growth under iron-replete growth (Fig. 8). These data provide indirect evidence that the hydrolysis of TafC occurs in the cytoplasm.
DISCUSSION
In contrast to that in fungi, siderophore-mediated iron uptake in various bacteria has been studied in great detail (23). One of the best-studied siderophores is the catecholate enterobactin, a 2,3-dihydroxybenzoylserine macrotrilactone produced by enteric bacteria such as E. coli and S. enterica (25). It is the strongest Fe3+ ligand known, with an estimated equilibrium dissociation constant of 10−49 M (12). Hydrolysis of its ester bonds by the esterase Fes is essential for iron release, to make it available for general cell metabolism (2, 11, 12). Recently, the Fes homologues IroD and IroE have been shown to mediate the hydrolysis of salmochelins, which are glycosylated enterobactin derivatives (12, 33).
Fungi do not produce catecholates but do produce hydroxamates, including ferrichromes and fusarinines (7). Similar to those of catecholates, the subunits of cyclic fusarinines (fusarinine C and TafC) are connected by ester bonds. The hydrolysis of cyclic fusarinines was demonstrated for several fungi and has been postulated to be required for intracellular iron release, similar to what is seen for bacteria (6). In this study, we identified and characterized the TafC esterase EstB of A. fumigatus, the first eukaryotic siderophore-degrading enzyme to be characterized at the molecular level. The EstB protein displays limited sequence similarity to the bacterial enzymes Fes, IroD, and IroE. Similar to its bacterial homologues (12, 24, 33), estB is genomically clustered with other genes involved in siderophore metabolism.
We demonstrated TafC hydrolysis by EstB in vitro and in vivo. Nevertheless, an EstB-deficient strain was still able to hydrolyze TafC, although with less efficiency. As the A. fumigatus genome does not appear to encode a related enzyme, the EstB-independent TafC hydrolysis is probably mediated by a different enzyme class. Due to the EstB-independent TafC degradation mechanism, it remains to be shown if TafC cleavage is essential for the release of iron from this siderophore. The utilization of TafC as the iron source has also been demonstrated for two yeast species, S. cerevisiae and C. albicans, which are not able to produce siderophores (8, 31). Both species appear to lack orthologues of EstB, supporting the hypothesis that this enzymatic activity is not essential for the use of TafC as the iron source. Nevertheless, the EstB-independent TafC hydrolytic mechanism is not able to compensate the loss of EstB in A. fumigatus, because estB deficiency reduces the transfer rate of iron from TafC to the intracellular siderophore DF-FC, delays iron sensing, and impairs growth on TafC as the sole iron source. These data indicate that EstB optimizes the utilization of TafC as the iron source. For DF-TafC-producing fungal species, TafC is the major source of iron, which is probably the reason for the evolution of a mechanism to improve the efficiency of iron release from TafC. Consistently, putative EstB orthologues can be found in the DF-TafC producers A. nidulans and Gibberella zeae (Table 2).
Unprotected iron-free siderophores within cells are potentially hazardous due to their high affinity to iron (7). Subsequent to synthesis, DF-TafC appears to be rapidly excreted or hydrolyzed, because only very low amounts can be detected intracellularly. As EstB hydrolyzes TafC and DF-TafC with equal efficiencies, its function might not be restricted to the release of iron from the siderophore but might also include the degradation of the iron-free chelator to protect cells. Localization of EstB by EGFP tagging suggests that the hydrolysis of TafC takes place in the cytoplasm. Therefore, EstB represents the first localized intracellular component of a eukaryotic siderophore system.
Acknowledgments
We thank Martin Herman for excellent support in fluorescence microscopy.
This work was supported by the Austrian Science foundation (FWF grants P15959-B07 and P18606-B11) and by the Tyrolean Science Foundation (TWF, UNI-404/110).
Footnotes
Published ahead of print on 22 June 2007.
REFERENCES
- 1.Adjimani, J. P., and T. Emery. 1987. Iron uptake in Mycelia sterilia EP-76. J. Bacteriol. 169:3664-3668. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Brickman, T. J., and M. A. McIntosh. 1992. Overexpression and purification of ferric enterobactin esterase from Escherichia coli. Demonstration of enzymatic hydrolysis of enterobactin and its iron complex. J. Biol. Chem. 267:12350-12355. [PubMed] [Google Scholar]
- 3.Debeaupuis, J. P., J. Sarfati, V. Chazalet, and J. P. Latge. 1997. Genetic diversity among clinical and environmental isolates of Aspergillus fumigatus. Infect. Immun. 65:3080-3085. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Eisendle, M., H. Oberegger, I. Zadra, and H. Haas. 2003. The siderophore system is essential for viability of Aspergillus nidulans: functional analysis of two genes encoding l-ornithine N 5-monooxygenase (sidA) and a non-ribosomal peptide synthetase (sidC). Mol. Microbiol. 49:359-375. [DOI] [PubMed] [Google Scholar]
- 5.Eisendle, M., M. Schrettl, C. Kragl, D. Muller, P. Illmer, and H. Haas. 2006. The intracellular siderophore ferricrocin is involved in iron storage, oxidative-stress resistance, germination, and sexual development in Aspergillus nidulans. Eukaryot. Cell 5:1596-1603. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Emery, T. 1976. Fungal ornithine esterases: relationship to iron transport. Biochemistry 15:2723-2728. [DOI] [PubMed] [Google Scholar]
- 7.Haas, H. 2003. Molecular genetics of fungal siderophore biosynthesis and uptake: the role of siderophores in iron uptake and storage. Appl. Microbiol. Biotechnol. 62:316-330. [DOI] [PubMed] [Google Scholar]
- 8.Heymann, P., M. Gerads, M. Schaller, F. Dromer, G. Winkelmann, and J. F. Ernst. 2002. The siderophore iron transporter of Candida albicans (Sit1p/Arn1p) mediates uptake of ferrichrome-type siderophores and is required for epithelial invasion. Infect. Immun. 70:5246-5255. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Konetschny-Rapp, S., H. G. Huschka, G. Winkelmann, and G. Jung. 1988. High-performance liquid chromatography of siderophores from fungi. Biol. Met. 1:9-17. [DOI] [PubMed] [Google Scholar]
- 10.Langfelder, K., B. Philippe, B. Jahn, J. P. Latge, and A. A. Brakhage. 2001. Differential expression of the Aspergillus fumigatus pksP gene detected in vitro and in vivo with green fluorescent protein. Infect. Immun. 69:6411-6418. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Langman, L., I. G. Young, G. E. Frost, H. Rosenberg, and F. Gibson. 1972. Enterochelin system of iron transport in Escherichia coli: mutations affecting ferric-enterochelin esterase. J. Bacteriol. 112:1142-1149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Lin, H., M. A. Fischbach, D. R. Liu, and C. T. Walsh. 2005. In vitro characterization of salmochelin and enterobactin trilactone hydrolases IroD, IroE, and Fes. J. Am. Chem. Soc. 127:11075-11084. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Mullins, J., R. Harvey, and A. Seaton. 1976. Sources and incidence of airborne Aspergillus fumigatus (Fres). Clin. Allergy 6:209-217. [DOI] [PubMed] [Google Scholar]
- 14.Neilands, J. B., K. Konopka, B. Schwyn, M. Coy, R. T. Francis, B. H. Paw, and A. Bagg. 1987. Comparative biochemistry of microbial iron assimilation, p. 3-34. In G. Winkelmann and D. R. Winge (ed.), Iron transport in microbes, plants and animals. Weinheim & VCH, New York, NY.
- 15.Nierman, W. C., A. Pain, M. J. Anderson, J. R. Wortman, H. S. Kim, J. Arroyo, M. Berriman, K. Abe, D. B. Archer, C. Bermejo, J. Bennett, P. Bowyer, D. Chen, M. Collins, R. Coulsen, R. Davies, P. S. Dyer, M. Farman, N. Fedorova, T. V. Feldblyum, R. Fischer, N. Fosker, A. Fraser, J. L. Garcia, M. J. Garcia, A. Goble, G. H. Goldman, K. Gomi, S. Griffith-Jones, R. Gwilliam, B. Haas, H. Haas, D. Harris, H. Horiuchi, J. Huang, S. Humphray, J. Jimenez, N. Keller, H. Khouri, K. Kitamoto, T. Kobayashi, S. Konzack, R. Kulkarni, T. Kumagai, A. Lafon, J. P. Latge, W. Li, A. Lord, C. Lu, W. H. Majoros, G. S. May, B. L. Miller, Y. Mohamoud, M. Molina, M. Monod, I. Mouyna, S. Mulligan, L. Murphy, S. O'Neil, I. Paulsen, M. A. Penalva, M. Pertea, C. Price, B. L. Pritchard, M. A. Quail, E. Rabbinowitsch, N. Rawlins, M. A. Rajandream, U. Reichard, H. Renauld, G. D. Robson, S. Rodriguez de Cordoba, J. M. Rodriguez-Pena, C. M. Ronning, S. Rutter, S. L. Salzberg, M. Sanchez, J. C. Sanchez-Ferrero, D. Saunders, K. Seeger, R. Squares, S. Squares, M. Takeuchi, F. Tekaia, G. Turner, C. R. Vazquez de Aldana, J. Weidman, O. White, J. Woodward, J. H. Yu, C. Fraser, J. E. Galagan, K. Asai, M. Machida, N. Hall, B. Barrell, and D. W. Denning. 2005. Genomic sequence of the pathogenic and allergenic filamentous fungus Aspergillus fumigatus. Nature 438:1151-1156. [DOI] [PubMed] [Google Scholar]
- 16.Oberegger, H., M. Schoeser, I. Zadra, B. Abt, and H. Haas. 2001. SREA is involved in regulation of siderophore biosynthesis, utilization and uptake in Aspergillus nidulans. Mol. Microbiol. 41:1077-1089. [DOI] [PubMed] [Google Scholar]
- 17.Oide, S., W. Moeder, S. Krasnoff, D. Gibson, H. Haas, K. Yoshioka, and B. G. Turgeon. 2006. NPS6, encoding a nonribosomal peptide synthetase involved in siderophore-mediated iron metabolism, is a conserved virulence determinant of plant pathogenic ascomycetes. Plant Cell 18:2836-2853. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Ollis, D. L., E. Cheah, M. Cygler, B. Dijkstra, F. Frolow, S. M. Franken, M. Harel, S. J. Remington, I. Silman, J. Schrag, et al. 1992. The alpha/beta hydrolase fold. Protein Eng. 5:197-211. [DOI] [PubMed] [Google Scholar]
- 19.Pao, S. S., I. T. Paulsen, and M. H. Saier, Jr. 1998. Major facilitator superfamily. Microbiol. Mol. Biol. Rev. 62:1-34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Pontecorvo, G., J. A. Roper, L. M. Hemmons, K. D. Macdonald, and A. W. Bufton. 1953. The genetics of Aspergillus nidulans. Adv. Genet. 5:141-238. [DOI] [PubMed] [Google Scholar]
- 21.Punt, P. J., I. E. Mattern, and C. A. M. J. J. van den Hondel. 1988. A vector for Aspergillus transformation conferring phleomycin resistance. Fungal Genet. Newsl. 35:25-30. [Google Scholar]
- 22.Punt, P. J., R. P. Oliver, M. A. Dingemanse, P. H. Pouwels, and C. A. van den Hondel. 1987. Transformation of Aspergillus based on the hygromycin B resistance marker from Escherichia coli. Gene 56:117-124. [DOI] [PubMed] [Google Scholar]
- 23.Ratledge, C., and L. G. Dover. 2000. Iron metabolism in pathogenic bacteria. Annu. Rev. Microbiol. 54:881-941. [DOI] [PubMed] [Google Scholar]
- 24.Rauscher, L., D. Expert, B. F. Matzanke, and A. X. Trautwein. 2002. Chrysobactin-dependent iron acquisition in Erwinia chrysanthemi. Functional study of a homolog of the Escherichia coli ferric enterobactin esterase. J. Biol. Chem. 277:2385-2395. [DOI] [PubMed] [Google Scholar]
- 25.Raymond, K. N., E. A. Dertz, and S. S. Kim. 2003. Enterobactin: an archetype for microbial iron transport. Proc. Natl. Acad. Sci. USA 100:3584-3588. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- 27.Schrettl, M., E. Bignell, C. Kragl, C. Joechl, T. Rogers, H. N. Arst, Jr., K. Haynes, and H. Haas. 2004. Siderophore biosynthesis but not reductive iron assimilation is essential for Aspergillus fumigatus virulence. J Exp. Med. 200:1213-1219. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Tekaia, F., and J. P. Latge. 2005. Aspergillus fumigatus: saprophyte or pathogen? Curr. Opin. Microbiol. 8:385-392. [DOI] [PubMed] [Google Scholar]
- 29.Tilburn, J., J. C. Sanchez-Ferrero, E. Reoyo, H. N. Arst, Jr., and M. A. Penalva. 2005. Mutational analysis of the pH signal transduction component PalC of Aspergillus nidulans supports distant similarity to BRO1 domain family members. Genetics 171:393-401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Winkelmann, G. 2001. Microbial transport systems. Wiley-VCH, Weinheim, Germany.
- 31.Yun, C. W., J. S. Tiedeman, R. E. Moore, and C. C. Philpott. 2000. Siderophore-iron uptake in Saccharomyces cerevisiae. Identification of ferrichrome and fusarinine transporters. J. Biol. Chem. 275:16354-16359. [DOI] [PubMed] [Google Scholar]
- 32.Zadra, I., B. Abt, W. Parson, and H. Haas. 2000. xylP promoter-based expression system and its use for antisense downregulation of the Penicillium chrysogenum nitrogen regulator NRE. Appl. Environ Microbiol. 66:4810-4816. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Zhu, M., M. Valdebenito, G. Winkelmann, and K. Hantke. 2005. Functions of the siderophore esterases IroD and IroE in iron-salmochelin utilization. Microbiology 151:2363-2372. [DOI] [PubMed] [Google Scholar]