Three New Macrolide Efflux (mef) Gene Variants in Streptococcus agalactiae

Streptococcus agalactiae (group B streptococcus [GBS]) is the most common cause of neonatal sepsis (9). Penicillin is used for intrapartum prophylaxis, but erythromycin or clindamycin is recommended for patients allergic to penicillin (3). There are two major mechanisms of erythromycin resistance in S. agalactiae, (i) erythromycin ribosomal methylase, mediated by ermB, ermA, ermTR, or ermC, which confers cross-resistance to macrolides, lincosamides, and streptogramin B (MLS_B phenotype), and (ii) a less common macrolide efflux pump, mediated by mef (7), which confers resistance to 14- and 15-membered macrolides only (M phenotype). The major mef variants, mefE and mefA, were originally identified in S. pneumoniae and S. pyogenes, respectively (5, 11); both are found in S. agalactiae (2), although mefE is much more common (4, 12).

Recently, we tested 512 GBS isolates from Australia, Hong Kong, and South Korea by using a multiplex PCR-based reverse line blot (mPCR/RLB) assay to identify nine resistance markers and identified mef in 22 (12). However, we did not distinguish mef variants. Subsequently, we tested a total of 1,629 GBS clinical isolates (including the original 512) from nine countries by using the same mPCR/RLB, except that two new probe pairs, specific for mefA and mefE, were added (Table 1). Isolates were typed by using a three-set genotyping system which identifies the molecular serotype (MS), surface protein genes, and mobile genetic elements, as described previously (8). Antibiotic susceptibilities to erythromycin, clindamycin, and tetracycline were measured by E-test (AB Biodisk; Australia Laboratory Services Pty. Ltd.) and interpreted as recommended by the Clinical and Laboratory Standards Institute (12).

TABLE 1.

Oligonucleotide primers and probes used in this study

Primer or probea	Target	Tm (°C)b	GenBank accession no.	Sequence (5′-3′)c
mefA/E primers and new mefA- and mefE-specific probes for mPCR/RLB
mefAESb	mefA/E	63.41	AF227521/AY064721	3314/50 GGC AGG GCA AGC AGT ATC 3331/67
mefAAP	mefA	64.33	AF227521	3453 GTC CAA AGA CCG CAT AGG G 3435
mefASP	mefA	61.08	AF227521	3529 CTG GTT CGG TGC TTA CTA TTG 3549
mefEAP	mefE	64.17	AY064721	192 CAG GTC CCA AAA TCG CAT AG 173
mefESP	mefE	62.95	AY064721	265 CTG GTG CAG TGC TTG CTA TT 284
mefAEAb	mefA/E	59.76	AF227521/	3674/410 CTG TTC TTC TGG TAC TAA AAG TGG 3651/387
			AY064721
Primers for whole mef gene amplification and sequencing
mef-102Sd	mefA/E	65.21	AJ971089	180 GACCAAAAGCCACATTGTGG 199
mef1d	mefA/E	57.78	AY064721	6 ATG GAA AAA TAC AAC AAT TGG 26
mef523Se	mefA/E	62.93	AY064721	528 GTA TTG GGT GCT GTG ATT GC 547
mef680Ae	mefA/E	51.84	AY064721	685 AA(/G)G AGT AAT AAA(/G) GCA AAC(/T) AAT C 664
mef1218d	mefA/E	46.63	AY064721	1223 TTA TTT TAA ATC TAA TTT TCT 1203
mef1329Ad	mefA/E	61.02	AJ971089	1606 CCTCCTGTCTATAATCGCATG 1586

^aA b suffix indicates a 5′ biotin-labeled primer; a p suffix indicates a 5′ amine-labeled probe.

^bThe primer T_m values were provided by the primer synthesizer (Sigma-Aldrich).

^cNumbers represent the numbered base positions at which primer sequences start and finish (numbering start point 1 refers to start point 1 of the gene with the corresponding GenBank accession number).

^dThis primer is a modified form of one described by Klaassen and Mouton (7).

^eThis primer was designed by us as a sequencing primer.

Forty five (2.7%) of 1,629 isolates were positive for mef, and of these, 35 contained mefE, 7 contained mefA, and 3 gave weak or variable signals with mefE- and mefA-specific probes. These three isolates were among 16 mef-positive isolates from Hong Kong. Their genotypes and phenotypic susceptibilities to erythromycin, clindamycin, and tetracycline are shown in Table 2. All three had the M phenotype and MS Ia but atypical genotypes. MS Ia usually has the surface protein gene alp1 and insertion sequence IS1381 (8, 10). Two of these isolates had alp1 but, instead of IS1381, carried the type II intron GBSi1, usually found in MS III but rarely in other serotypes (10). The other isolate had neither the surface protein gene nor the insertion sequence.

TABLE 2.

Characteristics and comprehensive genotyping results of three mef variants

Identificationa	GenBank accession no.	Typeb	MIC (mg/liter)c			Genotype (MS-pgp-mge-AR)d
			Erythromycin	Clindamycin	Tetracycline
HK-115	DQ445269	S	8	0.19	0.25	Ia-mefB
HK-99	DQ445270	S	12	0.094	48	Ia-alp1-GBSil-tetM-mefG
HK-121	DQ445271	S	12	0.125	48	Ia-alp1-GBSil-int-Tn-mefG

^aHK, Hong Kong.

^bThe isolate type was superficial (S) or colonizing.

^cMICs were measured by E-test and interpreted (with incubation in CO₂) according to the kit instructions. For erythromycin and clindamycin, the categories were as follows: ≤0.5 mg/liter, susceptible; 1 mg/liter, intermediate; ≥2 mg/liter, resistant. For tetracycline, the categories were as follows: ≤2 mg/liter, susceptible; 4 mg/liter, intermediate; ≥8 mg/liter, resistant.

^dGenotypes are reported as the MS; protein gene profile (pgp) for bca (Cα/Bca gene), bac (Cβ/Bac gene), rib (Rib gene), alp1 (Alp1/Alp5/epsilon gene), alp2 (Alp2 gene), and alp3 (Alp3 gene); mobile genetic elements (mge) (including IS1381 and GBSi1, among others) (8, 10); and antibiotic resistance (AR) genes (12).

From each of these three isolates, mef was amplified and sequenced with the primers shown in Table 1. The full sequences indicated that all were novel mef variants not previously described in a GBS. They were deposited in GenBank with accession numbers DQ445269 to DQ445271. DQ445271 and DQ445270 were 99% similar to each other but only 88% and 89% homologous with mefE (GenBank accession no. AF227521) and mefA (GenBank accession no. AY064721), respectively. They shared 99 to 100% homology with a mef variant recently identified in Streptococcus dysgalactiae (a group G streptococcus) (GenBank accession no. AM168138 and AY355405) (1). DQ445269 has not been described before; it had 89% homology with mefA (GenBank accession no. AY064721) and the novel group G streptococcus mef gene (GenBank accession no. AY355405), 91% homology with mefE (GenBank accession no. AY227521), and 92% homology with another mef variant, mefI, described in Streptococcus pneumoniae (GenBank accession no. AJ971089) (6). The inconsistent mPCR/RLB results for these isolates can be explained by mutations in the mefAESb and mefAEAb regions. New primers and probes will be required to detect them reliably by mPCR/RLB. For these novel mef variants, we propose the names mefG (for DQ445270 and DQ445271) and mefB (for DQ445269) to reflect the beta-hemolytic streptococcus groups in which they were first identified.

These findings and the atypical genotype patterns suggest that these strains have arisen by recombination. Further investigation will be required to determine their clinical significance.