A 24-Residue Presequence Localizes Human Factor B to Mitochondria

Abstract

We reported previously that the human factor B precursor is a 215-amino acid polypeptide, the first 40 amino acid residues of which function as a mitochondrial targeting presequence (G.I. Belogrudov and Y. Hatefi, J. Biol. Chem. 277 (2002) 6097-6103). Confocal microscopy of live HEK293 cells, transiently transfected with factor B constructs tagged at the C-terminus with green fluorescent protein (GFP) revealed that either a 40- or 25-residue presequence localized factor B to mitochondria. Indirect immunofluorescent labeling of fixed, permeabilized HEK293 cells that were transiently transfected with a construct lacking a presequence, showed diffuse, intracellular staining that was consistent with targeting of ectopically expressed factor B to cellular compartments distinct from the mitochondria. Mutants in which either Met^-25 or both Met^-25 / Met^-24 residues of the presequence were deleted exhibited decreased or undetectable levels, respectively, of the GFP-tagged factor B. The factor B presequence alone was shown to target a reporter polypeptide GFP to mitochondria. Our studies, therefore, demonstrate that a 24-residue presequence is sufficient to localize factor B to mitochondria, and suggest that the human factor B precursor is a 199-amino acid polypeptide.

Introduction

The well-being of a eukaryotic cell depends critically upon a steady supply of sufficient amounts of ATP, the essential part of which is produced by mitochondria through oxidative phosphorylation. In mitochondria, the transfer of substrate-derived electrons by the respiratory chain complexes of the inner mitochondrial membrane culminates in the reduction of dioxygen to water, and is coupled to a vectorial, transmembrane proton translocation, whereby a proton-motive force Δp across the membrane is generated [1]. The Δp, in turn, drives ATP synthesis by a rotory motor ATP synthase complex, multiple transport processes including the transport of ions, metabolites and proteins into the mitochondria, and ultimately plays a crucial role in the cellular decision to live or die.

In the early biochemical experiments concerned with resolution and reconstitution of the oxidative phosphorylation system, a polypeptide component of the inner mitochondrial membrane, referred to as factor B, was identified [2]. Removal of factor B from the membrane by sonicating bovine heart mitochondria at a pH of ~8.8 in the presence of 0.6 mM EDTA rendered a preparation of inside-out vesicles, AE-SMP1, deficient in their ability to synthesize ATP [2]. Surprisingly, antibiotic oligomycin, a specific inhibitor of proton translocation through the membrane sector F_O of the F_OF₁-ATPase, was found to restore the capability of such “non-phosphorylating” particles to catalyze the partial reactions of oxidative phosphorylation [3, 4]. The finding that recoupling of AE-SMP could be achieved either with oligomycin or with partially purified factor B preparations provided early evidence for the existence of a common target for both substances within the inner mitochondrial membrane and contributed to the view that coupling factor B is a component of the F_OF₁-ATPase that plays a role in proton translocation through the membrane sector F_O[5].

We recently cloned and expressed human [6] and bovine [7, 8] factor B polypeptides in Escherichia coli, and demonstrated that reconstituting bovine AE-SMP, essentially devoid of endogenous factor B, with either recombinant polypeptide, restored the Δp-dependent reactions to levels observed in coupled SMP [6, 7, 9]. In agreement with the previously published N-terminal sequence of a ~22 kDa species of bovine heart mitochondria factor B [10], the N-termini of the recombinant polypeptides commenced with a sequence comprised of Phe-Trp-Gly-Trp-Leu-Asn-Ala amino acids.

To elucidate the role of factor B in mitochondrial bioenergetics at the cellular level, we are analyzing the effects of modulating the factor B gene product expression level in cultured mammalian cells. As an initial step, we identified the optimal length of the human factor B mitochondrial targeting presequence. We reported previously that human factor B is synthesized as a 215-amino acid precursor, the first 40 amino acid residues of which function as a mitochondrial targeting presequence [6]. The experiments reported herein demonstrate that a 24-residue presequence is sufficient for targeting factor B to the organelle, and suggest that the human factor B precursor is a 199-amino acid polypeptide.

Materials and methods

Reagents

MitoTracker Red CMXRos, goat anti-rabbit or anti-mouse Alexa 488 Fluor conjugated secondary antibodies, Image-iT FX signal enhancer, ProLong Gold antifade reagent, Optifect transfecton reagent, calcium-, magnesium-free PBS, 0.05% trypsin, restriction enzymes were purchased from Invitrogen (Carlsbad, CA). The human embryonic kidney HEK293 cell line was obtained from the American Type Culture Collection (Manassas, VA). The plasmid pCI-neo was purchased from Promega (Madison, WI). The plasmid pAcGFP1-N1 and the monoclonal anti-green fluorescent protein (GFP) antibody were purchased from BD Biosciences (Mountain View, CA). QuikChange site-directed mutagenesis kit was purchased from Stratagene (La Jolla, CA). Monoclonal anti-hemagglutinin (HA) epitope antiserum and L-glutamine-penicillin-streptomycin solution were purchased from Sigma-Aldrich (St. Louis, MO). The Arrest-in transfection reagent was purchased from Open Biosystems (Huntsville, AL). Anti-glyceraldehyde phosphate dehydrogenase (GAPDH) monoclonal antibody was purchased from Ambion, Inc. (Austin, TX). Anti-rabbit and anti-mouse peroxidase conjugated secondary antibodies were purchased from EMD Biosciences-Calbiochem (La Jolla, CA). Dulbecco’s modified Eagle’s medium (DMEM) with 4.5 g/L glucose and sodium pyruvate with or without L-glutamine was purchased from Mediatech, Inc. (Herndon, VA). Fetal bovine serum (FBS) was purchased from Atlanta Biologicals, Inc. (Lawrenceville, GA). Poly-d-lysine coated 35 mm glass bottom culture dishes were purchased from MatTek Corp. (Ashland, MA). SuperSignal West Pico Chemiluminescent substrate was purchased from Pierce (Rockford, IL). All oligonucleotide primers were purchased from Operon Biotechnologies, Inc. (Huntsville, AL).

Plasmid construction

An earlier described [6] plasmid, pDrive-hFB, which contains the human factor B precursor cDNA with a 5’ UTR including 340 nucleotides, was used throughout the present study as a template for the PCR amplification of human factor B cDNA. The cDNA encoding the human factor B precursor with a 40-amino acid presequence was PCR-amplified with the forward primer GB112, ccgCTCGAGATGTGCTGTGCGGTCTCTGAGCAGCG (the restriction site is in italics), and the reverse primer GB115, cccAAGCTTCTTCAATTGTAATTTTAGTTCCAGAGAAGGC, lacking the stop codon. The PCR product was digested with Xho I and Hind III restriction enzymes and then ligated into the Xho I-, Hind III-cut pAcGFP1-N1 plasmid encoding the monomeric GFP. The cDNA encoding the human factor B precursor with a 25-amino acid presequence was PCR-amplified using the forward primer GB113, ccgCTCGAGATGATGCTATTTGGAAAAATTTCCCAGC, and the reverse primer GB115. To express the human factor B with a 25-amino acid presequence from the pAcGFP1-N1 plasmid without the GFP tag, a stop codon was introduced in the reverse primer GB114, cccAAGCTTTTACTTCAATTGTAATTTTAGTTCCAGAGAAGGC. A cDNA encoding a putative splice variant of the human factor B comprising 96 amino acids (GenBank™ accession # U79253) was amplified with the forward primer GB113 and the reverse primer GB117, cccAAGCTTCTGCAAATCATCTGCATTTTCTATTAGC, using plasmid DNA prepared from I.M.A.G.E. clone 24431 as a template. The PCR product was digested with Xho I and Hind III restriction enzymes and then ligated into Xho I-, Hind III-cut pAcGFP1-N1 plasmid. To express the splice variant from the pACGFP1-N1 plasmid backbone without GFP, a stop codon was introduced in the reverse primer GB116, cccAAGCTTTCACTGCAAATCATCTGCATTTTCTATTAGC. The resulting plasmids were designated pAcGFP1-N1-FB, pAcGFP1-N1-Δ1-15FB, pAcGFP1-N1-Δ1-15FBstop, pAcGFP1-N1-Δ1-15FBS and pAcGFP1-N1-Δ1-15FB_Sstop.

To subclone the cDNA encoding the human factor B precursor with a 25-amino acid presequence into the pCI-neo mammalian expression vector, a PCR was performed using the forward primer GB113 (described above), the reverse primer GB126, tgcTCTAGATTACTTCAATTGTAATTTTAGTTCCAGAGAAGGC, and the pDrive-hFB plasmid as a template. The PCR product was digested with Xho I and Xba I restriction enzymes and then ligated into Xho I-, Xba I-cut pCI-neo plasmid. A cDNA lacking the mitochondrial targeting sequence was amplified using the forward primer GB136, ccgCTCGAGATGATGTTCTGGGGCTGGTTGAATGC, in which two consecutive codons encoding Met residues were introduced upstream of the codon encoding a Phe residue from which the mature human factor B commences, and the reverse primer GB126. A cDNA encoding the human factor B precursor with a 25-amino acid presequence and an HA epitope at the C-terminus was amplified using the forward primer GB113 and the reverse primer GB137, tgcTCTAGATTAAGCGTAATCTGGAACATCGTATGGGTACTTCAATTGTAATTTTAGTT C, in which the HA epitope Tyr-Pro-Tyr-Asp-Val-Pro-Asp-Tyr-Ala was placed immediately downstream of the C-terminal Lys¹⁷⁵ of the human factor B, followed by a stop codon. The prepared plasmids were designated pCI-FB, pCI-Δ1-40FB, and pCI-FB-HA.

To prepare a plasmid harboring a 24-residue human factor B precursor fused alone to GFP, an Apa I GGGCCC restriction site was created within the nucleotide sequence encoding the amino acids Trp² and Gly³ of the mature factor B, using a plasmid pAcGFP1-N1-Δ1-15FB. We inserted a CC nucleotide pair in the preexisting nucleotide sequence via the QuikChange method (Stratagene, La Jolla, CA), using the primer GB171, TGGTCATGTGACTCCAGATACTTCTGGGCCCTGGTTGAATGCAGTGTTTAATAAGG, and its reverse counterpart (the position of the inserted nucleotides is shown in bold). The resulting plasmid, which, in addition to a newly created restriction site, also contained an Apa I site in its MCS region, was digested with Apa I restriction enzyme, the ~4.7 kb plasmid fragment was gel-purified and subsequently re-ligated, yielding a plasmid designated pGB-GFP. The latter plasmid encodes a fusion polypeptide in which a 24-residue human factor B presequence, followed by an 8-amino acid linker, is fused in-frame to GFP cDNA. Among the 8 amino acids of the linker intervening between the factor B presequence and GFP, the first two positions are occupied by Phe and Trp amino acids, which are identical to the residues present at the same positions at the N-terminus of the mature human factor B polypeptide. The correct sequences of all plasmid constructs were confirmed by DNA sequencing, performed at the DNA sequencing facility at the Department of Human Genetics at UCLA.

Preparation of deletion mutants

The plasmid pAcGFP1-N1-FB, encoding a 40-residue presequence upstream of the human factor B tagged with GFP, was used to prepare mutants carrying deletions of Met^-25 and Met^-25 / Met^-24 residues of the presequence via the QuikChange method, following the manufacturer’s protocol. The primers GB163, GAGCAGCGACTCACCTGTGCAGATCAAATGCTGTTTGGAAAAATTTCCCAGC, and GB164, GAGCAGCGACTCACCTGTGCAGATCAACTGTTTGGAAAAATTTCCCAGCAG, together with their reverse counterparts, were used to introduce the desired deletions. Their presence was verified by DNA sequence analysis. The resulting plasmids were designated pAcGFP1-N1-ΔMet^-25FB and pAcGFP1-N1-ΔMet^-25 /-ΔMet^-24FB.

Cell culture and transfection

The HEK293 cells were cultured in 1X DMEM containing 10 % FBS, 100 units/ml penicillin, 100 μg/ml streptomycin, and 2 mM L-glutamine in a humidified atmosphere in 5% CO₂at 37°C. Before transfection, the cells were seeded onto dishes and grown to 30-40% confluency. Plasmids with human factor B constructs were transfected into HEK293 cells using either Optifect or Arrest-In transfection reagents, according to the manufacturers’ recommendations. Twenty-four hours after transfection, the cells were examined by confocal microscopy, processed for indirect immunofluorescent labeling or used for preparing total cell lysates for Western blot analysis.

Confocal microscopy of live HEK293 cells

The HEK293 cells seeded onto MatTek dishes were transfected with the factor B constructs tagged at the C-terminus with GFP. Twenty-four hours after transfection, 50 nM MitoTracker Red CMXRos was added with fresh medium and incubation continued for 30 min. The cells were rinsed several times with fresh medium and confocal microscopic images were acquired using a Zeiss LSM 510 laser-scanning confocal microscope with LSM 510 software, version 3.2.

Indirect immunofluorescence microscopy

The transfected HEK23 cells grown onto the MatTek dishes were incubated with 50 nM MitoTracker Red CMXRos for 30 min, washed several times with fresh medium and fixed for 15 min at room temperature with warmed (at 37°C) 4% formaldehyde (PolySciences). The cells were washed with PBS and permeabilized with 0.1% Triton X-100 in PBS for 15 min at room temperature, followed by several washes with PBS. The cells were blocked with Image-iT FX reagent for 40 min, and rinsed with PBS. The cells were incubated with either anti-human factor B rabbit polyclonal (1:200 dilution) or anti-HA epitope monoclonal antisera (1:200 dilution) in PBS containing 1% BSA and 0.05% Triton X-100 for 1 h at room temperature. After several washes with the aforementioned buffer, the cells were incubated with Alexa 488 Fluor conjugated goat anti-rabbit or anti-mouse antibodies for 1 h, washed with PBS containing 1% BSA and 0.05% Triton X-100, and then with PBS alone. The cells were mounted with Prolong Gold antifade reagent and examined by confocal microscopy.

Western blot analysis

The HEK293 cells were seeded in T-25 flasks and transfected as described above. Twenty-four hours after transfection, the cells were washed with PBS and treated with 0.05% trypsin for 3-5 min at 37°C. The cells were collected by centrifugation at 1,100 rpm for 1 min, and washed with PBS. The cells were lysed with 100-200 μl cold PBS containing 1% Triton X-100 and 5 mM EDTA for 30 min at 4°C and spun down at 14,000 rpm for 15 min at 4°C in a benchtop refrigerated centrifuge. After determining the protein concentration, 10-20 μg of supernatant was separated by 15% SDS-PAGE, transferred to a nitrocellulose membrane and blotted with antisera at the following dilutions: rabbit anti-human factor B, 1:500; mouse anti-GFP, 1:1,000; mouse anti-HA epitope, 1:2,000; mouse anti-GAPDH, 1:3,000. Anti-rabbit or anti-mouse peroxidase conjugated secondary antibodies were used at 1:10,000 or 1:1,000 dilutions, respectively. The immune complexes were visualized using SuperSignal West Pico Chemiluminescent substrate (Pierce).

Results

Fig. 1 shows an alignment of the N-terminal amino acid sequences of the factor B precursors retrieved from the public databases. In agreement with the N-terminal amino acid sequence of the first 55 residues of bovine heart mitochondria factor B [10], the amino acid sequence of the mature, 175-residue factor B polypeptide is assumed to commence with a conserved phenylalanine at +1 position. Upstream of this residue resides a putative mitochondrial targeting presequence, which localizes factor B to the organelle and which is removed proteolytically by a mitochondrial processing peptidase. As shown in Fig. 1, the length of the human factor B presequence is 15 residues longer than that of the orthologs identified in other species, suggesting that the human polypeptide is synthesized as a 215-amino acid precursor. By assigning Met^-40 as a translation initiation methionine in the human factor B precursor polypeptide [6], we followed the annotation provided by the Baylor College of Medicine Human Genome sequencing group for a splice variant of human factor B gene (GenBank™ accession number U79253) [11]. At the amino acid level, this variant shares 100% sequence identity with the mature human factor B sequence (GenBank™ accession number AY052377) up to residue 80, after which a nucleotide sequence that encodes a 16-residue unrelated to factor B peptide is inserted. In addition, the detection of a short open reading frame encoding a 34-residue peptide upstream Met^-40 (G.I.B., unpublished), provided further support for its assignment as a putative translation initiation methionine [12, 13]. However, the presence of two, positions -24, -25, or three, positions -23,-24,-25, (Fig. 1) additional consecutive methionines in the human or in the subsequently identified sequences of factor B precursors from the bovine, dog, rat and mouse species, raised concerns regarding validity of the previously made assignment.

Fig. 1. Alignment of the N-terminal amino acid residues of factor B precursors.

Amino acid sequences (human, AAL13058;bovine, AAV52866; dog, XP 547805; rat, AAH83655; and mouse AAH27442) were aligned using ClustalW, version 1.8 alignment program. Identical and similar amino acids are enclosed by black and gray boxes, respectively, using the BOXSHADE 3.21 program. The position of the N-terminal Phe residue of the mature factor B is indicated with a +1 symbol, while positions of the selected Met residues within the human presequence are indicated with -25 and -40 symbols.

We cloned the human factor B precursor with either a 40- or 25-residue presequence, or the aforementioned splice variant (transcript U79253) with a 25-residue presequence into the pAcGFP1-N1 plasmid, upstream of the monomeric GFP (Fig. 2, A). We transiently transfected the HEK293 cells with the prepared constructs and 24 hours after transfection, examined the subcellular localization of the plasmid-encoded polypeptides in live HEK293 cells by confocal microscopy. Fig. 2, Bshows merged images of the transfected HEK293 cells, in which the mitochondria, loaded with MitoTracker Red CMXRos dye, are visualized as distinct, granular organelles stained red, while the mitochondria to which factor B-GFP fusions were targeted in the transfected cells are depicted by their yellow staining. It is seen that either the 40- or 25-residue presequences localized factor B to the mitochondria (Fig. 2, B, panels 1 and 2); a similar mitochondrial localization was observed for the splice variant fused to GFP (Fig. 2, B, panel 3). In the images shown in Fig. 2, B, the nuclei appear as round structures, occupying most of the HEK293 cell volume.

Fig. 2. Confocal microscopy and Western blot analysis of HEK293 cells transiently transfected with human factor B constructs tagged at the C-terminus with the monomeric GFP.

A. Schematic representation of human factor B constructs in a pAcGFP1-N1 vector (Clontech). B. Confocal microscopy images of live HEK293 cells, 24 h post transfection, after staining with 50 nM MitoTracker Red CMXRos. Shown are merged images. Red, staining of mitochondria; yellow, staining of mitochondria targeted with the factor B-GFP fusions in transfected HEK293 cells. In panels 1-3, the HEK293 cells after transfection with plasmids pAcGFP1-N1-FB, pAcGFP1-N1-Δ1-15FB, and pAcGFP1-N1-Δ1-15FBS, respectively, are shown. C. Western blot analysis of the total lysates of the HEK293 cells transiently transfected with the empty vector pAcGFP1-N1 (lanes 1 and 1’); pAcGFP1-N1-FB (lanes 2 and 2’); pAcGFP1-N1-Δ1-15FB (lanes 3 and 3’); pAcGFP1-N1-Δ1-15FBS (lanes 4 and 4’), and pAcGFP1-N1-Δ1-15FBstop (lanes 5 and 5’). Lanes 1-5 were blotted with an anti-GFP monoclonal antibody and lanes 1’-5’ were blotted with an anti-human factor B polyclonal antiserum.

To ascertain the steady-state levels of the ectopically expressed polypeptides, total lysates prepared from transfected HEK293 cells were subjected to Western blot analysis (Fig. 2, C). The anti-GFP monoclonal antibody and the anti-human factor B polyclonal serum reacted specifically with polypeptides of ~27 and ~23 kDa (Fig. 2, C, lanes 1 and 5’, respectively ), showing no signs of proteolytic degradation. In contrast, two pairs of bands, with Mr values of ~50 and ~39 kDa, and of ~40 and ~38 kDa, reacted with both antibodies (Fig. 2, C, lanes 2, 3 and 2’ 3’; Fig. 2, C, lanes 4 and 4’, respectively). It should be noted that in the prepared plasmid constructs, a 17-amino acid residue linker separated the full-length human factor B or its alternatively spliced isoform and GFP, respectively, increasing the molecular weight of the GFP-tagged fusions by ~2 kDa. The immunoreactive bands exhibiting faster electrophoretic mobilities could result from proteolytic degradation of the slower migrating bands, suggesting an intramitochondrial instability of factor B species appended with the GFP moiety. As a control for specificity of the antibodies employed, lanes 5 and 5’ of Fig. 2 were loaded with total lysates of HEK293 cells transfected with pAcGFP1-N1-Δ1-15FBstop plasmid, which carries an endogenous stop codon at the 3’ end of the factor B cDNA. As expected, no immunoreaction was seen in Fig. 2, lane 5, following imunoblotting with anti-GFP antibody, whereas a single band with M_r ~23, correspoponding to ectopically expressed human factor B, was detected in Fig. 2, lane 5’. A 3-4-fold higher amount of the total protein loaded on a gel or longer exposure time was required for detecting endogenous factor B with our polyclonal antibody in the total lysate of HEK293 cells.

Because of the observed proteolytic degradation of the factor B-GFP fusion proteins, we prepared a series of constructs based on the mammalian expression vector pCI-neo. In these constructs, the mature factor B, untagged or tagged with a hemagglutinin (HA) epitope at the C-terminus, was cloned with or without a 25-residue presequence. To ensure translation initiation, we placed two codons encoding methionine residues immediately upstream of the nucleotide sequence of the mature factor B in a construct without a presequence. After transfecting of HEK293 cells with the newly prepared constructs, we analyzed the subcellular localization of the ectopically expressed factor B polypeptides by indirect immunofluorescence of the cells after they had been fixed with formaldehyde and permeabilized with Triton X-100 (Fig. 3). The mitochondria were stained with the MitoTracker CMXRos fluorescent dye, which was retained within the organelle of the fixed cells due to covalent labeling of the cysteine residues of mitochondrial proteins (Fig. 3, B, E and H). The plasmid-driven expression of factor B was detected with either anti-factor B antiserum (Fig. 3, A and D) or anti-HA epitope monoclonal antibody (Fig. 3, G), and the immunoreactive complexes were revealed with appropriate Alexa 488 Fluor conjugated secondary antibodies. In the merged images shown in Fig. 3, C and I, yellow staining indicates the localization of either untagged or an HA epitope-tagged factor B species within mitochondria. In contrast, a diffuse staining of the cytoplasm and the nucleus was seen in cells transfected with a factor B construct lacking a presequence (Fig. 3, D and F). The steady-state levels of an ectopically expressed factor B species were ascertained by blotting the HEK293 cell total lysates with the aforementioned primary antibodies (Fig. 4). The electrophoretic mobility of the human factor B expressed from the pCI-FBΔ1-40 plasmid was slightly increased (Fig. 4, lane 3) and that of the HA-epitope tagged polypeptide was slightly decreased (Fig. 4, lanes 4 and 8) relative to the electrophoretic mobility of the polypeptide expressed from the pCI-FB plasmid (Fig. 4, lane 2). The loading of equivalent amounts of the total cellular protein onto the gel was verified with an anti-GAPDH antibody (Fig. 4, lanes 9-12).

Fig. 3. Indirect immunofluorescent labeling of HEK293 cells transiently transfected with human factor B constructs.

The HEK293 cells grown on MatTek dishes were transiently transfected with a pCI-FB vector harboring the mature human factor B sequence with a 25-residue presequence (A-C); a pCI-Δ1-40FB vector harboring the mature human factor B sequence without a presequence (D-F); and a pCI-FB-HA vector harboring the tagged at the C-terminus with an HA epitope mature human factor B sequence with a 25-residue presequence (G-I). 24 h post transfection, the cells were incubated with 50 nM MitoTracker Red CMXRos (B, E and H), fixed, permeabilized with Triton X-100 and stained with anti-human factor B polyclonal (A-F) or anti-HA epitope monoclonal (G-I) antisera, followed by staining with Alexa 488 Fluor conjugated goat anti-rabbit or anti-mouse secondary antibodies, respectively. The images were acquired with a confocal microscope.

Fig. 4. Western blot analysis of total lysates of HEK293 cells transiently transfected with the pCI-based human factor B constructs.

The HEK293 cells were transfected with the empty vector pCI-neo (lanes 1, 5 and 9); a pCI-FB vector harboring the mature human factor B sequence with a 25-residue presequence (lanes 2, 6 and 10); a pCI-Δ1-40FB vector harboring the mature human factor B sequence without a presequence (lanes 3, 7 and 11); and a pCI-FB-HA vector harboring the tagged at the C-terminus with an HA epitope mature human factor B sequence with a 25-residue presequence (lanes 4, 8 and 12). 24 h after transfection, cells were lysed, separated by 15% SDS-PAGE and blotted with anti-human factor B (lanes 1-4), anti-HA epitope (lanes 5-8) antisera and anti-GAPDH (lanes 9-12) monoclonal antibody.

To gain further insight into the role of the Met^-25 and Met^-24 residues of the presequence in the translation initiation of factor B mRNA, we prepared two mutants in which either Met^-25 or Met^-25 / Met^-24 were deleted, using plasmid pAcGFP1-N1-FB that carries a 40-residue presequence upstream of the GFP-tagged factor B polypeptide. The HEK293 cells transfected with the ΔMet^-25 mutant showed green fluorescence of their mitochondria, whereas a diffuse fluorescence of the cytoplasm was observed in the cells transfected with the ΔMet^-25 / ΔMet^-24 mutant (Fig. 5). Western blot analysis of HEK293 cells transfected with the plasmid harboring ΔMet^-25 deletion mutation revealed a decreased level of the FB-GFP fusion (Fig. 6, lanes 1 and 2, upper row), while no FB-GFP could be detected in cells transfected with the ΔMet^-25 / ΔMet^-24 double deletion mutant (Fig. 6, lane 3, upper row). Instead, in the cells transfected with the latter mutant, GFP alone was detected (Fig. 6, lane 3, middle row).

Fig. 5.

Confocal microscopy of live HEK293 cells transfected with plasmids carrying deletions of Met^-25 or Met^-25 / Met^-24 residues within the human factor B presequence. The images were acquired 36 h after transfection. The identities of ectopically expressed polypeptides are indicated atop of each panel.

Fig. 6. Western blot analysis of HEK293 cells transiently transfected with plasmids carrying ΔMet^-25 and ΔMet^-25/ ΔMet^-24 deletions within the human factor B presequence.

Equal amounts of the total cell lysate protein prepared from the HEK293 cells transiently transfected with pAcGFP1-N1-FB (lane 1), pAcGFP1-N1-ΔMet^-25FB (lane 2) and pAcGFP1-N1-ΔMet^-25 / ΔMet^-24FB (lane 3) plasmids were separated by 15% SDS-PAGE, transferred to nitrocellulose and blotted with anti-human factor B (upper row), anti-GFP (middle row) and anti-GAPDH (lower row) antibodies.

To demonstrate directly that a 24-residue human factor B presequence is sufficient for targeting a reporter polypeptide to mitochondria, we prepared a plasmid construct in which the presequence, followed by an 8-residue linker, was placed upstream of GFP cDNA. Instead of diffuse fluorescence throughout the cell, characteristic of ectopic GFP expression alone (Fig. 7, D), a punctate green fluorescence, which co-localized with the MitoTracker-stained mitochondria, was observed in the HEK293 cells transfected with pGB-GFP plasmid, which harbored GFP fused to the factor B mitochondrial leader (Fig. 6, A and C). This result provides further evidence that information contained within the first 24 residues of human factor B precursor is sufficient for importing the 199-residue precursor polypeptide into the mitochondria.

Fig. 7. A 24-residue human factor B presequence targets a reporter polypeptide GFP to mitochondria.

Confocal microscopy of live HEK293 cells, 72 h after transfection with pGB-GFP plasmid (panels A-C) or pAcGFP1-N1 plasmid (panels D-F). Plasmid pGB-GFP encodes a 24-residue human factor B presequence, fused to GFP via an 8-residue linker, whereas plasmid pAcGFP1-N1 encodes a monomeric GFP. 30 min before analysis, the HEK293 cells were stained with 50 nM MitoTracker Red CMXRos.

Discussion

Factor B belongs to a group of the nuclear encoded mitochondrial polypeptides that require a short presequence or a mitochondrial targeting leader for their import into and sorting within the organelle. During mitochondrial biogenesis, a precursor polypeptide, newly synthesized at the cytoplasmic ribosomes, is recognized by the translocase of the outer membrane (TOM) complex, and is escorted across the intermembrane space to the translocase of the inner membrane (TIM) complex, until it reaches a final destination within a specific subcompartment of the organelle [14,15]. The presequence is then removed by mitochondrial processing peptidases [16], giving rise to the mature, functionally active polypeptide.

Herein we demonstrated that a 24-residue presequence that resides immediately upstream of the mature human factor B amino acid sequence is sufficient for localizing the polypeptide to mitochondria (Fig. 2). Its absence causes the ectopically expressed factor B to mislocalize to extramitochondrial compartments, including the cytosol and nucleus (Fig. 3). Furthermore, the presequence alone was shown to target a reporter polypeptide GFP to mitochondria (Fig. 7). These results were obtained using HEK293 cells transiently transfected with a series of plasmid constructs harboring the human factor B, and subsequent analyses of the steady state levels of the plasmid-borne factor B expression by Western blotting and its intracellular localization by confocal microscopy.

In eukaryotic cells, the choice of translation initiation ATG codon is facilitated by surrounding nucleotides that comprise the so-called Kozak sequence [17]. Thus, in nearly all vertebrate mRNAs, the ATG start codon occurs in either a strong context (RNNatgG, where R is a purine) or at least an adequate context (RNNatgY or YNNatgG, where Y is a pyrimidine) [18]. The A/G preceding the ATG in the -3 and G immediately following it in the +4 positions are, therefore, considered as key nucleotides affecting translation initiation efficiency. The nucleotide context of the putative Met^-40 translation start of the human factor B cDNA is TAAatgT, while the nucleotide sequence that includes Met^-25 and Met^-24 is CAAatgatgC [6]. It is seen that none of the nucleotide contexts in the three putative translation initiation ATGs conform to those expected for a strong consensus context. However, the context of the ATG that encodes Met^-24 does conform to the described adequate context, with A of the preceding ATG in the -3 and C in the +4 positions. We prepared singly, ΔMet^-25, or doubly, ΔMet^-25 / ΔMet^-24, deleted mutants and analyzed the effect of deletion of these methionine residues on the steady state level of the GFP-tagged factor B and it subcellular localization. Using confocal microscopy, the FB-GFP fusion expressed from the ΔMet^-25 plasmid showed a mitochondrial localization, while a diffuse green fluorescence of the cytoplasm was observed in cells transfected with the double deletion mutant (Fig. 5). In the HEK293 cells transfected with the ΔMet^-25 mutant, we detected the FB-GFP fusion at a lower level than that expressed from a plasmid carrying no mutation (Fig. 6, upper row). In contrast, the FB-GFP fusion polypeptide could not be detected in the cells transfected with a plasmid carrying the double ΔMet^-25/ ΔMet^-24 deletions; instead, GFP alone was found (Fig. 6, middle row). The expression of GFP alone from the latter plasmid is not surprising since in the plasmid employed, the canonical Kozak sequence is provided immediately upstream of the GFP cDNA. It seems, therefore, that during the scanning of the mRNA transcribed from the plasmid carrying the ΔMet^-25 / ΔMet^-24 double deletion, the cellular ribosomes, unable to recognize the remaining AUG as the initiation codon, including the AUG encoding a putative Met^-40, continues scanning the mRNA downstream region, until they encounter a GFP translation initiation codon. Together, these results point to Met^-24 as the translation initiation start of the human factor B cDNA.

Of special interest is the finding that expression of factor B without its cognate mitochondrial targeting leader led to the distribution of the polypeptide between the cytoplasm and the nucleus in HEK293 cells (Fig. 3, D and F). It is well accepted that nuclear localization of cellular proteins whose molecular weights exceed ~60 kDa requires the presence of a highly basic nuclear localization signal (NLS), while ions, small metabolites and globular proteins of less than 60 kDa can diffuse through a water-filled channel of the nuclear envelope nuclear pore complex [17]. It is therefore plausible that the nuclear localization of a 20.3 kDa mature factor B could be achieved by its diffusion from the cytoplasm without employing a mechanism that relies on a specific recognition by importin α of the NLS motif within its potential cargo [17]. Indeed, we could not detect a canonical NSL motif Pro-Lys-Lys-Lys-Arg-Lys-Val within the amino acid sequence of factor B, which does not preclude the existence of a non-canonical NSL motif [19]. Surprisingly, we detected a short stretch comprised of Phe¹⁶¹-Lys-Thr-Ala-Leu-Pro-Ser-Leu-Glu-Leu¹⁷⁰ amino acids in the C-terminus of the human factor B polypeptide that conforms to a leucine-rich nuclear export signal (NES) consensus motif Leu-x(2, 3)-[Leu,Ile,Val,Phe,Met]-x(2, 3)-Leu-x-[Leu,Ile] [20]. The Phe¹⁶¹-Leu¹⁷⁰ sequence is conserved within the amino acid sequences of the human, bovine, rat, mouse, chicken, fish and zebra fish factor B polypeptides; in the latter three species, a Leu¹⁶¹ occurs instead of a Phe¹⁶¹(not shown, seeFig. 2in Ref. 7for sequence alignment of the indicated orthologs). Notably, a mutation study of a NES motif identified in the protein kinase A inhibitor (PKI) has indicated that the leucine residues located in the C-terminus of the signal are more important for function than the N-terminal leucine [21]. The cryptic nature of the putative NES identified in factor B is obvious, since factor B ectopically expressed from presequence-carrying plasmids was found exclusively in mitochondria but not in other organelles or compartments of HEK293 cells (Figs. 2B, 3C and 3I). The conditions under which the NES of factor B could become functionally active would require mutations of the amino acids that comprise the 24-residue presequence, which, in turn, could compromise the mitochondrial delivery of the polypeptide. Their occurrence or circumstances under which they could arise remain to be invesitigated.

A splice variant (GenBank™ accession number U79253) of the factor B gene encodes a putative 96-residue mature polypeptide that exhibits 100% sequence identity with the first 80 amino acids of the mature factor B, but has a distinct C-terminus. Using RT-PCR, we demonstrated previously that the splice variant mRNA was expressed in all 16 human tissues present in commercially prepared cDNA paneles [6]. However, we could not detect a corresponding translation product of ~11 kDa with antiserum raised against this fragment in neither bovine heart mitochondria [6] nor in the total lysates of the HEK293 cells transfected with the plasmid harboring U79253 cDNA alone (this work; data not shown). Our attempts to express the 96-residue polypeptide in a soluble form in E. coli have also been unsuccessful. Together, these findings could suggest that a polypeptide encoded by transcript U79253 cannot fold independently in the absence of the second half of the factor B molecule, and is unlikely to compete with a 175-residue mature factor B for a binding site on the inner mitochondrial membrane. Rather, its production could be used as a mechanism of downregulation of cellular levels of a transcript encoding the functionally active, full-length factor B.

In summary, we have identified the optimal length of the presequence required for targeting of human factor B to mitochondria. Our results demonstrate that a 24-residue presequence is sufficient for targeting factor B to the organelle, and suggest that the human factor B precursor is a 199-amino acid polypeptide. To our knowledge, this is the first report describing ectopic expression of factor B in a human cell line. The experimental tools developed in the present study are expected to facilitate future work aimed at understanding the role of factor B in oxidative phosphorylation and mitochondrial physiology.

Abbreviations

AE-SMP

ammonia-EDTA-treated bovine heart submitochondrial particles depleted of factor B

FB

a regulatory component of the ATP synthase complex factor B

GFP

green fluorescent protein