Skip to main content
NCBI home page
Journal of Bacteriology logoLink to Journal of Bacteriology
. 1994 Sep;176(17):5525–5529. doi: 10.1128/jb.176.17.5525-5529.1994

Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis.

R Osuna 1, A Schwacha 1, R A Bender 1
PMCID: PMC196741  PMID: 8071231

Abstract

Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.

Full text

PDF
5525

Images in this article

5528Image
on p.5528

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Allison S. L., Phillips A. T. Nucleotide sequence of the gene encoding the repressor for the histidine utilization genes of Pseudomonas putida. J Bacteriol. 1990 Sep;172(9):5470–5476. doi: 10.1128/jb.172.9.5470-5476.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Boylan S. A., Eades L. J., Janssen K. A., Lomax M. I., Bender R. A. A restriction enzyme cleavage map of the histidine utilization (hut) genes of Klebsiella aerogenes and deletions lacking regions of hut DNA. Mol Gen Genet. 1984;193(1):92–98. doi: 10.1007/BF00327420. [DOI] [PubMed] [Google Scholar]
  3. Brill W. J., Magasanik B. Genetic and metabolic control of histidase and urocanase in Salmonella typhimurium, strain 15-59. J Biol Chem. 1969 Oct 10;244(19):5392–5402. [PubMed] [Google Scholar]
  4. Dunn T. M., Hahn S., Ogden S., Schleif R. F. An operator at -280 base pairs that is required for repression of araBAD operon promoter: addition of DNA helical turns between the operator and promoter cyclically hinders repression. Proc Natl Acad Sci U S A. 1984 Aug;81(16):5017–5020. doi: 10.1073/pnas.81.16.5017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Eismann E., von Wilcken-Bergmann B., Müller-Hill B. Specific destruction of the second lac operator decreases repression of the lac operon in Escherichia coli fivefold. J Mol Biol. 1987 Jun 20;195(4):949–952. doi: 10.1016/0022-2836(87)90499-2. [DOI] [PubMed] [Google Scholar]
  6. Fritz H. J., Bicknäse H., Gleumes B., Heibach C., Rosahl S., Ehring R. Characterization of two mutations in the Escherichia coli galE gene inactivating the second galactose operator and comparative studies of repressor binding. EMBO J. 1983;2(12):2129–2135. doi: 10.1002/j.1460-2075.1983.tb01713.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Gerson S. L., Magasanik B. Regulation of the hut operons of Salmonella typhimurium and Klebsiella aerogenes by the heterologous hut repressors. J Bacteriol. 1975 Dec;124(3):1269–1272. doi: 10.1128/jb.124.3.1269-1272.1975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Goldberg R. B., Magasanik B. Gene order of the histidine utilization (hut) operons in Klebsiella aerogenes. J Bacteriol. 1975 Jun;122(3):1025–1031. doi: 10.1128/jb.122.3.1025-1031.1975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Hagen D. C., Gerson S. L., Magasanik B. Isolation of super-repressor mutants in the histidine utilization system of Salmonella typhimurium. J Bacteriol. 1975 Feb;121(2):583–593. doi: 10.1128/jb.121.2.583-593.1975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Hagen D. C., Magasanik B. Deoxyribonucleic acid-binding studies on the hut repressor and mutant forms of the hut repressor of Salmonella typhimurium. J Bacteriol. 1976 Aug;127(2):837–847. doi: 10.1128/jb.127.2.837-847.1976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Henikoff S. Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene. 1984 Jun;28(3):351–359. doi: 10.1016/0378-1119(84)90153-7. [DOI] [PubMed] [Google Scholar]
  12. Hu L., Allison S. L., Phillips A. T. Identification of multiple repressor recognition sites in the hut system of Pseudomonas putida. J Bacteriol. 1989 Aug;171(8):4189–4195. doi: 10.1128/jb.171.8.4189-4195.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Irani M. H., Orosz L., Adhya S. A control element within a structural gene: the gal operon of Escherichia coli. Cell. 1983 Mar;32(3):783–788. doi: 10.1016/0092-8674(83)90064-8. [DOI] [PubMed] [Google Scholar]
  14. Johnson A. D., Meyer B. J., Ptashne M. Interactions between DNA-bound repressors govern regulation by the lambda phage repressor. Proc Natl Acad Sci U S A. 1979 Oct;76(10):5061–5065. doi: 10.1073/pnas.76.10.5061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Leidigh B. J., Wheelis M. L. Genetic control of the histidine dissimilatory pathway in Pseudomonas putida. Mol Gen Genet. 1973 Feb 2;120(3):201–210. doi: 10.1007/BF00267152. [DOI] [PubMed] [Google Scholar]
  16. Magasanik B., Lund P., Neidhardt F. C., Schwartz D. T. Induction and repression of the histidine-degrading enzymes in Aerobacter aerogenes. J Biol Chem. 1965 Nov;240(11):4320–4324. [PubMed] [Google Scholar]
  17. Nieuwkoop A. J., Baldauf S. A., Hudspeth M. E., Bender R. A. Bidirectional promoter in the hut(P) region of the histidine utilization (hut) operons from Klebsiella aerogenes. J Bacteriol. 1988 May;170(5):2240–2246. doi: 10.1128/jb.170.5.2240-2246.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Nieuwkoop A. J., Bender R. A. RNA polymerase as a repressor of transcription in the hut(P) region of mutant Klebsiella aerogenes histidine utilization operons. J Bacteriol. 1988 Oct;170(10):4986–4990. doi: 10.1128/jb.170.10.4986-4990.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Nieuwkoop A. J., Boylan S. A., Bender R. A. Regulation of hutUH operon expression by the catabolite gene activator protein-cyclic AMP complex in Klebsiella aerogenes. J Bacteriol. 1984 Sep;159(3):934–939. doi: 10.1128/jb.159.3.934-939.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Osuna R., Boylan S. A., Bender R. A. In vitro transcription of the histidine utilization (hutUH) operon from Klebsiella aerogenes. J Bacteriol. 1991 Jan;173(1):116–123. doi: 10.1128/jb.173.1.116-123.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Osuna R., Janes B. K., Bender R. A. Roles of catabolite activator protein sites centered at -81.5 and -41.5 in the activation of the Klebsiella aerogenes histidine utilization operon hutUH. J Bacteriol. 1994 Sep;176(17):5513–5524. doi: 10.1128/jb.176.17.5513-5524.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Prival M. J., Magasanik B. Resistance to catabolite repression of histidase and proline oxidase during nitrogen-limited growth of Klebsiella aerogenes. J Biol Chem. 1971 Oct 25;246(20):6288–6296. [PubMed] [Google Scholar]
  23. Saint-Girons I., Fritz H. J., Shaw C., Tillmann E., Starlinger P. Integration specificity of an artificial kanamycin transposon constructed by the in vitro insertion of an internal Tn5 fragment into IS2. Mol Gen Genet. 1981;183(1):45–50. doi: 10.1007/BF00270136. [DOI] [PubMed] [Google Scholar]
  24. Schwacha A., Bender R. A. Nucleotide sequence of the gene encoding the repressor for the histidine utilization genes of Klebsiella aerogenes. J Bacteriol. 1990 Sep;172(9):5477–5481. doi: 10.1128/jb.172.9.5477-5481.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES