Abstract
To assess the role of the CALM‐AF10 fusion gene in leukemic transformation in vivo, we generated transgenic mice that expressed a CALM‐AF10 fusion gene. Depending on the transgenic line, at least 40–50% of the F1 generation mice developed acute leukemia, at a median age of 12 months. Leukemic mice typically had enlarged spleens, invasion of parenchymal organs with malignant cells, and tumors with myeloid markers such as myeloperoxidase, Mac1, and Gr1. Although most leukemias were acute myeloid leukemia (AML), many showed lymphoid features, such as CD3 staining, or clonal Tcrb or Igh gene rearrangements. Mice were clinically healthy for the first 9 months of life, and had normal peripheral blood hemograms, but showed impaired thymocyte differentiation, manifested by decreased CD4+/CD8+ cells and increased immature CD4−/CD8− cells in the thymus. Hematopoietic tissues from both clinically healthy as well as leukemic CALM‐AF10 mice showed up‐regulation of Hoxa cluster genes, suggesting a potential mechanism for the impaired differentiation. The long latency period and incomplete penetrance suggest that additional genetic events are needed to complement the CALM‐AF10 transgene and complete the process of leukemic transformation.
Keywords: Acute Myeloid Leukemia (AML), CALM, AF10, HOXA, chromosomal translocation
Introduction
The analysis of fusion genes produced by non‐random, recurring chromosomal translocations has proven to be a rich source of insights into the process of leukemic transformation (1–3). The recurring t(10;11)(p14;q21) chromosomal translocation has been recognized in patients with a wide array of hematologic malignancies (http://cgap.nci.nih.gov/Chromosomes/Mitelman), most commonly pre‐T lymphoblastic leukemia/lymphoma (pre‐T LBL) and acute myeloid leukemia (AML). A recent analysis of pre‐T LBL patients with the t(10;11)(p14;q21) demonstrated that the vast majority of samples either expressed the T cell receptor (TCR) γδ heterodimer or were immature, undifferentiated T‐cells that expressed no TCR (4). Moreover, most of the AML or acute undifferentiated leukemia (AUL) patients in that series demonstrated TCR gene rearrangements, suggesting that the transformed cell may have possessed the potential for lymphoid differentiation (4). The t(10;11)(p14;q21) translocation breakpoint was initially cloned from the U937 cell line, a cell line with monocytic features that was initially established from a patient with histiocytic lymphoma, and was shown to result in an in‐frame fusion between the CALM and AF10 genes (5).
The CALM (for Clathrin Assembly Lymphoid Myeloid; also known as PICALM) gene is ubiquitously expressed and encodes a 652 aa residue protein (5). CALM has structural similarity to the clathrin‐binding protein AP180 (6), contains an epsin N‐terminal homology (ENTH) domain, DPF (ASP‐Pro‐Phe) and NPF (Asn‐Pro‐Phe) motifs, and clathrin‐binding sequences (CBS) (6, 7). The CALM protein is normally involved in endocytosis and the formation of clathrin‐coated vesicles from cell membranes. Mutations in the CALM gene lead to defective endocytosis, and are responsible for the iron metabolism defects seen in fit1 mice (7).
AF10 (also known as MLLT10) was initially cloned as an MLL chromosomal translocation partner gene in patients with AML (8). Similar to CALM, AF10 is ubiquitously expressed and encodes a 1027 aa protein. AF10 contains N‐terminal zinc‐fingers, and a C‐terminal leucine zipper and AT‐hook domain. AF10 is thought to normally function as a transcription factor, and has been shown to be leukemogenic when fused to MLL (9). Deletion analysis of the MLL‐AF10 fusion protein has demonstrated that the AF10 leucine zipper motif is required for leukemic transformation (9).
The CALM‐AF10 fusion genes retain all but the final 4 amino acid residues of the CALM gene, which is fused to the C‐terminal portion of the protein encoded by the AF10 gene (4, 5). Although the CALM fusion point is constant, at least 4 different AF10 fusion points have been described; these have been classified as 5’ or 3’ transcripts, depending on how far 5’ on the AF10 sequence the fusion occurs (4). There is a correlation between the fusion point and leukemic phenotype, with 3’ fusion transcripts being associated with more immature T‐cells that do not express a TCR on the cell surface, and 5’ fusion transcripts being associated with TCRγδ T‐cells (4).
Since cancer develops in the context of an intact organism, with the influence of nearby cells and tissues, genetically engineered animal models have become a standard model for demonstrating that a lesion associated with any form of malignancy causes the malignancy (10). Moreover, generation of mouse models allows one to study the process of malignant transformation over time in vivo. In this report, we show that expression of CALM‐AF10 in murine hematopoietic cells leads to overexpression of Hoxa cluster genes, impairs hematopoietic differentiation, and is ultimately leukemogenic.
Materials and Methods
Generation of transgenic mice
A CALM‐AF10 fusion cDNA fragment was amplified from the U937 cell line using RT‐PCR, and fragments of CALM and AF10 derived from EST clones were ligated to the 5’ and 3’ portion of the fusion cDNA. A human β‐globin 5’ untranslated region was ligated to the 5’ portion of a full length CALM‐AF10 cDNA, and the resultant cDNA was cloned into the SfiI and NotI sites of the HS21/45‐vav vector (11). In order to delete all plasmid backbone sequences, the CALM‐AF10 insert was then shuttled into the pSV40zeo (Invitrogen, Carlsbad, CA) vector by using a partial HindIII digest. The resultant plasmid, pSVZvavCA was digested with PmeI to remove all plasmid sequences. The CALM‐AF10 expression cassette was purified over a sucrose gradient, and FVB/N zygotes were microinjected with the construct at the NCI transgenic animal facility. Transgenic mice that had incorporated the construct were identified by Southern blot analysis of tail DNA. The transgenic lines were maintained by breeding to wild‐type FVB/N mice. Offspring of the founders were genotyped using polymerase chain reaction (PCR) amplification of the CALM‐AF10 fusion gene from tail biopsy using primers 5’TGTTCCTGTAATGACGCAACCAACC3’ and 5’CTCTGGAATATACAGGGCACAAACA3’ and a thermal cycling profile of 94°C for 3 min; 34 cycles of 94°C for 30 seconds, 62°C for 30 seconds, 72°C for one minute; followed by a terminal extension of 72°C for 10 minutes.
Expression of the CALM‐AF10 transgene
Expression of the CALM‐AF10 transgene was determined by Northern blot analysis and RT‐PCR. Total RNA was isolated from thymus, spleen, bone marrow, liver and kidney of mice using Trizol (Invitrogen) reagents and protocols. Total RNA (10µ) was size‐fractionated on an agarose/formaldehyde gel, transferred to a nitrocellulose membrane as previously described (12) and hybridized with a 32P‐labeled‐human CALM probe (0.5 kb HindIII‐EcoRI fragment; nucleotides 1588‐2121 of NM_007166.2). The probe was labeled with 32P‐dCTP using Ready‐To‐Go™ DNA Labeled Beads (dCTP) (Amersham, Bioscience, Little Chalfont Buckinghamshire, England) and the manufacturer’s recommended protocol. Stringency washes were 20 min × 2 with 0.1 × SSC/0.1% SDS at 52C. RT‐PCR amplification of the CALM‐AF10 mRNA was performed by reverse transcription of 1 ug total DNase‐treated (Ambion, Austin, TX) RNA using Superscript II reverse transcriptase (RT) and random hexamer primers (Invitrogen) in a volume of 20 uL. 1–2 uL of the reverse transcription reaction was used to amplify the CALM‐AF10 fusion with primers 5’TGTTCCTGTAATGACGCAACCAACC 3’ and 5’CTCTGGAATATACAGGGCACAAACA 3’ and a thermal cycling profile of 94°C for 3 min; 34 cycles of 94°C for 30 seconds, 62°C for 30 seconds, 72°C for one minute; followed by a terminal extension of 72°C for 10 minutes.
Evaluation of leukemic and healthy mice
A cohort of 38 transgenic and 33 wild‐type littermate controls were housed together and observed daily for signs and symptoms of disease. Statistical analysis was done by chi‐square with 1 df at 18 months of age. Whole blood was obtained from tail veins for complete blood counts (CBC) and morphological evaluation in attempts to detect leukemia in clinically healthy mice. Mice that showed signs of disease such as ruffled fur, hunched posture, or difficulty in breathing were euthanized for postmortem evaluation. Mice that were found dead were also dissected and tissues placed in formalin as below, unless the tissues were judged to be severely decomposed. Tissue samples including the liver, kidney, spleen, thymus, bone marrow, lung, and heart were fixed in 10% neutral buffered formalin (Sigma, St. Louis, MO), paraffin embedded, sectioned at 5 um, and stained with hematoxylin and eosin (HE) or antimyeloperoxidase (MPO; DAKO), CD3 (DAKO, Carpinteria, CA), F4/80 (Caltag, San Francisco, CA), and B220 (CD45R; Pharmingen, San Diego, CA). The Bethesda proposals for classifying nonlymphoid hematopoietic and lymphoid neoplasms in mice were used as guides to evaluate tissues from CALM‐AF10 mice (13, 14). Single‐cell suspensions prepared from thymus, spleen, and/or bone marrow were incubated with fluorescein isothiocyanate (FITC)‐conjugated anti‐mouse CD8, B220, Gr‐1, phycoerythrin (PE)‐conjugated anti‐mouse CD4, IgM, Mac‐1 (Pharmingen) and allophycocyanin (APC)‐conjugated anti‐mouse CD19, CD117, and IgM (eBioscience, San Diego, CA) and phycoerythrin‐cy5 (PE‐Cy5)‐conjugated antimouse CD24analyzed by three‐color flow cytometry to determine immunophenotype. To identify Lin‐/Sca‐1+/c‐Kit+ (“LSK”) cells, mouse bone marrow cells were resuspended with Hank’s balanced salt solution containing 2% FBS (HF2) to 1×107 cells/mL. The cells were incubated with biotin conjugated lineage antibodies cocktail (CD5, TER119, B220, GR‐1, Mac‐1, 7‐4; Stemcell Technologies, Vancouver, Canada); Streptavidin conjugated to APC (Pharmingen), anti‐cKit conjugated to FITC (Pharmingen) and anti‐Sca‐1 conjugated to PE (Pharmingen). The stained cells were resuspended with HF2 containing 1 ug/mL of propidum iodide (Sigma). Four‐color staining was used to identify LSK cells. Statistical differences between groups was done using a two‐sided student’s t test.
Southern blot analysis for Tcrb, Tcrd, and Igh gene rearrangements
Genomic DNA from mouse liver, spleen, or thymus was digested with either HindIII or SstI (for Tcrb and Tcrd gene rearrangements), or EcoRI or XbaI (for Igh rearrangements) size‐fractionated on a 0.8% agarose gels, and transferred to nitrocellulose membranes, as previously described (15). The nitrocellulose membrane was hybridized to a 32P‐labeled TCRB probe that detects the constant region of both Tcrb1 and Tcrb2 gene or to a 32P‐labeled Jδ1 TCRD probe (16) that detects the Jδ1 and constant regions of Tcrd, or to a 32P‐labeled murine Igh probe that hybridizes to the JH3‐4 region of the mouse Igh locus (17).
Real Time RT‐PCR assay for Hoxa5, Hoxa7, Hoxa9 Hoxa10, Hoxa11, Hoxa13, Hoxb4, Hoxd13, and Meis1
Total RNA (1 ug) from transgenic or wild‐type spleen, bone marrow, and thymus, as well as spleen infiltrated by leukemic cells was reverse transcribed as described above. Real time RT‐PCR was performed on a 7500 Fast Real Time Taqman PCR system (Applied Biosystem) using aliquots of first strand cDNA as templates for mouse Hoxa5, Hoxa7, Hoxa9, Hoxa10, Hoxa11, Hoxa13, Hoxb4, Hoxd13, and Meis1 with Applied Biosystems primer and probe sets. Primer details are available upon request. The expression of the 18S ribosomal RNA was used as an endogenous control. All reactions were performed in triplicate, and the −ΔΔCT mean and standard error were calculated for each sample. Values for the transcript of interest were normalized to the 18S rRNA value and compared to the expression in wild type bone marrow.
Results
Generation of mice that express a CALM‐AF10 fusion gene
In order to generate genetically identical mice that expressed a CALM‐AF10 fusion gene, we used RT‐PCR to amplify a portion of the CALM‐AF10 fusion cDNA from the U937 cell line. Although several different CALM‐AF10 fusion cDNAs have been described (4), the predominant fusion cDNA that we detected in the U937 cell line joined CALM nucleotide 2230 (Genbank reference NM_007166.2) to AF10 nucleotide 241 (Genbank reference NM_001009569.1). We then extended the fusion cDNA 5’ and 3’ by ligating portions of CALM and AF10 cDNAs to the CALM‐AF10 PCR product, and introduced a human beta‐globin 5’ untranslated region to aid in the translation of the CALM‐AF10 fusion mRNA. The entire coding sequence of the CALM‐AF10 cDNA was 4881 nucleotides encoding a 1627 aa protein (see Supplemental Fig. 1 for nucleotide sequence). This cDNA was cloned into the HS21/45‐vav vector (11) that uses 5’ and 3’ vav regulatory elements to direct expression of cDNA inserts specifically in hematopoietic tissues (Fig. 1A).
Figure 1. Expression of a CALM‐AF10 transgene.
(A) Map of the construct used to generate CALM‐AF10 transgenic mice. 5’ and 3’ vav regulatory sequences are indicated. The fusion between CALM nucleotide 2230 and AF10 nucleotide 241 is indicated. (B) Northern blot of tissues from CALM‐AF10 mouse (line E6) and wild‐type littermate. T, thymus; BM, bone marrow; Li, liver; S, spleen; K, kidney. The CALM‐AF10 fusion transcript is shown with an arrow. (C) RT‐PCR analysis of tissue from CALM‐AF10 line C10. W, deionized H2O control. Human β‐actin primers were used as a RNA quality control for the U937 cell line; C‐A, CALM‐AF10. (D) Survival of CALM‐AF10 mice. Transgenic mice from line C10 (20) and E6 (18), along with 33 wild‐type littermate controls were followed for 18 months. *, p<1×10−08 compared to littermate controls.
Transgenic CALM‐AF10 mice were generated by pronuclear injection of FVB/N single cell embryos, and eight potential founders were identified by Southern blotting of tail DNA. Four founders were bred and all four transmitted the transgene. F1 mice were euthanized to determine expression of the transgene. As expected, the CALM‐AF10 transgene was expressed in hematopoietic tissues (thymus, bone marrow, and spleen), but not in non‐hematopoietic tissues (liver, kidney) (Fig. 1B, Fig. 1C). Complete blood counts (CBC) were obtained from clinically healthy offspring of the CALM‐AF10 founders aged 6–10 months; although the CALM‐AF10 transgenic mice had increased numbers of atypical lymphocytes (data not shown), there were no statistical differences in, white blood cell, neutrophil, lymphocyte, hemoglobin, or platelet counts (Supplemental Table 1).
CALM‐AF10 mice develop acute leukemia
A cohort of transgenic offspring from two founders, C10 and E6, were followed for 18 months and were euthanized when signs and symptoms of leukemia, such as tachypnea, lethargy, ruffled fur, hunched posture, or lymphadenopathy were detected. Additionally, mice that were found dead in their cage were necropsied when possible, and tissues harvested for histology. As shown in Fig. 1D, 83% of the E6 transgenic mice and 70% of the C10 transgenic mice died by 18 months of age. At least 9 of the 18 (50%) E6 mice and 8 of the 20 (40%) C10 mice had clear signs of leukemia; several additional mice were found dead but were too autolytic to analyze. Wild type mice that died during the study showed no evidence of leukemia. In addition to the E6 and C10 offspring, one potential founder mouse, D5, developed a myeloid leukemia, and one of six offspring of a fourth founder (D3) died of a myeloid leukemia.
Leukemic mice typically had hunched posture, ruffled fur, and tachypnea. Gross examination revealed marked splenomegaly and hepatomegaly, with prominent scattered white foci. Histologically, the splenic red pulp was effaced by an expanding myeloid infiltrate accompanied by follicular atrophy. Peripheral blood examination showed circulating blasts with a high nuclear/cytoplasmic ratio, and the bone marrow was replaced by cells with a similar appearance (Fig. 2). In addition to the spleen, parenchymal organs such as liver, lung, kidney and brain were infiltrated with malignant cells. Involved tissues were evaluated by immunohistochemical stains including the myeloid marker myeloperoxidase (MPO), the B‐cell marker B220, the T‐cell marker CD3, and the monocytic marker F4/80 (Table 1). CBCs, FACS, and antigen‐receptor gene rearrangements were also analyzed on a subset of leukemic mice.
Figure 2. Myeloid leukemia in CALM‐AF10 mouse 9001.
(A) Liver stained with H&E (left panel), MPO (middle panel), or B220 (right panel). Original magnification × 200 (inset × 1000). (B) Peripheral blood (left panel) or bone marrow cytospin (right panel) stained with May‐Giemsa. Note increased numbers of blasts in the peripheral blood and bone marrow. Original magnification × 1000. (C) Bone marrow and spleen stained with the indicated antibodies, note the Mac‐1+/B220+ population in bone marrow and spleen
Table 1.
Summary of CALM‐AF10 Transgenic Mice with Leukemia
| ID | Age (mo) | Diagnosis | Clinical Features | Histology | IHC | Tcrb | Tcrd | Igh | |||
|---|---|---|---|---|---|---|---|---|---|---|---|
| MPO | B220 | CD3 | F4/80 | ||||||||
| E6 | |||||||||||
| 2968 | 15 | Myeloid leukemia | FD | Invasion of liver, kidney | + | − | − | − | nd | nd | nd |
| 7001 | 15 | Myeloid leukemia | FD, splenomegaly | Invasion of liver, kidney, spleen | + | + | − | − | nd | nd | nd |
| 7004 | 5 | Leukemia, NOS**** | FD; marked autolysis | Invasion of bone marrow, liver, kidney, spleen | − | − | − | − | nd | nd | nd |
| 7019 | 6 | Myeloid leukemia | FD, | Invasion of bone marrow | + | − | − | − | − | − | − |
| 7026 | 18 | Myelomonocytic leukemia | ruffled fur, splenomegaly | Invasion of liver and spleen | + | + | − | + | − | − | − |
| 7087 | 14 | Myeloid leukemia | clinically healthy* | Invasion of bone marrow | + | + | − | − | − | − | − |
| 7088 | 17 | Myeloid leukemia | ocular discharge, ruffled fur, splenomegaly | Invasion of liver, kidney, spleen | + | − | − | − | − | − | − |
| 7092 | 14 | Leukemia, NOS**** | FD; mildly autolytic, hepatosplenomegaly | Invasion of liver, kidney, spleen | − | − | − | − | + | − | + |
| 7095 | 18 | Myeloid leukemia | FD; splenomegaly | Invasion of liver, kidney, spleen, lung | + | − | − | − | + | − | + |
| C10 | |||||||||||
| 2948 | 18 | Myeloid leukemia | FD | Invasion of bone marrow, liver, kidney, lung | + | − | − | − | − | − | −** |
| 2952 | 16 | Myeloid leukemia | clinically healthy* | + | + | − | − | − | − | + | |
| 2953 | 14 | Myelomonocytic leukemia | lethargy, tachypnea, hepatomegaly | Invasion of bone marrow, lung, liver, kidney, spleen | + | + | + | + | + | + | + |
| 7060 | 17 | Myeloid Leukemia | FD | Invasion of bone marrow | + | − | − | − | nd | nd | nd |
| 7081 | 14 | Myeloid leukemia | ruffled fur, splenomegaly | Invasion of liver, lung, heart, kidney, pancreas, meninges, sinuses, spleen, bone marrow | + | + | − | − | − | − | − |
| 7083 | 9 | Myeloid leukemia | FD | Invasion of bone marrow, lung, kidney | + | − | − | − | nd | nd | nd |
| 7160 | 17 | Myeloid leukemia | hunched, ruffled fur, splenomegaly | Invasion of bone marrow, liver, lung, kidney, spleen | + | − | − | − | − | − | + |
| 7161 | 12 | Leukemia, NOS**** | FD, splenomegaly | Invasion of liver, kidney, spleen, lung | − | − | − | − | − | − | + |
| 9001*** | 12 | Myeloid leukemia | clinically healthy*, splenomegaly, lymphadenopathy | Invasaion of bone marrow, lung, liver, kidney, spleen lymph nodes | + | + | − | − | − | nd | + |
| 9014*** | 12 | Myeolid leukemia | clinically healthy*, splenomegaly, lymphadenopathy | Invasion of bone marrow, lung, liver, kidney, spleen, lymph nodes | + | + | − | − | − | nd | − |
| 9043*** | 17 | Myeolid leukemia | lethargy, ruffled fur, hunched posture, splenomegaly, lymphadenopathy | Invasion of bone marrow, lung, liver, kidney, spleen, lymph nodes | + | + | − | − | − | nd | + |
FD = Found Dead
NOS = Not otherwise specified
nd = not done
Mouse euthanized due to CBC that showed an increased WBC, decreased HGB, and circulating blasts.
No clonal rearrangements identified, but genomic DNA was partially degraded.
9001, 9014, and 9043 were not part of the intial cohort shown in Fig. 1.
Mouse foud dead and partially autolytic. IHC stains were negative.
As shown in Table 1, all 17 of the analyzable leukemias were MPO positive, indicating that these mice had a myeloid leukemia. Three additional mice (7004, 7092 and 7061) were found dead and showed leukemic infiltration of parenchymal organs including the liver, kidney, and spleen, but did not stain positively for MPO, B220, CD3, or F4/80, raising the possibility that these mice had undifferentiated leukemias. However, given the phenotype of the other leukemic mice, it is likely that these were also myeloid leukemias, but that the MPO antibody was non‐reactive because the tissues were partially autolytic. Nine of these analyzable leukemias were also B220+, and FACS analysis performed on a subset of these mice showed a population of leukemic cells that were Mac1+/B220+ (Fig. 2). Eight of the MPO+ leukemias were negative for B220; a subset of these were analyzed by FACS and shown to be Mac1+/B220− (Supplemental Fig. 2). Two mice (7026 and 2953) developed myelomonocytic leukemia as evidenced by both MPO and F4/80 immunohistochemical staining; one of these also stained positive for CD3 (Supplemental Fig. 3). Taken together, these findings demonstrate that expression of a CALM‐AF10 fusion gene leads to an acute leukemia, with a long latency period and incomplete penetrance.
Immunophenoptype analysis
We observed that over half of the leukemic mice had either MPO+/B220+ cells within tumor infiltrates or were Mac1+/B220+ by FACS analysis. We considered the possibility that these B220+ leukemic cells might have other properties of B cells, or that they may be more immature bi‐phenotypic cells, suggesting that the leukemia had arisen in a common early progenitor cell with the potential to differentiate along the myeloid or lymphoid lineages. Therefore, the leukemic Mac1+/B220+ population was assayed for the expression of either cKit (CD117), CD19, CD24, or IgM. As shown in Fig. 3, although the leukemias were consistently positive for Mac1, the B220 staining was quite variable (compare #9001 and #7160, Fig. 3). The Mac1+/B220+ cells were typically positive for CD24, negative for IgM and CD19, but showed variable expression of CD117, ranging from 23–72% positive cells. Of note, some of the mice (such as 9001, see Fig. 3A) had a distinct B220+ population that was distinct from the Mac1+/B220+ population (gate R4 in Fig. 3A). This “bright” B220+ population was not present in bone marrow from the leukemic mouse (data not shown), and these cells were positive for CD19 and IgM (not shown), leading us to conclude that the Mac1−/B220 “bright” population in the spleen represented contaminating normal B cells. The B220 “dim” population (gate R5 in Fig. 3A) from these same mice was negative for both IgM and CD19 (not shown).
Figure 3. Immunophenotype of CALM‐AF10 leukemia.
(A) Cells isolated from leukemic CALM‐AF10 mouse spleens were stained with the indicated antibodies, and 10,000 total events scored. Gates R3, R4, and R5 are shown. Cells in gate R3 were scored for CD19, CD117, IgM, and CD24. (B) Summary of five CALM‐AF10 mice with AML; the cells in gate R3 were scored for CD19, CD117, IgM, and CD24.
Antigen receptor gene rearrangements
Because some of the leukemic mice stained for either the B‐cell marker B220 or the T‐cell marker CD3 in addition to myeloid markers, we considered the possibility that some of these cells might have additional features of T or B lymphocytes, such as clonal Tcrb, Tcrd, or Igh gene rearrangements. As shown in Fig. 4, some of these leukemias had clonal T‐cell and/or immunoglobulin gene rearrangements; indeed one mouse (2953) had clonal rearrangements of Tcrb, Tcrd, and Igh‥ In all, 3 of 15 mice analyzed had clonal Tcrb gene rearrangements, 1 of 15 had a clonal Tcrd gene rearrangement, and 8 of 15 mice analyzed had clonal Igh gene rearrangements.
Figure 4. Clonal Igh and TCR gene rearrangements.
(A) Southern blot of HindIII digested genomic DNA hybridized to a TCRB probe. Mouse numbers are indicated, a number followed by S indicates the infiltrated tissue was spleen, L indicates the tissue was liver. C is germline control tissue. Asterisk indicates germline bands, arrows indicate clonal rearrangments. Size standards are in kb. (B) Same as in (A), except the probe was TCRD. (C and D) Same as (A) except the digest was XbaI and the probe was IGH.
Myeloid and T‐cell differentiation in clinically healthy CALM‐AF10 mice
Given that the human disease most often associated with CALM‐AF10 fusions is pre‐T LBL, we were somewhat surprised that the majority of the mice in this series had myeloid leukemia (although a minority of these leukemias had T‐cell features such as CD3 staining and/or clonal Tcrb or Tcrd gene rearrangements). Since previously published models of pre‐T LBL have often shown evidence of perturbed thymocyte differentiation prior to the onset of pre‐T LBL, we studied thymocyte subsets in 8 CALM‐AF10 transgenic and 8 wild‐type control littermates. Supplemental Fig. 4A shows that 4 of 8 transgenic mice had significantly decreased numbers of double positive CD4+/CD8+ (hereafter DP) cells (1–36 %), coinciding with dramatically increased numbers of more immature CD4−/CD8− (hereafter DN) cells (27–90%). Consistent with this finding, a mouse with >80 % DN cells (mouse # 9045) had Tcrb alleles that were exclusively in the germline configuration, in contrast to control mice with normal (<10%) numbers of DN cells, and transgenic mice with less marked (<30%) increases in DN cells, who demonstrated polyclonal Tcrb gene rearrangements (Supplemental Fig. 4B). As shown in Supplemental Fig. 4, the degree of impaired thymocyte differentiation was quite variable, indicating that the penetrance of this phenotype was incomplete.
Since the mice developed primarily myeloid leukemias, we assayed the proportion of Mac1+/Gr1+ cells in the bone marrow, to determine if there was an expansion of this population in clinically healthy mice. Although there were increased numbers of Mac1+/Gr1+ cells in the CALM‐AF10 transgenic mice (68.7±12.4) compared to wild‐type littermates (54.2±6.8), this difference did not reach statistical significance (Supplemental Fig. 5). We evaluated bone marrow from clinically healthy mice to determine if there was expansion of LSK cells in bone marrow. Although there was a trend toward decreased LSK cells in CALM‐AF10 mice (0.03±0.007%) compared to wild‐type controls (0.08±0.003%), this difference was not statistically significant.
Hoxa cluster genes are up‐regulated in CALM‐AF10 mice
When compared to pre‐T LBL patients without CALM‐AF10 fusions, pre‐T LBL patients with CALM‐AF10 fusions show up‐regulation of HOXA cluster genes, including HOXA5, HOXA9, and HOXA10 (18). In addition, the CALM‐AF10 patients showed up‐regulation of BMI‐1, which is located within 500 kb of AF10 on chromosome 10. We assayed Hoxa5, Hoxa7, Hoxa9, Hoxa10, Hoxa11, Hoxa13, Hoxb4, Hoxd13, and Meis1 expression by real time RT‐PCR in leukemias from CALM‐AF10 mice to determine if the up‐regulation of these genes was seen in this mouse model as well as in the human leukemias. As shown in Fig. 5, Hoxa5, Hoxa7, Hoxa9, Hoxa10, and Meis1 were all up‐regulated in hematopoietic tissue (bone marrow, spleen, thymus) from clinically healthy CALM‐AF10 mice. Myeloid leukemias from CALM‐AF10 mice also showed up‐regulation of Hoxa5, Hoxa7, Hoxa9, Hoxa10, and Meis1, indicating that up‐regulation of these genes occurs in myeloid as well as T‐cell tumors associated with CALM‐AF10 expression. Hoxb4 was modestly decreased in clinically healthy transgenic bone marrow, as well as in one of four leukemia samples. Expression of Hoxa11, Hoxa13, and Hoxd13 was undetectable in all tissues and tumor samples after 35 cycles of amplification in contrast to the threshold of detection for the 18S ribosomal control at 18 cycles of amplification. In contrast to the up‐regulation of Hoxa cluster genes described above, conventional RT‐PCR demonstrated that Bmi1 was highly expressed in hematopoietic tissue and leukemias from both transgenic and non‐transgenic mice, but not up‐regulated (data not shown)
Figure 5. Hoxa cluster and Meis1 expression in CALM‐AF10 mice.
RNA transcript analysis by real time RT‐PCR of bone marrow (BM), spleen (Sp), and thymus (Th) from clinically healthy wild type (WT) and transgenic (TG) mice in addition to mice 7088, 7180, 7160, and 9014 (samples 1,2,3,4) with AML. Expression of Hoxa5, Hoxa7, Hoxa9, Hoxa10, Hoxa11, Hoxa13, Hoxb4, Hoxd13, and Meis1 was normalized to 18S rRNA expression and shown as mean fold change (log2) compared to WT BM‥
Discussion
To develop a mouse model for CALM‐AF10 leukemia, we generated transgenic mice that expressed the CALM‐AF10 fusion gene under control of vav regulatory elements. These mice developed acute leukemia, after an extended latent period (median 12 months), with an incomplete penetrance (40–50%). In addition, a substantial number of mice were found dead in their cages and were unable to be characterized as leukemic or non‐leukemic. If all of these mice were leukemic, then the penetrance of the disease would rise to 70–83 %, depending on the founder line, over the 18‐month study period.
The acute leukemias that developed in CALM‐AF10 transgenic mice were predominantly myeloid leukemias. Unexpectedly, half of these myeloid leukemias stained positive for B220. Although B220 is often regarded as a pan‐B cell marker, B220 expression has also been detected on NK, dendritic, and myeloid progenitors (19, 20). The Mac1+/B220+ leukemic cells were negative for more specific B‐cell markers, such as CD19 and IgM, but were positive for CD24 and heterogeneous for CD117 expression. We studied Igh gene rearrangements as an additional marker of B‐cell differentiation; over half of the mice analyzed had clonal Igh rearrangements. Interestingly, the B220 staining did not correlate well with clonal Igh rearrangements, for instance, mouse # 7160 was negative for B220 and had clonal Igh gene rearrangements, and mouse #9014 was positive for B220 and did not have clonal Igh gene rearrangements. In addition, two mice had a myelomonocytic leukemia, one of which stained weakly positive for CD3 and had both Tcrb and Tcrd rearrangements as well as an Igh rearrangement, and one mouse (#7160) had a myeloid leukemia with both Tcrb and Igh rearrangements.
Although CALM‐AF10 fusions have been identified in patients with myeloid, monocytic, and megakaryocytic leukemia (21–25), it was somewhat surprising that the mice in this study developed myeloid leukemia, since CALM‐AF10 leukemia in humans is primarily γ/δ pre‐T LBL. The observation that over half (8/15) of the leukemias assayed had clonal Tcr or Igh gene rearrangements, and over half (9/17) stained positively for B220 suggests that the transformed cell, at least in some cases, was derived from a progenitor capable of lymphoid as well as myeloid differentiation. This finding is consistent with reports that clonal TCRD and/or IGH gene rearrangements are often detected in patients with CALM‐AF10 fusion and myeloid leukemia (4, 26). Alternatively, the difference in leukemia phenotype may be due to use of the pan‐hematopoietic vav regulatory elements to direct CALM‐AF10 expression. In humans, it is possible that CALM‐AF10 translocations occurs only rarely in myeloid progenitors, and more commonly in lymphoid progenitors. However, in CALM‐AF10 mice, the vav transgene cassette directs expression to all hematopoietic cells (11, 27), including those in the myeloid compartment, allowing the CALM‐AF10 fusion an opportunity to exert its oncogenic potential in myeloid cells. Finally, it is possible that a cis effect present in CALM‐AF10 pre‐T LBL patients is missing in these transgenic mice, where the CALM‐AF10 construct has integrated randomly. Support for this hypothesis comes from the observation that although patients with CALM‐AF10 translocations upregulate BMI1, presumably through a cis effect as the AF10 gene is located near BMI1 on chromosome 10, the CALM‐AF10 mice did not up‐regulate Bmi1. In any case, the results reported here demonstrate that expression of a CALM‐AF10 fusion gene in myeloid cells predisposes these cells to leukemic transformation.
We studied healthy CALM‐AF10 mice to determine if we could identify signs of impending leukemic transformation, however, CBCs from CALM‐AF10 mice were not significantly different than those of their wild‐type littermates (Supplemental Table 1). We detected abnormalities of thymocyte differentiation, as half (4/8) of the CALM‐AF10 mice had reduced numbers of DP thymocytes and increased numbers of more immature DN thymocytes. This impaired differentiation was reinforced by the observation that the mouse with the most dramatic increase in DN cells had not rearranged Tcrb. Since most of the CALM‐AF10 mice developed myeloid leukemia, we reasoned that clinically healthy mice might have an increase in the proportion of Mac1+/Gr1+ cells in the bone marrow. However, although there was an increased proportion of Mac1+/Gr1+ cell in the bone marrow of the CALM‐AF10 mice compared to wild‐type controls, this difference did not reach statistical significance.
Several lines of evidence developed over the past several years have demonstrated the importance of HOX genes during leukemic transformation. First, multiple HOX genes have been identified as fusion partners with NUP98 in chromosomal translocations associated with acute leukemia (28). Second, gene expression profile studies have shown that up‐regulation of several HOX genes, especially HOXA7 and HOXA9, occurs in both acute lymphoid and myeloid leukemia (29–31). Third, Hox genes, again including Hoxa7 and Hoxa9, have been found to be up‐regulated by retroviral insertion in mice with retroviral‐induced myeloid leukemia (32). Finally, a number of investigators have reported that over‐expression of HOX genes or NUP98‐HOX fusion genes leads to acute myeloid malignancies in mice (31, 33–36). Of note, recent reports demonstrated over‐expression of HOXA5, HOXA9, and HOXA10 in pre‐T LBL patients who had CALM‐AF10 translocations (18, 29, 37). We show here that CALM‐AF10 expression leads to upregulation of Hoxa5, Hoxa9, and Hoxa10 in hematopoietic tissues from clinically healthy and leukemic CALM‐AF10 transgenic mice. In contrast to previous studies that used retroviral transduction and transplantation to over‐express HOXA9 or HOXA10 in mouse bone marrow, we did not detect evidence for myeloproliferation in CALM‐AF10 transgenic mice (38–42) This difference may be due to the relative levels of Hox gene expression, or to activation of multiple Hox genes by the CALM‐AF10 transgene, or to the technique employed to express CALM‐AF10 in hematopoietic cells (retroviral transduction and transplantation vs. transgenesis). Given the documented leukemogenicity caused by up‐regulation of HOX genes, particularly those of the abd‐b group (paralogs 9–13) (31), it seems likely that the CALM‐AF10 transgene exerts its leukemic effect, at least in part, through HOX gene activation.
While this manuscript was under review, Deshpande and colleagues reported the use of retroviral transduction and transplantation of primary bone marrow cells to show that expression of CALM‐AF10 in mouse bone marrow cells led to myeloid leukemia (26). They noted that the myeloid leukemia cells were invariably B220+, with clonal Igh gene rearrangements, whereas in our study, only half of the myeloid leukemias were B220+, and only half had clonal Igh gene rearrangements. Similar to our findings, they found that the Mac1+/B220+ cells lacked specific B‐cell markers such as CD19 and IgM. In contrast, the Mac1+/B220+ cells in their study lacked CD117 expression, whereas a variable (as high as 70%) percentage of Mac1+/B220+ leukemic cells from CALM‐AF10 transgenic mice expressed CD117. Intriguingly, they noted that transplantation of Mac1−/B220+ leukemic cells led to myeloid leukemia in recipient mice, and that the leukemic stem cell was likely to be a Mac1−/B220+ cell. In the current study, we noted two distinct populations of Mac1−/B220+ cells in some of the CALM‐AF10 leukemic mice (see Fig. 3). The “bright” Mac1−/B220+ population (Fig. 3A, box R4) likely reflected contaminating normal B‐cells, as these cells were positive for CD19 and IgM, and were only seen in leukemic spleen but not leukemic bone marrow, whereas the “dim” Mac1−/B220+ cells (Fig. 3A, box R5) were negative for CD19 and IgM, and may represent part of the leukemic clone, similar to the B220+ cells transplanted by Deshpande and colleagues (26). Given the absence of other B lineage markers on the “dim” B220 population, along with reports of B220 expression on progenitor cells (20, 21), it is important to consider the possibility that the “dim” B220 expression detected in these leukemic samples does not indicate B‐lineage commitment.
In this report, we have demonstrated that CALM‐AF10 expression is strongly leukemogenic. An emerging paradigm in leukemia biology predicts that most, if not all leukemic cells must undergo at least two collaborative events to produce a fully transformed cell. One of these events leads to impaired differentiation, and the second event results in increased proliferation and/or decreased apoptosis. The long latency period and incomplete penetrance of the leukemic phenotype supports the hypothesis that at least one additional event is required to fully transform these cells. The impaired differentiation that we observed in the thymus, along with previous reports that HOX gene overexpression is associated with impaired blood cell differentiation (31), is consistent with a model in which overexpression of the CALM‐AF10 gene impairs differentiation of hematopoietic cells. It seems likely that secondary, as yet undefined events which lead to increased proliferation and/or decreased apoptosis collaborate with the impaired differentiation caused by CALM‐AF10 expression and result in a completely transformed, leukemic cell.
Supplementary Material
Acknowledgements
We would like to thank Michael Kuehl (NCI) for the gift of the murine Igh probe, Jerry Adams (Walter and Eliza Hall Institute) for the gift of the vav plasmid, and Lionel Feigenbaum (NCI) for generation of the transgenic mice. We also thank Siba K. Samal, R. Mark Simpson, YingWei Lin, Chris Slape, and Helge Hartung for fruitful discussions and insight. This research was supported by the Intramural Research Program of the NIH, NCI.
References
- 1.Rowley JD. Chromosome translocations: dangerous liaisons revisited. Nat Rev Cancer. 2001;1(3):245–250. doi: 10.1038/35106108. [DOI] [PubMed] [Google Scholar]
- 2.Rabbitts TH. Chromosomal translocation master genes, mouse models and experimental therapeutics. Oncogene. 2001;20(40):5763–5777. doi: 10.1038/sj.onc.1204597. [DOI] [PubMed] [Google Scholar]
- 3.Lin YW, Aplan PD. Leukemic transformation. Cancer Biol Ther. 2004;3(1):13–20. doi: 10.4161/cbt.3.1.537. [DOI] [PubMed] [Google Scholar]
- 4.Asnafi V, Radford‐Weiss I, Dastugue N, et al. CALM‐AF10 is a common fusion transcript in T‐ALL and is specific to the TCRgammadelta lineage. Blood. 2003;102(3):1000–1006. doi: 10.1182/blood-2002-09-2913. [DOI] [PubMed] [Google Scholar]
- 5.Dreyling MH, Martinez‐Climent JA, Zheng M, Mao J, Rowley JD, Bohlander SK. The t(10;11)(p13;q14) in the U937 cell line results in the fusion of the AF10 gene and CALM, encoding a new member of the AP‐3 clathrin assembly protein family. Proc Natl Acad Sci U S A. 1996;93(10):4804–4809. doi: 10.1073/pnas.93.10.4804. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Tebar F, Bohlander SK, Sorkin A. Clathrin assembly lymphoid myeloid leukemia (CALM) protein: localization in endocytic‐coated pits, interactions with clathrin, and the impact of overexpression on clathrin‐mediated traffic. Mol Biol Cell. 1999;10(8):2687–2702. doi: 10.1091/mbc.10.8.2687. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Klebig ML, Wall MD, Potter MD, Rowe EL, Carpenter DA, Rinchik EM. Mutations in the clathrin‐assembly gene Picalm are responsible for the hematopoietic and iron metabolism abnormalities in fit1 mice. Proc Natl Acad Sci U S A. 2003;100(14):8360–8365. doi: 10.1073/pnas.1432634100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Chaplin T, Bernard O, Beverloo HB, et al. The t(10;11) translocation in acute myeloid leukemia (M5) consistently fuses the leucine zipper motif of AF10 onto the HRX gene. Blood. 1995;86(6):2073–2076. [PubMed] [Google Scholar]
- 9.DiMartino JF, Ayton PM, Chen EH, Naftzger CC, Young BD, Cleary ML. The AF10 leucine zipper is required for leukemic transformation of myeloid progenitors by MLL‐AF10. Blood. 2002;99(10):3780–3785. doi: 10.1182/blood.v99.10.3780. [DOI] [PubMed] [Google Scholar]
- 10.Bernardi R, Grisendi S, Pandolfi PP. Modelling haematopoietic malignancies in the mouse and therapeutical implications. Oncogene. 2002;21(21):3445–3458. doi: 10.1038/sj.onc.1205313. [DOI] [PubMed] [Google Scholar]
- 11.Adams JM, Harris AW, Strasser A, Ogilvy S, Cory S. Transgenic models of lymphoid neoplasia and development of a pan‐hematopoietic vector. Oncogene. 1999;18(38):5268–5277. doi: 10.1038/sj.onc.1202997. [DOI] [PubMed] [Google Scholar]
- 12.Aplan PD, Nakahara K, Orkin SH, Kirsch IR. The SCL gene product: a positive regulator of erythroid differentiation. EMBO J. 1992;11(11):4073–4081. doi: 10.1002/j.1460-2075.1992.tb05500.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Kogan SC, Ward JM, Anver MR, et al. Bethesda proposals for classification of nonlymphoid hematopoietic neoplasms in mice. Blood. 2002;100(1):238–245. doi: 10.1182/blood.v100.1.238. [DOI] [PubMed] [Google Scholar]
- 14.Morse HC, 3rd, Anver MR, Fredrickson TN, et al. Bethesda proposals for classification of lymphoid neoplasms in mice. Blood. 2002;100(1):246–258. doi: 10.1182/blood.v100.1.246. [DOI] [PubMed] [Google Scholar]
- 15.Aplan PD, Jones CA, Chervinsky DS, et al. An scl gene product lacking the transactivation domain induces bony abnormalities and cooperates with LMO1 to generate T‐cell malignancies in transgenic mice. EMBO J. 1997;16(9):2408–2419. doi: 10.1093/emboj/16.9.2408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Begley CG, Aplan PD, Davey MP, et al. Chromosomal translocation in a human leukemic stem‐cell line disrupts the T‐cell antigen receptor delta‐chain diversity region and results in a previously unreported fusion transcript. Proc Natl Acad Sci USA. 1989;86(6):2031–2035. doi: 10.1073/pnas.86.6.2031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lang RB, Stanton LW, Marcu KB. On immunoglobulin heavy chain gene switching: two gamma 2b genes are rearranged via switch sequences in MPC‐11 cells but only one is expressed. Nucleic Acids Res. 1982;10(2):611–630. doi: 10.1093/nar/10.2.611. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Dik WA, Brahim W, Braun C, et al. CALM‐AF10+ T‐ALL expression profiles are characterized by overexpression of HOXA and BMI1 oncogenes. Leukemia. 2005;19(11):1948–1957. doi: 10.1038/sj.leu.2403891. [DOI] [PubMed] [Google Scholar]
- 19.Rolink A, ten Boekel E, Melchers F, Fearon DT, Krop I, Andersson J. A subpopulation of B220+ cells in murine bone marrow does not express CD19 and contains natural killer cell progenitors. J Exp Med. 1996;183(1):187–194. doi: 10.1084/jem.183.1.187. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Balciunaite G, Ceredig R, Massa S, Rolink AG. A B220+ CD117+ CD19− hematopoietic progenitor with potent lymphoid and myeloid developmental potential. European journal of immunology. 2005;35(7):2019–2030. doi: 10.1002/eji.200526318. [DOI] [PubMed] [Google Scholar]
- 21.Bohlander SK, Muschinsky V, Schrader K, et al. Molecular analysis of the CALM/AF10 fusion: identical rearrangements in acute myeloid leukemia, acute lymphoblastic leukemia and malignant lymphoma patients. Leukemia. 2000;14(1):93–99. doi: 10.1038/sj.leu.2401614. [DOI] [PubMed] [Google Scholar]
- 22.Dreyling MH, Schrader K, Fonatsch C, et al. MLL and CALM are fused to AF10 in morphologically distinct subsets of acute leukemia with translocation t(10;11): both rearrangements are associated with a poor prognosis. Blood. 1998;91(12):4662–4667. [PubMed] [Google Scholar]
- 23.Kumon K, Kobayashi H, Maseki N, et al. Mixed‐lineage leukemia with t(10;11)(p13;q21): an analysis of AF10‐CALM and CALM‐AF10 fusion mRNAs and clinical features. Genes Chromosomes Cancer. 1999;25(1):33–39. doi: 10.1002/(sici)1098-2264(199905)25:1<33::aid-gcc5>3.0.co;2-3. [DOI] [PubMed] [Google Scholar]
- 24.Carlson KM, Vignon C, Bohlander S, Martinez‐Climent JA, Le Beau MM, Rowley JD. Identification and molecular characterization of CALM/AF10fusion products in T cell acute lymphoblastic leukemia and acute myeloid leukemia. Leukemia. 2000;14(1):100–104. doi: 10.1038/sj.leu.2401629. [DOI] [PubMed] [Google Scholar]
- 25.Jones LK, Chaplin T, Shankar A, et al. Identification and molecular characterisation of a CALM‐AF10 fusion in acute megakaryoblastic leukaemia. Leukemia. 2001;15(6):910–914. doi: 10.1038/sj.leu.2402140. [DOI] [PubMed] [Google Scholar]
- 26.Deshpande AJ, Cusan M, Rawat VP, et al. Acute myeloid leukemia is propagated by a leukemic stem cell with lymphoid characteristics in a mouse model of CALM/AF10‐positive leukemia. Cancer Cell. 2006;10(5):363–374. doi: 10.1016/j.ccr.2006.08.023. [DOI] [PubMed] [Google Scholar]
- 27.Ogilvy S, Metcalf D, Gibson L, Bath ML, Harris AW, Adams JM. Promoter elements of vav drive transgene expression in vivo throughout the hematopoietic compartment. Blood. 1999;94(6):1855–1863. [PubMed] [Google Scholar]
- 28.Slape C, Aplan PD. The role of NUP98 gene fusions in hematologic malignancy. Leuk Lymphoma. 2004;45(7):1341–1350. doi: 10.1080/10428190310001659325. [DOI] [PubMed] [Google Scholar]
- 29.Soulier J, Clappier E, Cayuela JM, et al. HOXA genes are included in genetic and biologic networks defining human acute T‐cell leukemia (T‐ALL) Blood. 2005;106(1):274–286. doi: 10.1182/blood-2004-10-3900. [DOI] [PubMed] [Google Scholar]
- 30.Golub TR, Slonim DK, Tamayo P, et al. Molecular classification of cancer: class discovery and class prediction by gene expression monitoring. Science. 1999;286(5439):531–537. doi: 10.1126/science.286.5439.531. [DOI] [PubMed] [Google Scholar]
- 31.Abramovich C, Humphries RK. Hox regulation of normal and leukemic hematopoietic stem cells. Curr Opin Hematol. 2005;12(3):210–216. doi: 10.1097/01.moh.0000160737.52349.aa. [DOI] [PubMed] [Google Scholar]
- 32.Nakamura T, Largaespada DA, Shaughnessy JD, Jr., Jenkins NA, Copeland NG. Cooperative activation of Hoxa and Pbx1‐related genes in murine myeloid leukaemias. Nat Genet. 1996;12(2):149–153. doi: 10.1038/ng0296-149. [DOI] [PubMed] [Google Scholar]
- 33.Lin YW, Slape C, Zhang Z, Aplan PD. NUP98‐HOXD13 transgenic mice develop a highly penetrant, severe myelodysplastic syndrome that progresses to acute leukemia. Blood. 2005;106(1):287–295. doi: 10.1182/blood-2004-12-4794. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Pineault N, Abramovich C, Ohta H, Humphries RK. Differential and common leukemogenic potentials of multiple NUP98‐Hox fusion proteins alone or with Meis1. Mol Cell Biol. 2004;24(5):1907–1917. doi: 10.1128/MCB.24.5.1907-1917.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Pineault N, Buske C, Feuring‐Buske M, et al. Induction of acute myeloid leukemia in mice by the human leukemia‐specific fusion gene NUP98‐HOXD13 in concert with Meis1. Blood. 2003;101(11):4529–4538. doi: 10.1182/blood-2002-08-2484. [DOI] [PubMed] [Google Scholar]
- 36.Kroon E, Thorsteinsdottir U, Mayotte N, Nakamura T, Sauvageau G. NUP98‐HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice. EMBO J. 2001;20(3):350–361. doi: 10.1093/emboj/20.3.350. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Bergeron J, Clappier E, Cauwelier B, et al. HOXA cluster deregulation in T‐ALL associated with both a TCRD‐HOXA and a CALM‐AF10 chromosomal translocation. Leukemia. 2006;20(6):1184–1187. doi: 10.1038/sj.leu.2404187. [DOI] [PubMed] [Google Scholar]
- 38.Thorsteinsdottir U, Kroon E, Jerome L, Blasi F, Sauvageau G. Defining roles for HOX and MEIS1 genes in induction of acute myeloid leukemia. Mol Cell Biol. 2001;21(1):224–234. doi: 10.1128/MCB.21.1.224-234.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Kroon E, Krosl J, Thorsteinsdottir U, Baban S, Buchberg AM, Sauvageau G. Hoxa9 transforms primary bone marrow cells through specific collaboration with Meis1a but not Pbx1b. EMBO J. 1998;17(13):3714–3725. doi: 10.1093/emboj/17.13.3714. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Thorsteinsdottir U, Sauvageau G, Hough MR, et al. Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia. Mol Cell Biol. 1997;17(1):495–505. doi: 10.1128/mcb.17.1.495. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Calvo KR, Sykes DB, Pasillas M, Kamps MP. Hoxa9 immortalizes a granulocyte‐macrophage colony‐stimulating factor‐dependent promyelocyte capable of biphenotypic differentiation to neutrophils or macrophages, independent of enforced meis expression. Mol Cell Biol. 2000;20(9):3274–3285. doi: 10.1128/mcb.20.9.3274-3285.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Buske C, Feuring‐Buske M, Antonchuk J, et al. Overexpression of HOXA10 perturbs human lymphomyelopoiesis in vitro and in vivo. Blood. 2001;97(8):2286–2292. doi: 10.1182/blood.v97.8.2286. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.