Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2008 Jul 15.
Published in final edited form as: Gene. 2007 Apr 18;396(2):338–345. doi: 10.1016/j.gene.2007.04.008

Development of a set of plasmid vectors for genetic manipulations of the pathogenic yeast Candida parapsilosis

Peter Kosa 1,*, Barbora Gavenciakova 1, Jozef Nosek 1
PMCID: PMC1994580  NIHMSID: NIHMS26675  PMID: 17512139

Abstract

A system for genetic transformation of the yeast Candida parapsilosis, recently developed in our laboratory, opened a venue for investigation of this pathogenic species at the molecular level. In this study we extend the range of available experimental tools by construction of a genomic DNA library suitable for screening and isolation of genes by functional complementation of yeast mutants and a set of replicative plasmid vectors for genetic manipulation of C. parapsilosis cells. The plasmids are based on auxotrophic (CpGAL1, CpURA3, CpMET2, CpLYS4) and dominant (CaIMH3) selection markers. In addition, we constructed plasmid derivatives containing reporter genes yEGFP3 and KlLAC4 coding for enhanced version of the green fluorescent protein and Kluyveromyces lactis β-galactosidase, respectively. The vectors facilitate propagation and expression of cloned genes in C. parapsilosis cells and allow intracellular localization of gene products and/or monitoring the activity of promoter sequences.

Keywords: yeast plasmids, genetic transformation, selection and reporter markers

1. Introduction

Candidiases are important fungal diseases in humans and warm-blooded animals caused by yeasts from the genus Candida. Although Candida albicans predominates in these mycoses, recent studies revealed an increased incidence of non-C. albicans species (Cassone et al., 1995; Fridkin et al., 2006). Of them, the yeast C. parapsilosis, although considered as a harmless commensal organism in healthy individuals, represents important nosocomial pathogen attacking newborns and immunocompromised patients and causes severe cases of septic arthritis, peritonitis, vaginitis, endocarditis, endophtalmitis, nail and skin infections (Cassone et al., 1995; Huang et al., 2000; Alonso-Valle et al., 2003).

This species displays many interesting biological features. Its selective adherence to prosthetic materials and formation of biofilms on plastic surfaces (Branchini et al., 1994; Pfaller, 1995), resistance to drugs and inhibitors (Camougrand et al., 1986), secretion of extracellular proteases (Fusek et al., 1993; Pichova et al., 2001; Merkerova et al., 2006), phenotype switching (Lott et al., 1993; Laffey and Butler, 2005; Kim et al., 2006), colonization of human hands (Bonassoli et al., 2005) and proliferation in high concentration of glucose and lipids (Branchini et al., 1994) are presumed to be directly related to its virulence.

One of the most remarkable biological features of this species is the presence of a linear DNA genome terminating with specific telomeric structures in its mitochondria (Kovac et al., 1984; Nosek et al., 2004). This linear genome represents a unique model system for investigation of telomerase-independent mode of telomere maintenance (Nosek et al., 1995; Tomaska et al., 2000; Nosek et al., 2005). Moreover, the mitochondrial telomeres have a potential in the molecular diagnostics of this opportunist pathogen (Nosek et al., 2002b; Rycovska et al., 2004).

The ongoing sequencing project of the C. parapsilosis nuclear genome (http://www.sanger.ac.uk/sequencing/Candida/parapsilosis) provides an essential platform for further functional studies which are essential for understanding the biology of this pathogenic yeast species at the molecular level. However, the genetic analysis of C. parapsilosis is complicated due to diploid/aneuploid state of its genome (Doi et al., 1992; Fundyga et al., 2004) as well as the lack of sexual cycle (Logue et al., 2005). To overcome this problem, a set of auxotrophic host strains was isolated and the first system and optimized protocols for genetic transformation were developed in our laboratory (Nosek et al., 2002a; Zemanova et al., 2004). The system utilized the complementation of a galactokinase-deficient mutant of C. parapsilosis by the CpGAL1 gene. Recently, a protocol based on the selection of transformed cells using an integrative plasmid with a dominant selection marker CaIMH3 encoding resistance to mycophenolic acid (MPA) was described (Gacser et al., 2005).

To extend the range of available tools for genetic manipulation of C. parapsilosis cells we isolated two selection markers CpMET2 and CpLYS4 by functional complementation of corresponding mutations in auxotrophic strains. We used both genes, together with previously described markers CpURA3, CpGAL1, and CaIMH3, for construction of a set of plasmid vectors facilitating gene cloning and expression. In addition, we prepared vector derivatives allowing intracellular localization of the products of cloned genes and/or the monitoring of promoter activity.

The availability of vectors for efficient genetic manipulation of C. parapsilosis cells is particularly important as, similarly to other Candida species, this yeast employs a modified version of the genetic code which hampers the analysis of its genes in heterologous systems such as S. cerevisiae or K. lactis.

2. Material and Methods

2.1 Strains and media

The C. parapsilosis type strain CBS604 was kindly provided by Hiroshi Fukuhara (Institute Curie, Orsay, France). Auxotrophic strains C. parapsilosis SR23 gal1-7 (ade, lys4, gal1) and SR23 met-1 (ade, lys4, met2) were prepared in our laboratory (Nosek et al., 2002a). The S. cerevisiae L5366 (MATa/MATα ura3/ura3) strain was kindly provided by Cora A. Styles (Whitehead Institute for Biomedical Research, Cambridge, USA). Escherichia coli DH5α strain (Clontech) was used for cloning experiments. Yeast cells were cultivated at 28°C in YPD medium [1% yeast extract (Difco), 1% peptone (Difco), 2% glucose] or SD medium [0.67% Yeast nitrogen base w/o amino acids (Difco), 2% glucose] supplemented with appropriate amino acids or nitrogen bases. The carbon source in SGly and SGal/YPGal media was 3% glycerol and 2% galactose, respectively. Solid media were supplemented with 2% agar (Difco).

2.2 Preparation of the C. parapsilosis genomic DNA library

Genomic DNA of the strain CBS604 was isolated using a protocol described for S. cerevisiae (Phillippsen et al., 1991). Total DNA was partially digested with the restriction endonuclease Sau3AI and DNA fragments (2 – 15 kb) were cloned into the BamHI site of the shuttle vector YEplac195 (Gietz and Sugino, 1988). The library contains approximately 86,000 independent E. coli clones and its analysis revealed 75% recombinant plasmids containing inserts with an average size of about 3 kb. As the size of C. parapsilosis diploid genome has been estimated to approximately 26 Mb (Doi et al., 1992) the library covers the genome with a probability above 99.9%. The library can be propagated in E. coli and S. cerevisiae cells. Moreover, we observed that plasmid vector YEplac195 replicates in C. parapsilosis. Therefore, the library can be employed for screening and isolation of genes by functional complementation of mutations in both yeast species.

2.3 Yeast transformation

The transformation of S. cerevisiae cells was performed essentially as described by Gietz and Schiestl (1995). C. parapsilosis cells were transformed using an optimized electroporation protocol developed in our laboratory (Zemanova et al., 2004). Transformants were selected in SD medium supplemented with appropriate amino acids and nitrogen bases at 28°C for 2-4 days. In the case of selection in media containing MPA, the electric pulse was followed by incubation of the cell suspension for additional 6 hours in YPGS (1% peptone, 1% yeast extract, 3% glycerol, and 1 M sorbitol) medium and transformants were selected on YPGal medium supplemented with 150 μg/ml MPA for 4-5 days at 28°C.

2.4 Isolation of CpMET2 and CpLYS4 genes by functional complementation

C. parapsilosis SR23-met1 cells were transformed with approximately 1 μg of the genomic library (see section 2.2) and selected on SD medium lacking either methionine or lysine at 28°C for 5 days. Plasmid DNAs isolated from transformants were amplified in E. coli and retransformed into C. parapsilosis SR23 met-1 to confirm the phenotype. Subsequent DNA sequence analysis of inserts from two isolated plasmids, pBP-M and pBP-L, revealed the presence of CpMET2 and CpLYS4 gene, respectively.

2.5 Construction of the plasmid vectors

Source plasmids pUC19-CpGAL1B-ARS7, pUC19-CpGAL1B, pUC19-CpURA3, and YEplac181-CpGAL1 were described previously (Nosek et al., 2002a). The vector pPK1 was constructed as follows. First, the 503 bp AccI-ClaI fragment containing the CpARS7 sequence was excised from the pUC19-CpGAL1B-ARS7 plasmid and treated with DNA polymerase I (Klenow) to generate blunt ends. Next, the fragment was inserted into the plasmid pUC19-CpGAL1B which was linearized with the BsmBI and treated with Klenow enzyme. The plasmid pPK2 was prepared analogously except that pUC19-CpURA3 was used as the recipient vector. The plasmid pPK1 was used for construction of two derivatives, pBP1 and pBP2.

pBP1 was prepared by insertion of 2726 bp PmlI-BglII fragment of the clone pBG-M carrying the CpMET2 gene into corresponding sites of pPK1. pBP2 was constructed from the 2974 bp XbaI-BamHI fragment of the pBG-L clone containing the CpLYS4 gene and pPK1 digested with PmlI and BglII endonucleases; both fragments were treated with Klenow enzyme prior the ligation reaction.

The vectors pPK2, pBP1 and pBP2 were subsequently used to design expression vectors containing the promoter of CpGAL1 gene (pBP3, pBP3T, pBP5, pBP5T, pBP7) and/or the reporter markers, KlLAC4 (pPK3, pPK3-PCpGAL1, pPK4, pPK4-PCpGAL1) and yEGFP3 (pBP4, pBP6, pBP8, pPK5).

The CpGAL1 promoter (PCpGAL1) was amplified from the plasmid YEplac181-CpGAL1 using the primers 5’-CGGGATCCCCATGGTAATAATTTCAAC-3’ and 5’-ATTTCACACAGGAAACAGCTATGAC-3’, digested with BamHI and inserted into the unique BamHI site of YEp354 (Myers et al., 1986). Resulting plasmid YEp354-PCpGAL1 contains lacZ driven by PCpGAL1. Subsequently, the 576 bp BamHI fragment of YEp354-PCpGAL1 was inserted into corresponding site of pBP1, pBP2, and pPK2 and resulting constructs were named pBP3, pBP5, and pBP7, respectively. In addition, the 801 bp PvuII-XbaI fragment from pPK1 containing presumed terminator sequence of the CpGAL1 gene (TCpGAL1) was treated with Klenow enzyme and cloned into PstI linearized and blunt-ended plasmid molecules pBP3 and pBP5. These constructs were named pBP3T and pBP5T, respectively.

The reporter gene coding for K. lactis β-galactosidase was amplified from pKR1B-LAC4-1 (Sreekrishna and Dickson, 1985) using the primers 5’CCCGGGTCTTGCCTTATTCCTGAGAATTTA3’ and 5’ACTCTAGAATCGTTAATCAGCGGTGGTTA3’, and digested with XbaI. The fragment was then inserted into the recipient vectors pBP3 and pBP5 which were linearized with NcoI, blunt-ended with Klenow enzyme, and digested with XbaI. The constructs were named pPK3-PCpGAL1, and pPK4-PCpGAL1. Subsequent deletion of the 580 bp SmaI fragment from both plasmids resulted in two vectors named pPK3 and pPK4, respectively.

The plasmids pBP4 and pBP6 were prepared as follows. The vector pUG35 (kindly provided by J. H. Hegemann, Düsseldorf, Germany) was linearized with KpnI, treated with Klenow enzyme, and digested with SalI. The 986 bp fragment containing the yEGFP3 reading frame and the terminator of S. cerevisiae CYC1 gene (TScCYC1) was then ligated into the recipient vector molecules pBP3 and pBP5 which were linearized with PstI, treated with Klenow enzyme and digested with SalI. Elimination of the 536 bp BamHI fragment containing the PCpGAL1 sequence from pBP6 resulted in the construct named pBP6ΔP.

To prepare the plasmid pBP8, the vector pPK2 was digested with XbaI and EcoRI, and the 1435 bp insert containing promoter of the S. cerevisiae MET25 gene (PScMET25), yEGFP3, and the TScCYC1 sequence was cleaved from pUG35 by KpnI and SacI. Termini of both DNA fragments were treated with Klenow enzyme and joined by T4 DNA ligase.

The vector pPK6 was constructed in two steps. First, the 536 bp BamHI DNA fragment was removed from pBP5T and the resulting plasmid was digested with KpnI and SacI. Next, the PCpGAL1 promoter and the yEGFP3 coding sequence were amplified from the pBP6 template using the primers 5’CAGAGCTCGATCCATTAAGTTTATTTTTTTTTCA3’ and 5’CAGGTACCACCAGTAATTTGTACAATTCATCCA3’, digested with KpnI and SacI, and inserted in corresponding sites of the vector.

In addition to vectors based on auxotrophic markers, the plasmid pPK5 carrying dominant selection marker CaIMH3 coding for resistance to MPA and yEGFP3 gene was prepared. First, the 2710 bp EcoRI-BamHI fragment from pSFI1 (kindly provided by J. Morschhäuser, Würzburg, Germany) was inserted into corresponding sites of pBP6. Subsequently, the 576 bp BamHI fragment containing PCpGAL1 (see above) was cloned into the BamHI site.

2.6 Miscellaneous

Radioactive DNA labeling, Southern blot hybridization, DNA manipulation and cloning procedures were performed essentially as described by Sambrook et al. (1989). The CpMET2 probe was amplified from the pBP1 template using the primers 5’GCAAAGGAGACGACGA3’ and 5’AAACTACGCTCTACACGA3’. The CpLYS4 probe was amplified from the pBP2 template using the primers 5’AGTGATGAGGATGCCAA3’ and 5’TTATCGGCATTACACAAGA 3’. The DNA sequences were determined using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems). The DNA sequences reported in this work were deposited in the EMBL/GenBank data library under following accession numbers: X99635 (CpURA3), Y14704 (CpGAL1), DQ359727 (CpMET2), DQ359726 (CpLYS4), and AY074814 (CpARS7). The vectors and their sequences are available upon request from authors.

3. Results and Discussion

3.1 Isolation of auxotrophic selection markers CpMET2 and CpLYS4

With the aim to isolate selection markers suitable for construction of plasmid vectors we complemented two auxotrophic mutations met- and lys- in the strain C. parapsilosis SR23-met1 using the genomic library prepared from the strain CBS604 (see section 2.2). This approach led to isolation of two plasmid clones pBG-M and pBG-L. Subsequent DNA sequence analysis of the 3270 bp insert of the pBG-M plasmid complementing met- mutation led to identification of an open reading frame (ORF) with a significant degree of sequence homology to MET2 genes of diverse organisms. The sequence of deduced protein product with the length 461 amino acids displays 64.4 % and 55.5 % identity to L-homoserine-O-acetyltransferase of C. albicans and S. cerevisiae, respectively. The analysis of the 5608 bp insert of the pBG-L plasmid complementing lys- mutation revealed a homologue of the S. cerevisiae LYS4 gene. The deduced protein consisting of 688 amino acids residues has 80.4 % and 70.6 % identity to homo-aconitase of C. albicans and S. cerevisiae, respectively. Next, the genes CpMET2 and CpLYS4, together with CpURA3 and CpGAL1, previously isolated in our laboratory (Nosek et al., 2002a), were used as auxotrophic markers in a set of cloning and expression vectors for C. parapsilosis.

3.2 Cloning vectors

We constructed a set of four cloning vectors pBP1, pBP2, pPK1, and pPK2, suitable for C. parapsilosis (Figure 1A). These plasmids are based on the E. coli vector pUC19 which possesses ColE1 origin of replication in bacteria and β-lactamase gene conferring the resistance to ampicilin. In addition, they contain auxotrophic selection markers CpGAL1, CpURA3, CpMET2 or CpLYS4, and the autonomous replicating sequence CpARS7 (Nosek et al., 2002a) ensuring their propagation and selection in appropriate auxotrophic mutants of C. parapsilosis. The CpARS7 element permits the plasmid replication in multiple copies within C. parapsilosis cells and ensures the high efficiency of transformation. The vectors allow cloning of DNA fragments into several unique sites for restriction endonucleases originally present within the polylinker of pUC19 (e.g., SacI, KpnI, SmaI, XmaI, BamHI, XbaI, SalI, PstI, SphI). The mitotic stability of the plasmids in the yeast cells was determined after the growth of transformants for 10 generations in a non-selective medium (YPD). The results of three independent experiments show that 31.8% (±4.4), 22.5% (±1.6), and 36.6% (±2.9) of cells retain the plasmid pBP1, pBP2, and pPK1, respectively. This indicates that the replicative plasmids can be easily eliminated from host cells by cultivation in non-selective media. In the case of pBP1 and pBP2, the number of plasmid copies per cell was estimated using Southern blot hybridization analysis (Figure 2) of total DNA prepared from three independent transformants grown overnight in liquid selective media and probed with corresponding marker (i.e., CpMET2 or CpLYS4). Our results indicate that pBP1 and pBP2 are present in 17±2 and 13±2 copies per cell, respectively.

Figure 1.

Figure 1

Open in a new tab

A set of cloning (A) and expression vectors (B, C, D, E) developed for C. parapsilosis. (A) The cloning vectors pBP1, pBP2, pPK1, and pPK2 contain CpMET2, CpLYS4, CpGAL1 and CpURA3, respectively, as auxotrophic selection markers. All four vectors possess multiple cloning sites (MCS) localized within E. coli lacZ’ gene. (B) The expression vectors pBP3, pBP5, and pBP7 contain CpMET2, CpLYS4, and CpURA3 selection marker, respectively. The expression of cloned genes is driven by PCpGAL1. In addition, plasmids pBP3T and pBP5T derived from pBP3 and pBP5, respectively, contain the TCpGAL1 sequence. (C) The plasmids pBP4, pBP6, pBP8, and pPK5 designed for intracellular localization of protein products are based on CpMET2, CpLYS4, CpURA3, and CaIMH3 selection marker, respectively. The expression of proteins C-terminally tagged with yEGFP3 is driven either by PCpGAL1 (pBP4, pBP6, pPK5) or PScMET25 (pBP8) promoters. (D) The vector pPK6 contains CpLYS4 as a selection marker and is suitable for intracellular localization of proteins N-terminally tagged with yEGFP3. The gene expression of fusion proteins is driven by the PCpGAL1 promoter. (E) The vectors pPK3 and pPK4 suitable for monitoring the activity of gene promoters contain CpMET2 and CpLYS4 selection markers, respectively. Promoter sequences can be inserted into unique SmaI site.

Figure 2.

Figure 2

Open in a new tab

Southern blot hybridization analysis of transformants harboring pBP1 (A) and pBP2 (B) plasmids. Cells of C. parapsilosis SR23-met1 were transformed with the plasmids and selected in appropriate medium. In both cases, total DNA was prepared from three individual transformants, digested with the restriction endonuclease EcoRI, electrophoretically separated in 0.7 % agarose gel, blotted onto a Nylon membrane and hybridized with radioactively labeled probes derived from the genes CpMET2 (A) and CpLYS4 (B). Note that the faint upper bands (9.5 and 10.1 kb) correspond to the gene copies in presumably diploid nuclear genome.

3.3 Vectors for gene expression

In our previous study (Nosek et al., 2002a) we isolated and characterized the PCpGAL1 sequence which was shown to control the expression of galactokinase by the presence/absence of appropriate carbon source (e.g., galactose, glucose, glycerol) in the cultivation media. Based on these results, we constructed three plasmid vectors, pBP3, pBP5, and pBP7, containing the CpMET2, CpLYS4, and CpURA3 marker, respectively, and the PCpGAL1 sequence (Figure 1B). Moreover, we prepared two vector derivatives, pBP3T and pBP5T, containing both the PCpGAL1 and the TCpGAL1 sequences (Figure 1B). These plasmids are suitable for the expression of homologous or heterologous genes in C. parapsilosis cells and permit an easy control of the gene expression by switching between repressed (glucose), non-repressed (glycerol) and induced conditions (galactose) by changing the carbon source in the cultivation medium. The vectors can be also used in genetic approaches such as screening for lethal genes by induction of gene expression (e.g. Espinet et al., 1995).

3.4 Vectors for intracellular localization of protein products

Based on the pBP3, pBP5, and pPK2 vectors, we constructed three derivatives pBP4, pBP6 and pBP8 (Figure 1C), respectively, containing the marker yEGFP3 coding for yeast enhanced version of green fluorescent protein 3 that was shown to function in the closely related species C. albicans and C. dubliniensis (Cormack et al., 1997; Staib et al., 2000). In the plasmids pBP4 and pBP6, the yEGFP3 expression is driven by PCpGAL1, while in pBP8 its expression is under the control of PScMET25. To overcome the requirement for auxotrophic strains and synthetic media in experiments, the IMH3 gene from C. albicans has been successfully employed as a dominant selection marker conferring the resistance to MPA in diverse Candida species (Staib et al., 2000; Du et al., 2004; Gacser et al., 2005). In this study we constructed the replicative plasmid pPK5 containing the CaIMH3 gene (Figure 1C) which allows selection of transformants in complex media, such as YPD, supplemented with 150 μg/ml MPA, and the PCpGAL1 promoter driven yEGFP3 marker for intracellular localization of C-terminally tagged fusion proteins. In addition, we constructed the vector pPK6 (Figure 1D). This plasmid contains CpLYS4 as a selecion marker and the yEGFP3 coding sequence driven by PCpGAL1 promoter as a reporter. The unique SmaI site in pPK6 allows construction of fusion proteins N-terminally tagged with yEGFP3. To test these vectors we transformed them into appropriate C. parapsilosis strain. The transformants were then observed by fluorescence microscopy (Figure 3). In the case of plasmids pBP4, pBP6, pPK5, and pPK6, the transformants exhibit fluorescence within the cytoplasm. To illustrate targeting of yEGFP3 into a specified cellular compartment, we amplified ORF of the C. parapsilosis MTP1 gene coding for mitochondrial telomere-binding protein (mtTBP) (Nosek et al., 1999) from the genomic DNA of the strain CBS604 using the primers 5’GACTCTAGATTCTGTAGCTTCGGCTCTATCCTCA3’ and 5’GACTCTAGAATGTTGCGAGCATTCACTAGATCA3’. The PCR product was then digested with XbaI and cloned in-frame with the yEFGP3 sequence of the pBP6 vector. Resulting plasmid pBP6-mtTBP was subsequently transformed into C. parapsilosis cells. As expected from our previous study with a mtTBP-GFP construct in S. cerevisiae (Nosek et al., 1999), the mtTBP-yEGFP3 fusion protein localizes into multiple foci corresponding to mitochondrial nucleoids. As the ura3 mutant of C. parapsilosis is not yet available, the vector pBP8 was tested in S. cerevisiae cells with the same cytoplasmic fluorescence of the expressed marker as observed in the case of other vectors in C. parapsilosis.

Figure 3.

Figure 3

Open in a new tab

Fluorescence microscopy of yeast cells transformed with plasmids expressing yEGFP3 alone or in the fusion with mtTBP. A, B, C, D, and E are C. parapsilosis cells transformed with pBP4, pPK5, pBP6, pPK6 and pBP6-mtTBP, respectively. F and H show fluorescence of C. parapsilosis cells transformed with pBP6ΔP lacking PCpGAL1 promoter grown in the presence of glucose (F) and galactose (G). H shows S. cerevisiae expressing yEGFP3 from pBP8. The bar represents 5 μm.

3.5 Vectors for monitoring the activity of gene promoters

β-galactosidase represents another reporter marker which activity can be detected by several methods: quantitative liquid assays using permeabilized cells, colorimetric assays of colonies replicated to paper filters, and in situ coloration of colonies growing on medium containing the indicator X-Gal (Guthrie and Fink, 2002). However, β-galactosidase encoded by the E. coli lacZ gene routinely used in many species (El Barkani et al., 2000; Juretzek et al., 2001), cannot be employed in the case of C. parapsilosis as it contains 51 ‘CTG’ codons that are translated as serine instead of leucine (Ohama et al., 1993). In contrast, the genes coding for β-galactosidase from Streptococcus thermophilus and K. lactis (KlLAC4) with only one and two ‘CTG’ codons, respectively, were successfully tested as reporters in C. albicans and C. tropicalis (Leuker et al., 1992; Uhl and Johnson, 2001). Therefore, we constructed two plasmids (pPK3 and pPK4) containing the KlLAC4 gene (Figure 1E) which can be utilized for investigation of various aspects of gene regulation in a range of cellular processes of C. parapsilosis. Both vectors lack the translation initiation codon ‘ATG’ of KlLAC4 which has been replaced by the site for SmaI endonuclease permitting cloning of blunt-ended PCR-amplified promoters terminating with ‘ATG’ codon. To test pPK3 and pPK4 we cloned the PCpGAL1 sequence into both vectors. Resulting constructs named pPK3-PCpGAL1 and pPK4-PCpGAL1 were transformed into C. parapsilosis. Subsequently, the transformants were assayed for β-galactosidase activity. The colonies grown in media (SGal) where the expression of the KlLAC4 marker is induced by galactose were blue. In contrast, the transformants cultivated in the repressed (SD) and non-repressed (SGly) conditions remained white, although light blue coloration developed in both cases after prolonged time of incubation. Next, we performed quantitative β-galactosidase assays. Our results clearly indicate that in both cases galactose induces, while glucose effectively represses, PCpGAL1 driven expression of the KlLAC4 marker (Figure 4). We observed about 5-fold difference in β-galactosidase activities between cells transformed with pPK3-PCpGAL1 and pPK4-PCpGAL1 grown on galactose (Figure 4). Although this might result from a difference in plasmid copy number, the estimated number of copies of the parental vectors (pBP1 and pBP2) did not differ significantly (17±2 vs. 13±2).

Figure 4.

Figure 4

Open in a new tab

C. parapsilosis expressing K. lactis β-galactosidase under the control of the PCpGAL1 promoter. C. parapsilosis SR23-met1 cells were transformed with pPK3-PCpGAL1 (A) and pPK4-PCpGAL1 (B). Transformants were grown in liquid selection media containing 2 % glucose (glu), 2 % galactose (gal), and 3 % glycerol (gly) as the sole carbon source, and the activity of β-galactosidase was measured essentially as described by Rose and Botstein (1983). The results are based on three independent replicates of the experiment. In a control experiment, lysates from cells transformed with the plasmid pPK3 lacking the PCpGAL1 promoter exhibited 6.7, 15.4, and 10.0 Miller units of β-galactosidase in media containing 2 % glucose, 2 % galactose, and 3 % glycerol, respectively. In the case of pPK4, the activities were 5.3, 8.1, and 6.3 Miller units.

3.6 Conclusion

In this report, we constructed a collection of replicative shuttle vectors suitable for molecular genetic studies of C. parapsilosis and functional analysis of its genes (Table 1). Our vectors allow expression of the cloned genes, intracellular localization of protein products or monitoring of a promoter activity. These plasmids are based on auxotrophic or dominant selection markers facilitating their propagation either in the auxotrophic host strains or wild type strains of C. parapsilosis such as clinical isolates. These vectors open new experimental opportunities and may significantly contribute to investigations of diverse biological phenomena related to C. parapsilosis.

Table 1.

Vectors for genetic manipulation of C. parapsilosis

Cloning vectors
Plasmid Plasmid size (bp) Selection marker Autonomously replicating sequence (ARS) Reference
pPK1 6177 CpGAL1 C. parapsilosis ARS7 This study
pPK2 5027 CpURA3 C. parapsilosis ARS7 This study
pBP1 6652 CpMET2 C. parapsilosis ARS7 This study
pBP2 6900 CpLYS4 C. parapsilosis ARS7 This study
YEplac181-CpGAL1 8717 CpGAL1 S. cerevisiae 2μm Nosek et al., 2002a
pUC19-CpGAL1B 5670 CpGAL1 - Nosek et al., 2002a
pUC19-CpGAL1E 5275 CpGAL1 - Nosek et al., 2002a
pRM100-CpGAL1 ~ 11300 CpGAL1 C. albicans ARS Nosek et al., 2002a
pUC19-CpGAL1B-ARS2 5871 CpGAL1 C. parapsilosis ARS2 Nosek et al., 2002a
pUC19-CpGAL1B-ARS3 6016 CpGAL1 C. parapsilosis ARS3 Nosek et al., 2002a
pUC19-CpGAL1B-ARS4 5837 CpGAL1 C. parapsilosis ARS4 Nosek et al., 2002a
pUC19-CpGAL1B-ARS7 6276 CpGAL1 C. parapsilosis ARS7 Nosek et al., 2002a
pMPA 5665 CaIMH3 - Gacser et al., 2005
Expression vectors*
Plasmid Plasmid size (bp) Selection marker Expression cassette Reference
Promoter Reporter gene Terminator
pBP3 7228 CpMET2 PCpGAL1 - - This study
pBP3T 8013 CpMET2 PCpGAL1 - TCpGAL1 This study
pBP4 8208 CpMET2 PCpGAL1 yEGFP3 TScCYC1 This study
pBP5 7476 CpLYS4 PCpGAL1 - - This study
pBP5T 8261 CpLYS4 PCpGAL1 - TCpGAL1 This study
pBP6 8456 CpLYS4 PCpGAL1 yEGFP3 TScCYC1 This study
pBP7 5603 CpURA3 PCpGAL1 - - This study
pBP8 6435 CpURA3 PScMET25 yEGFP3 TScCYC1 This study
pPK3 10157 CpMET2 - KlLAC4 TKlLAC4 This study
pPK4 10405 CpLYS4 - KlLAC4 TKlLAC4 This study
pPK5 7343 CaIMH3 PCpGAL1 yEGFP3 TScCYC1 This study
pPK6 9006 CaLYS4 PCpGAL1 yEGFP3 TCpGAL1 This study
Open in a new tab
*

these plasmids contain C. parapsilosis ARS7 element

Acknowledgments

The authors wish to thank L. Kovac and L. Tomaska (Comenius University, Bratislava) for continuous support and helpful comments, J. Zemanova for providing C. parapsilosis auxotrophic strains and technical help, D. Luknarova for excellent technical assistance, and other members of our laboratory for discussions. This work was supported by grants from the Howard Hughes Medical Institute (55005622), the Fogarty International Research Collaboration Award (2-R03-TW005654-04A1), the Slovak grant agencies VEGA (1/2331/05, 1/3247/06), APVV (20-001604, LPP-0164-06), and the Comenius University grant (UK/181/2005).

Abbreviations

CpARS7

C. parapsilosis autonomously replicating sequence 7

MPA

mycophenolic acid

mtTBP

mitochondrial telomere-binding protein

ORF

open reading frame

PCpGAL1

promoter of the CpGAL1 gene

PScMET25

promoter of the ScMET25 gene

PCR

polymerase chain reaction

TCpGAL1

terminator of the CpGAL1 gene

TScCYC1

terminator of the ScCYC1 gene

yEGFP3

yeast enhanced green fluorescent protein 3

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Alonso-Valle H, et al. Candidemia in a tertiary care hospital: epidemiology and factors influencing mortality. Eur J Clin Microbiol Infect Dis. 2003;22:254–257. doi: 10.1007/s10096-003-0890-x. [DOI] [PubMed] [Google Scholar]
  2. Bonassoli LA, Bertoli M, Svidzinski TI. High frequency of Candida parapsilosis on the hands of healthy hosts. J Hosp Infect. 2005;59:159–162. doi: 10.1016/j.jhin.2004.06.033. [DOI] [PubMed] [Google Scholar]
  3. Branchini ML, Pfaller MA, Rhine-Chalberg J, Frempong T, Isenberg HD. Genotypic variation and slime production among blood and catheter isolates of Candida parapsilosis. J Clin Microbiol. 1994;32:452–456. doi: 10.1128/jcm.32.2.452-456.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Camougrand N, Velours G, Guerin M. Resistance of Candida parapsilosis to drugs. Biol Cell. 1986;58:71–78. doi: 10.1111/j.1768-322x.1986.tb00489.x. [DOI] [PubMed] [Google Scholar]
  5. Cassone A, et al. Biotype diversity of Candida parapsilosis and its relationship to the clinical source and experimental pathogenicity. J Infect Dis. 1995;171:967–975. doi: 10.1093/infdis/171.4.967. [DOI] [PubMed] [Google Scholar]
  6. Cormack BP, et al. Yeast-enhanced green fluorescent protein (yEGFP) a reporter of gene expression in Candida albicans. Microbiology. 1997;143:303–311. doi: 10.1099/00221287-143-2-303. [DOI] [PubMed] [Google Scholar]
  7. Doi M, Homma M, Chindamporn A, Tanaka K. Estimation of chromosome number and size by pulsed-field gel electrophoresis (PFGE) in medically important Candida species. J Gen Microbiol. 1992;138:2243–2251. doi: 10.1099/00221287-138-10-2243. [DOI] [PubMed] [Google Scholar]
  8. Du W, Coaker M, Sobel JD, Akins RA. Shuttle vectors for Candida albicans: control of plasmid copy number and elevated expression of cloned genes. Curr Genet. 2004;45:390–398. doi: 10.1007/s00294-004-0499-3. [DOI] [PubMed] [Google Scholar]
  9. El Barkani A, Haynes K, Mosch H, Frosch M, Muhlschlegel FA. Candida glabrata shuttle vectors suitable for translational fusions to lacZ and use of beta-galactosidase as a reporter of gene expression. Gene. 2000;246:151–155. doi: 10.1016/s0378-1119(00)00065-2. [DOI] [PubMed] [Google Scholar]
  10. Espinet C, de la Torre MA, Aldea M, Herrero E. An efficient method to isolate yeast genes causing overexpression-mediated growth arrest. Yeast. 1995;11:25–32. doi: 10.1002/yea.320110104. [DOI] [PubMed] [Google Scholar]
  11. Fridkin SK, Kaufman D, Edwards JR, Shetty S, Horan T. Changing Incidence of Candida Bloodstream Infections Among NICU Patients in the United States: 1995-2004. Pediatrics. 2006;117:1680–1687. doi: 10.1542/peds.2005-1996. [DOI] [PubMed] [Google Scholar]
  12. Fundyga RE, Kuykendall RJ, Lee-Yang W, Lott TJ. Evidence for aneuploidy and recombination in the human commensal yeast Candida parapsilosis. Infect Genet Evol. 2004;4:37–43. doi: 10.1016/j.meegid.2003.11.002. [DOI] [PubMed] [Google Scholar]
  13. Fusek M, Smith EA, Monod M, Foundling SI. Candida parapsilosis expresses and secretes two aspartic proteinases. FEBS Lett. 1993;327:108–112. doi: 10.1016/0014-5793(93)81050-a. [DOI] [PubMed] [Google Scholar]
  14. Gacser A, Salomon S, Schafer W. Direct transformation of a clinical isolate of Candida parapsilosis using a dominant selection marker. FEMS Microbiol Lett. 2005;245:117–121. doi: 10.1016/j.femsle.2005.02.035. [DOI] [PubMed] [Google Scholar]
  15. Gietz RD, Schiestl RH. Transforming yeast with DNA. Meth Mol Cell Biol. 1995;5:255–269. [Google Scholar]
  16. Gietz RD, Sugino A. New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene. 1998;74:527–534. doi: 10.1016/0378-1119(88)90185-0. [DOI] [PubMed] [Google Scholar]
  17. Guthrie C, Fink GR. Guide to Yeast Genetics and Molecular and Cell Biology. Academic Press; New York: 2002. [Google Scholar]
  18. Huang YC, et al. Candidaemia in special care nurseries: comparison of albicans and parapsilosis infection. J Infect. 2000;40:171–175. doi: 10.1053/jinf.2000.0638. [DOI] [PubMed] [Google Scholar]
  19. Juretzek T, et al. Vectors for gene expression and amplification in the yeast Yarrowia lipolytica. Yeast. 2001;18:97–113. doi: 10.1002/1097-0061(20010130)18:2<97::AID-YEA652>3.0.CO;2-U. [DOI] [PubMed] [Google Scholar]
  20. Kim SK, Bissati KE, Mamoun CB. Amino acids mediate colony and cell differentiation in the fungal pathogen Candida parapsilosis. Microbiology. 2006;152:2885–2894. doi: 10.1099/mic.0.29180-0. [DOI] [PubMed] [Google Scholar]
  21. Kovac L, Lazowska J, Slonimski PP. A yeast with linear molecules of mitochondrial DNA. Mol Gen Genet. 1984;197:420–424. doi: 10.1007/BF00329938. [DOI] [PubMed] [Google Scholar]
  22. Laffey SF, Butler G. Phenotype switching affects biofilm formation by Candida parapsilosis. Microbiology. 2005;151:1073–1081. doi: 10.1099/mic.0.27739-0. [DOI] [PubMed] [Google Scholar]
  23. Leuker CE, Hahn AM, Ernst JF. beta-Galactosidase of Kluyveromyces lactis (Lac4p) as reporter of gene expression in Candida albicans and C. tropicalis. Mol Gen Genet. 1992;235:235–241. doi: 10.1007/BF00279365. [DOI] [PubMed] [Google Scholar]
  24. Logue ME, Wong S, Wolfe KH, Butler G. A genome sequence survey shows that the pathogenic yeast Candida parapsilosis has a defective MTLa1 allele at its mating type locus. Eukaryot Cell. 2005;4:1009–1017. doi: 10.1128/EC.4.6.1009-1017.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lott TJ, Kuykendall RJ, Welbel SF, Pramanik A, Lasker BA. Genomic heterogeneity in the yeast Candida parapsilosis. Curr Genet. 1993;23:463–467. doi: 10.1007/BF00312635. [DOI] [PubMed] [Google Scholar]
  26. Merkerova M, Dostal J, Hradilek M, Pichova I, Hruskova-Heidingsfeldova O. Cloning and characterization of Sapp2p, the second aspartic proteinase isoenzyme from Candida parapsilosis. FEMS Yeast Res. 2006;6:1018–1026. doi: 10.1111/j.1567-1364.2006.00142.x. [DOI] [PubMed] [Google Scholar]
  27. Myers AM, Tzagoloff A, Kinney DM, Lusty CJ. Yeast shuttle and integrative vectors with multiple cloning sites suitable for construction of lacZ fusions. Gene. 1986;45:299–310. doi: 10.1016/0378-1119(86)90028-4. [DOI] [PubMed] [Google Scholar]
  28. Nosek J, et al. Genetic manipulation of the pathogenic yeast Candida parapsilosis. Curr Genet. 2002a;42:27–35. doi: 10.1007/s00294-002-0326-7. [DOI] [PubMed] [Google Scholar]
  29. Nosek J, Dinouel N, Kovac L, Fukuhara H. Linear mitochondrial DNAs from yeasts: telomeres with large tandem repetitions. Mol Gen Genet. 1995;247:61–72. doi: 10.1007/BF00425822. [DOI] [PubMed] [Google Scholar]
  30. Nosek J, et al. Complete DNA sequence of the linear mitochondrial genome of the pathogenic yeast Candida parapsilosis. Mol Genet Genomics. 2004;272:173–180. doi: 10.1007/s00438-004-1046-0. [DOI] [PubMed] [Google Scholar]
  31. Nosek J, Rycovska A, Makhov AM, Griffith JD, Tomaska L. Amplification of telomeric arrays via rolling-circle mechanism. J Biol Chem. 2005;280:10840–10845. doi: 10.1074/jbc.M409295200. [DOI] [PubMed] [Google Scholar]
  32. Nosek J, Tomaska L, Pagacova B, Fukuhara H. Mitochondrial telomere-binding protein from Candida parapsilosis suggests an evolutionary adaptation of a nonspecific single-stranded DNA-binding protein. J Biol Chem. 1999;274:8850–8857. doi: 10.1074/jbc.274.13.8850. [DOI] [PubMed] [Google Scholar]
  33. Nosek J, Tomaska L, Rycovska A, Fukuhara H. Mitochondrial telomeres as molecular markers for identification of the opportunistic yeast pathogen Candida parapsilosis. J Clin Microbiol. 2002b;40:1283–1289. doi: 10.1128/JCM.40.4.1283-1289.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Ohama T, et al. Non-universal decoding of the leucine codon CUG in several Candida species. Nucleic Acids Res. 1993;21:4039–4045. doi: 10.1093/nar/21.17.4039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Pfaller MA. Epidemiology of candidiasis. J Hosp Infect. 1995;30(Suppl):329–338. doi: 10.1016/0195-6701(95)90036-5. [DOI] [PubMed] [Google Scholar]
  36. Phillippsen P, Stotz A, Scherf C. DNA isolation of Saccharomyces cerevisiae. Methods Enzymol. 1991;194:169–182. doi: 10.1016/0076-6879(91)94014-4. [DOI] [PubMed] [Google Scholar]
  37. Pichova I, et al. Secreted aspartic proteases of Candida albicas, Candida tropicalis, Candida parapsilosis and Candida lusitaniae. Inhibition with peptidomimetic inhibitors. Eur J Biochem. 2001;268:2669–2677. doi: 10.1046/j.1432-1327.2001.02152.x. [DOI] [PubMed] [Google Scholar]
  38. Rose M, Botstein D. Construction and use of gene fusions to lacZ (beta-galactosidase) that are expressed in yeast. Methods Enzymol. 1983;101:167–180. doi: 10.1016/0076-6879(83)01012-5. [DOI] [PubMed] [Google Scholar]
  39. Rycovska A, Valach M, Tomaska L, Bolotin-Fukuhara M, Nosek J. Linear versus circular mitochondrial genomes: intraspecies variability of mitochondrial genome architecture in Candida parapsilosis. Microbiology. 2004;150:1571–1580. doi: 10.1099/mic.0.26988-0. [DOI] [PubMed] [Google Scholar]
  40. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. Cold Spring Harbour Laboratory Press; Cold Spring Harbour, New York: 1989. [Google Scholar]
  41. Sreekrishna K, Dickson RC. Construction of strains of Saccharomyces cerevisiae that grow on lactose. Proc Natl Acad Sci USA. 1985;82:7909–7913. doi: 10.1073/pnas.82.23.7909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Staib P, Michel S, Kohler G, Morschhauser J. A molecular genetic system for the pathogenic yeast Candida dubliniensis. Gene. 2000;242:393–398. doi: 10.1016/s0378-1119(99)00512-0. [DOI] [PubMed] [Google Scholar]
  43. Tomaska L, Nosek J, Makhov AM, Pastorakova A, Griffith JD. Extragenomic double-stranded DNA circles in yeast with linear mitochondrial genomes: potential involvement in telomere maintenance. Nucleic Acids Res. 2000;28:4479–4487. doi: 10.1093/nar/28.22.4479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Uhl MA, Johnson AD. Development of Streptococcus thermophilus lacZ as a reporter gene for Candida albicans. Microbiology. 2001;147:1189–1195. doi: 10.1099/00221287-147-5-1189. [DOI] [PubMed] [Google Scholar]
  45. Zemanova J, Nosek J, Tomaska L. High-efficiency transformation of the pathogenic yeast Candida parapsilosis. Curr Genet. 2004;45:183–186. doi: 10.1007/s00294-003-0472-6. [DOI] [PubMed] [Google Scholar]

RESOURCES