Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2008 Jul 15.
Published in final edited form as: Dev Biol. 2007 May 3;307(2):328–339. doi: 10.1016/j.ydbio.2007.04.045

The MARVEL domain protein, Singles Bar, is required for progression past the pre-fusion complex stage of myoblast fusion

Beatriz Estrada 1,3, Anne D Maeland 2, Stephen S Gisselbrecht 1, James W Bloor 2,4, Nicholas H Brown 2, Alan M Michelson 1,5,6
PMCID: PMC1994691  NIHMSID: NIHMS27349  PMID: 17537424

Summary

Multinucleated myotubes develop by the sequential fusion of individual myoblasts. Using a convergence of genomic and classical genetic approaches, we have discovered a novel gene, singles bar (sing), that is essential for myoblast fusion. sing encodes a small multipass transmembrane protein containing a MARVEL domain, which is found in vertebrate proteins involved in processes such as tight junction formation and vesicle trafficking where—as in myoblast fusion—membrane apposition occurs. sing is expressed in both founder cells and fusion competent myoblasts preceding and during myoblast fusion. Examination of embryos injected with double-stranded sing RNA or embryos homozygous for ethane methyl sulfonate-induced sing alleles revealed an identical phenotype: replacement of multinucleated myofibers by groups of single, myosin-expressing myoblasts at a stage when formation of the mature muscle pattern is complete in wild-type embryos. Unfused sing mutant myoblasts form clusters, suggesting that early recognition and adhesion of these cells is unimpaired. To further investigate this phenotype, we undertook electron microscopic ultrastructural studies of fusing myoblasts in both sing and wild-type embryos. These experiments revealed that more sing mutant myoblasts than wild-type contain pre-fusion complexes, which are characterized by electron-dense vesicles paired on either side of the fusing plasma membranes. In contrast, embryos mutant for another muscle fusion gene, blown fuse (blow), have a normal number of such complexes. Together, these results lead to the hypothesis that sing acts at a step distinct from that of blow, and that sing is required on both founder cell and fusion-competent myoblast membranes to allow progression past the pre-fusion complex stage of myoblast fusion, possibly by mediating fusion of the electron-dense vesicles to the plasma membrane.

Keywords: cell-cell fusion, myoblast fusion, mesoderm, myogenesis, muscle, development, Drosophila, MARVEL domain

Introduction

Cell fusion is the process by which two or more cells combine to form one multinucleated cell by fusing their plasma membranes and sharing their cytoplasms. This process is essential for the formation of a variety of tissues, such as bone, skeletal muscle, and the epidermis of C. elegans (Chen and Olson, 2005). During myogenesis, mononucleated myoblasts fuse with each other to form functional multinucleated myofibers. Thus, both normal muscle growth and muscle regeneration rely on myoblast fusion (Charge and Rudnicki, 2004). Elucidating the molecular mechanisms underlying myoblast fusion has important implications in understanding both normal myogenesis and the use of cell fusion as a therapy for muscle diseases (Vassilopoulos and Russell, 2003).

Studies undertaken in mammalian cell culture and in Drosophila embryos have demonstrated that myoblast fusion involves an ordered set of specific events where a sequence of cellular interactions occurs: first, myoblasts recognize and adhere; then, alignment occurs through the parallel apposition of the membranes of elongated myoblasts with myotubes or other myoblasts; finally, membrane union takes place between the aligned plasma membranes leading to small areas of cytoplasmic continuity. These processes result in the formation of a multinucleated cell and are conserved between flies and humans (Chen and Olson, 2005; Horsley and Pavlath, 2004).

The somatic musculature of Drosophila is the equivalent of vertebrate skeletal muscle. From the embryonic mesoderm, two populations of somatic myoblasts arise—founder cells (FCs) and fusion-competent myoblasts (FCMs)—through the integration of signals mediated by the Notch, Wnt, Dpp and Ras pathways, and of tissue specific transcription factors that include Twist and Tinman (Carmena et al., 1998; Halfon et al., 2000; Knirr and Frasch, 2001). These two types of myoblasts fuse to form functional multinucleated myotubes. FCs serve as attractants for FCMs which, upon fusion, acquire the differentiation program dictated by the FCs. As determined by the combination of “selector” transcription factors that FCs express (Baylies and Michelson, 2001; Furlong, 2004), these cells posses all of the information for the unique identity of each muscle, including its size, shape, position, innervation and attachment to the epidermis.

Myoblast fusion occurs in two distinct rounds. First, one or two FCMs fuse to a FC giving rise to a bi- or tri-nucleated cell, the syncytial precursor. Second, subsequent fusion events take place until the muscle attains its characteristic size (Bate, 1990). Recent experiments in mammalian cell culture also have shown that myoblast fusion takes place in two different rounds: first the nascent myotubes form, and then, additional myoblasts fuse to the nascent myotube (Horsley and Pavlath, 2004).

Genetic analysis in Drosophila has identified several molecules that are essential for myoblast fusion. Four of these are transmembrane proteins that are members of the immunoglobulin superfamily of cell adhesion proteins. Dumbfounded (Duf) is expressed in FCs and serves as an attractant for FCMs (Ruiz-Gomez et al., 2000). Roughest (Rst) appears to have similar functions to Duf because embryos lacking both genes show defects in myoblast attraction and fusion (Strunkelnberg et al., 2001). Sticks and stones (Sns) and Hibris (Hbs) are specifically expressed in FCMs, and, in the case of Sns, direct interaction with Duf mediates cell recognition and adhesion (Artero et al., 2001; Bour et al., 2000; Dworak et al., 2001; Galletta et al., 2004). This interaction is thought to trigger a signaling cascade from the membrane to cytoskeletal components required for fusion. In the FC, the scaffold-like protein Rolling pebbles (Rols, also known as Antisocial) is translocated from the cytoplasm to the fusion site in a Duf-dependent manner upon cell adhesion (Chen and Olson, 2001; Menon and Chia, 2001; Rau et al., 2001). This process causes the recruitment of the cytoskeletal protein D-Titin to the fusion site. At the same time, Duf recruits the guanine nucleotide exchange factor, Loner, which then brings and activates the ARF6 and D-Rac GTPases to the fusion site (Chen et al., 2003). In addition, there is a molecular interaction between Rols and Myoblast city (Mbc) (Chen and Olson, 2001; Erickson et al., 1997), a protein of the conserved CDM family, which modulates the small GTPase Rac, an important cytoskeletal regulator (Hall, 1998). These experiments have established a pathway that relays signals from the fusion site at the membrane to the cytoskeleton (Chen and Olson, 2004). The requirement of several cytoskeletal proteins for myoblast fusion—including D-Titin, small GTPases, and Kette/Nap1, a regulator of the cytoskeleton (Schroter et al., 2004)—highlights the important role of the cytoskeleton during these cellular events. However, the function of the cytoskeleton in FCs and FCMs, and the mechanism by which the signal is relayed in FCMs, are still unknown.

The ultrastructural morphology of myoblast membranes during cell adhesion and fusion has been described in great detail (Doberstein et al., 1997). Upon cell adhesion, the plasma membranes align and groups of electron-dense vesicles pair on each side of the apposing cells to form structures called pre-fusion complexes. More rarely, elongated electron-dense regions called plaques are observed along apposed plasma membranes. Because the material within plaques resembles that associated with vesicles, it is thought that plaques result from fusion of paired vesicles to the plasma membrane (Doberstein et al., 1997). These regions in developing Drosophila muscles are similar to the membrane plaques observed in vertebrate myoblasts (Rash and Fambrough, 1973). Finally, membrane vesiculation and pores are seen between the fusing myoblasts (Doberstein et al., 1997). Electron-dense vesicles have also been observed in fusing vertebrate myoblasts, including in primary cultures of quail myoblasts (Lipton and Konigsberg, 1972) and in the muscle cell line L6 (Engel et al., 1986). However in the latter cases, the pairing behavior and the electron-dense material between cells were not observed. The vesicles in quail myoblasts were shown to fuse with the plasma membrane, and at least one example of a pair of vesicles in apposed cells was observed in the act of fusing simultaneously with their respective plasma membranes (Lipton and Konigsberg, 1972). Whether the molecules associated with vertebrate and Drosophila vesicles are homologous remains to be determined.

There is currently a gap in our understanding of how myoblasts fuse because the molecules that mediate the actual process of membrane fusion have not been identified. Moreover, the components of the pre-fusion complex and of electron-dense vesicles have not been characterized. It is also unclear what triggers membrane breakdown after myoblasts become closely apposed.

In this paper, we identify and characterize singles bar (sing), a novel Drosophila gene encoding a MARVEL domain transmembrane protein that is required for myoblast fusion. Of note, mammalian MARVEL domain proteins are involved in membrane apposition events, such as tight junction formation and vesicular transport. RNA interference for and ethane methyl sulfonate (EMS)-induced mutations in sing revealed that myoblast recognition and adhesion take place normally but myoblasts fail to fuse in the absence of Sing. Ultrastructural analysis demonstrated the presence of higher numbers of pre-fusion complexes and electron-dense vesicles in the pre-fusion complexes in sing mutants compared with wild-type myoblasts. These latter findings demonstrate that Sing is required for progression past the pre-fusion complex stage of myoblast fusion, and raise the possibility that Sing may be a component of the pre-fusion complex and may directly contribute to membrane fusion.

Material and Methods

Drosophila strains

The following strains were used: twi-Gal4, UAS-Ras1Act (Carmena et al., 1998; Greig and Akam, 1993), DlX/TM3, ftz-lacz (Lieber et al., 1993), lmd1/TM3, ftz-lacz (Duan et al., 2001), MHC-tau-GFP (Chen and Olson, 2001), mbcTT261/TM3, ftz-lacz (J. Skeath, E. Buff, and A. M. Michelson, unpublished results) and rp298-lacz (Nose et al., 1998). The following sing alleles were isolated in an EMS mutagenesis: sing23/FTG, sing22/FTG, sing21 /FTG. The FTG (FM7, twi-Gal4 UAS-2EGFP) and CTG (CyO, twi-Gal4 UAS-2EGFP) balancer chromosomes were used to identify live homozygous mutants for sing and blow, respectively (Halfon et al., 2002). The alleles blow1/CTG (Doberstein et al., 1997) and mbcTT261/TTG (TM3, twi-Gal4 UAS-2EGFP) were used to compare the fusion phenotypes with sing. Rescue experiments of sing’s lethality were performed with transgenic lines containing the genomic rescue construct described in the Results section or by expressing CG13011 cDNA transgenes under control of the mesodermal driver, twi-Gal4. In the genomic rescue experiment, sing23/FTG females were crossed to sing-genomic2,3/TM3 line B2 males. In the cDNA rescue experiment, sing23/FTG females were crossed either to twi-Gal4, UAS-CG13011-DL3/CyO, ftz-lacz males or to twi-GAl4, UAS-CG13011-DA1/TM3 males. Progeny were scored for viable, non-balancer males in both types of rescue experiments.

In situ hybridization and immunohistochemistry

In situ hybridization was done as described in Estrada et al. (2006). The following sing specific primers were used to amplify embryonic primary cDNA to generate anti-sense digoxigenin-labeled probes: forward 5′-CGTCTGCACCTGCATCAATTTC-3′, reverse 5′- ctaatacgactcactatagggATATTCCCGCTGCATAGCCC-3′ containing the T7 promotor. Immunostains were performed as described in Carmena et al. (1998). The following primary antibodies were used: guinea pig anti-Kr (Kosman et al., 1998), rabbit anti-MHC (a gift from D. Keihart), rabbit anti-eve (Frasch et al., 1987), rabbit anti-Lmd (Duan et al., 2001), mouse anti-Rols (Menon and Chia, 2001), guinea pig anti-Duf/Rst (Galletta et al., 2004), rabbit and mouse anti-βgalactosidase (Cappel, Promega), rabbit and mouse anti-GFP (Invitrogen, Clontech), and anti-digoxigenin-AP (Roche).

RNA interference assay

RNA interference assays were performed as described in Estrada et al. (2006). Specific primers were as follows: sing -TAATACGACTCACTATAGGGAGACGTCTGCACCTGCATCAATTTC and TAATACGACTCACTATAGGGAGAATATTCCCGCTGCATAGCCC; mbc -TAATACGACTCACTATAGGGAGATGCCAAGACCTCGGAGAAGAAC and TAATACGACTCACTATAGGGAGAATGTTGACCCTGCGTGATGG; lacZ-TAATACGACTCACTATAGGGAGATGGCGGAAAACCTCAGTGTG and TAATACGACTCACTATAGGGAGAATCCCAGCGGTCAAAACAGG.

Sequencing of sing alleles

Sequencing of sing alleles was done from PCR-amplified and cloned genomic DNA isolated from mutant embryos. We used the following primers covering the coding sequence of the gene: TCCATGTGTATCGGCAGCTATTT and CATCCACAAGGTTATCCACGAAA.

Conventional electron microscopy and quantification of pre-fusion complexes

Three-hour egg collections of wild-type and mutant genotypes were aged to late stage 12 or early stage 13 (7-10 hours) when most myoblast fusion occurs. We identified homozygous mutant embryos by selecting GFP-negative embryos prior to fixation from sing23/FTG and blow1/CTG stocks. Fixation was done as described in (Lin et al., 1994) with the following minor modifications. The Osmium postfix was done in water with 1.5% potassium ferrocyanide instead of cacodylate buffer, then rinsed once with 0.14 M Na-cacodylate buffer followed by 2 rinses with distilled water followed by a stain of the embryos en bloc with 1% aqueous uranyl acetate for 1 hour at room temperature to increase membrane contrast. The embryos were embedded in TAAB EPON (Marivac Corp.) resin. Serial sections and stainings were done as in (Lin et al., 1994). Sections were examined and photographed with a transmission electron microscope (JEOL 1200EX).

To quantify the number of pre-fusion complexes and the total number of vesicles present in wild-type and mutant embryos, we analyzed an average of 123 myoblasts per embryo in 4 to 6 different embryos from each genotype. It is important to note that these quantitations represent relative differences between genotypes and not absolute counts per cell. The presence of at least one electron-dense vesicle between two adjacent myoblasts was scored as a pre-fusion complex, and the total number of vesicles in each complex was also counted. This scoring was done twice independently and the average between the two measurements was calculated for later statistical analysis. To compare the number of pre-fusion complexes among genotypes, we calculated the ratio of pairs of myoblasts sharing vesicles over the total number of myoblasts per field. However, since this ratio showed significant heterogeneity of variances among genotypes, we rank-transformed our original variables in order to overcome such violation of parametric assumption (Conover and Iman, 1981; Marden et al., 1995). This manipulation enabled us to conduct analyses of variance (ANOVA) among genotypes on the ranked variable, the number of myoblasts sharing vesicles. The same was true for the average number of vesicles found per pre-fusion complex, which we also ranked prior to analysis. As we found significant overall differences among genotypes, we tested for pairwise differences using post-hoc Tukey tests (Sokal, 1995).

Results

The gene CG13011 is expressed in muscle founder cells and in fusion-competent myoblasts

Previous studies done in our laboratory identified hundreds of genes that are differentially expressed in different populations of Drosophila embryonic myoblasts (Estrada et al., 2006). One of the newly identified genes, CG13011, is expressed in both FCs and FCMs, as revealed by in situ hybridization of wild-type embryos and embryos having informative genetic backgrounds. The latter result was confirmed by double labeling with appropriate cell type-specific markers (Fig. 1).

Figure 1.

Figure 1

Open in a new tab

CG13011 is expressed in embryonic muscle founder cells (FCs) and fusion-competent myoblasts (FCMs). (A) Somatic (asterisk) and visceral (arrow) mesoderm expression of CG13011 in a wild-type stage 11 embryo. (B, C) Expanded expression of CG13011 in enlarged clusters of somatic FCs as a result of constitutively activating Ras (B) or inhibiting Notch signaling by removing Delta (Dl), the Notch ligand (C). Inset in C shows coexpression of sing mRNA (purple) with the FC marker duf-LacZ (brown) in a wild-type embryo. (D) Residual expression of CG13011 in FCs (arrow) in lame duck (lmd) mutant embryos in which FCM development is blocked. Inset shows coexpression of sing mRNA (purple) with the FCM marker Lmd (brown) in wild-type embryos. (E, F) CG13011 expression in the somatic musculature of wild-type stage 13 and stage 14 embryos.

The expression of CG13011 is first detected in the visceral mesoderm primordium at stage 10 (data not shown). Then, at stage 11, it is expressed additionally in the somatic mesoderm (Fig. 1A). There is no prominent expression of CG13011 in any embryonic tissues other than the somatic and visceral mesoderm. To determine whether CG13011 is expressed in both FCs and FCMs, we genetically manipulated the fates of these cells. The Ras and Notch signaling pathways act antagonistically to specify FCs and FCMs, respectively (Bour et al., 2000; Carmena et al., 2002; Carmena et al., 1998; Estrada et al., 2006; Furlong et al., 2001; Ruiz-Gomez et al., 2002). For example, embryos expressing an activated form of Ras (Ras1Act) or lacking the Notch ligand, Delta (Dl), have an increased number of FCs found in clusters when stained for any of a large number of FC marker genes (Artero et al., 2003; Carmena et al., 1998; Corbin et al., 1991; Estrada et al., 2006; Gisselbrecht et al., 1996; Michelson et al., 1998). The expanded expression of CG13011 in clusters of cells in these two genotypes (compare Fig. 1A with Fig. 1B and C) indicates that this gene is expressed in FCs. Of note, the clustered arrangement of FCs in Ras gain-of-function and Dl loss-of-function embryos reflects persistence of FC marker gene expression in all cells of myoblast equivalence groups, thereby accounting for the different appearance of the in situ hybridization patterns when comparing wild-type and Ras1Act or Dl mutant embryos (Fig. 1A,B). In contrast, in embryos homozygous for a mutation in lame duck (lmd), which compromises FCM development (Duan et al., 2001; Furlong et al., 2001; Ruiz-Gomez et al., 2002), CG13011 expression is clearly reduced (Fig. 1D). This result indicates that this gene is also expressed in FCMs. Moreover, in double labeling experiments, we observed co-expression of CG13011 mRNA with an enhancer trap reporter for the FC-specific gene, dumbfounded (inset in Fig 1C), and with the FCM-specific gene lmd (inset in Fig 1D), thereby confirming that CG13011 RNA is found in both types of myoblasts.

Interestingly, CG13011 expression in the visceral muscles is not clearly reduced in lmd mutant embryos (Fig 1D). This result, together with previous observations with other genes expressed in FCMs (Estrada et al., 2006), suggests that lmd differentially regulates myoblast gene expression in the somatic and visceral mesoderm. The expression of CG13011 in both somatic and visceral mesodermal cells persists until stage 13, and fades away by stages 14 to 15 (Fig. 1 F).

CG13011 is singles bar, a gene required for myoblast fusion

Given the mesodermally restricted expression of CG13011, we wished to test its function during myogenesis. We therefore performed an RNA interference (RNAi) assay, as described in Estrada et al., (2006), where CG13011 double-stranded RNA (dsRNA) was injected into live embryos expressing GFP in the musculature. We observed many unfused myoblasts in the RNAi experiment for CG13011 at a time in development when no single myoblasts are present in the negative control embryos injected with lacZ dsRNA (Fig. 2A,C, D), suggesting that CG13011 is required for myoblast fusion. This aberrant phenotype is similar to the one observed in the positive control in which mbc dsRNA was similarly injected into embryos with muscle-specific GFP expression (Fig. 2B, E).

Figure 2.

Figure 2

Open in a new tab

The gene singles bar (CG13011) encodes a MARVEL domain protein that is essential for myoblast fusion. (A-E) Embryonic muscle pattern of stage 16-17 GFP-expressing embryos injected with lacZ (A) mbc (B and E) or CG13011 dsRNA (C and D), respectively. The recipient embryos express a tau-GFP fusion protein under control of a myosin heavy chain promoter (Chen and Olson, 2001). Many unfused myoblasts (small, rounded GFP-positive cells) are present in embryos injected with either mbc or CG13011 dsRNA at a time in development when only multinucleated myofibers are seen in a lac-Z dsRNA injected embryo (best seen at higher magnification in D and E; compare with A). (F) Sing wild-type amino acid sequence; underlined amino acids represent the transmembrane domains. Point mutations present in the three sing alleles are shown underneath this sequence: sing22 is a missense mutant (A46V), sing23 causes a premature stop (W142stop), as does sing27 (L160stop). (G) Schematic representation of the MARVEL domain Sing protein showing four transmembrane helixes and the location of the point mutations found in the sing alleles. Modified from Puertollano et al 1997. (I, J) Visualization of the somatic musculature of a stage 14 sing23 embryo by staining for myosin heavy chain expression. Unfused myoblasts are observed as grape-like clusters of myosin-positive cells (higher magnification in J) at a time in development when there are none in wild type embryos (compare with H).

Independently, a role for CG13011 in muscle fusion was identified by a more classical genetic approach. A screen of the X-chromosome for regions that, when deleted, caused muscle defects showed that there is a gene or genes within the cytological interval 14F6 to 15A6 that are required for muscle fusion (Drysdale et al., 1993). A smaller deficiency was isolated (Brown, 1994), which narrowed down the region to 15A1-2 to 15A4-5. To isolate point mutants in the putative muscle fusion gene, as well as in the adjacent locus inflated, an F2 lethal screen was performed for mutations within the region 14F to 16A1-2 (covered by a duplication Dp(1;4)80f3c (Bloor and Brown, 1998). Three of the mutations isolated formed a lethal complementation group that was named singles bar (sing) due to the accumulation of single myoblasts within the embryo. The singles bar locus was mapped to a small transcription unit in this interval, which corresponds to CG13011. Each of the sing alleles contains a point mutation causing a change in the encoded 176 residue protein: sing22 is a missense mutant (A46V), and sing23 causes a premature stop (W142stop), as does sing27 (L160stop).

The identification of the CG13011 transcription unit as sing was confirmed by genetic rescue experiments. A 2524 bp Nde I to Sfi I fragment, starting 1359 bp upstream of the ATG of CG13011, and extending 272 bp beyond the 3′ untranslated region, was introduced into the genome by P-element mediated transformation. This genomic region was able to rescue the lethality of sing mutations, as was expression of a UAS-sing cDNA under control of a mesodermal Gal 4 driver (Table 1). Based on the combined findings of the RNAi, EMS allele sequencing and genetic rescue experiments, we conclude that CG13011 corresponds to the sing gene, and the failure in muscle fusion is caused by defects in the encoded gene product. Sing protein is a small multipass transmembrane protein, with residues 30-173 consisting of a MARVEL domain (after MAL and related proteins for vesicle trafficking and membrane link) (Sanchez-Pulido et al., 2002), characterized by four transmembrane helix regions and both the N- and C-termini of the protein on the cytoplasmic side (Fig. 2G). The missense mutation in sing22 is in the first helix, sing27 truncates the protein between helices three and four, while sing23 truncates within the fourth helix (Fig. 2F). The sing mutations are clearly nulls because embryos hemizygous for the deficiency Df(1)rif (Bloor and Brown, 1998), which completely removes sing, have an identical muscle fusion defect. Fig. 2 shows the presence of unfused groups of myoblasts in sing23 embryos (Fig. 2I and J) compared to the multinucleated myofibers found in stage 14 wild-type embryos (Fig. 2H). The presence of groups of unfused myoblasts (reminiscent of a “bunch of grapes” phenotype, comparable to that of blown fuse, (blow) (Doberstein et al., 1997), as visualized with a myosin heavy chain antibody (Fig. 2J), suggests that sing is not required for cell attraction, recognition or adhesion. We tried extensively to generate a reagent that would allow us to examine the subcellular distribution of Sing, including antibodies and tagged rescue constructs, but none of these approaches was successful.

Table 1.

Both sing cDNA and genomic constructs rescue the lethality of sing mutants.

FEMALES MALES Viable sing males (frequency observed) Expected frequency of viable males if mutation was fully rescued § Progeny Flies scored
sing23/FM7 sing-genomic2,3 line B2/ TM3 44 (0.15) 0.125 338
sing23/FM7 twi-Gal4, UAS-CG13011-DL3/CyO * 30 (0.12) 0.125 256
sing23/FM7 twi-GAl4, UAS-CG13011-DA1/TM3 37 (0.10) 0.125 385
Open in a new tab
§

expected frequency from heterozygous lines is 0.125.

*

pooled data from two separate crosses of two independent recombinants between the UAS-sing cDNA line DL3 and Twi-Gal4.

pooled data from three separate crosses of three independent recombinants between the UAS-sing cDNA line DA1 and Twi-Gal4.

Flies ectopically expressing sing cDNA under the twi-Gal4 driver were viable.

sing is not required for myoblast cell fate specification

To verify that the muscle fusion phenotype associated with sing loss-of-function was not due to failure in cell fate specification of the FCs or FCMs, we analyzed the expression of one marker of each myoblast population at a stage when these cells have already been determined. The expression of the transcription factor Kruppel (Kr) (Ruiz-Gomez et al., 1997) in a group of unfused FCs in stage 12 wild-type embryos is the same as in sing mutant embryos (Fig. 3A-D). In contrast, later in development when the majority of myoblasts have completed fusion in wild-type embryos (Fig. 3 I), muscles in sing mutant embryos contain only two nuclei due to their inability to incorporate new myoblasts into the growing myofiber (Fig. 3L, see below).

Figure 3.

Figure 3

Open in a new tab

sing is not required for FC or FCM fate specification but is necessary after the first round of fusion. (A-D) Stage 12 wild-type (A, B) and sing23 (C,D) embryos stained for expression of Kruppel (Kr) protein in FCs. An identical number of Kr-positive FCs is present in wild-type and sing mutant embryos. (E-H) A similar number of Lmd-expressing FCMs is present in stage 12 wild-type (E,F) and sing23 (G,H) embryos. (I-L) Even skipped (Eve)-stained pericardial cells (asterisk) and DA1 muscle (dotted line) in stage 15-16 wild-type, mbcTT261, blow1 and sing23 embryos, respectively. A normal DA1 muscle contains from 9-14 nuclei (selected oval in I) whereas mbc DA1 muscles are mono-nucleated (ovals in J) because myoblasts fail to undergo the first round of fusion. blow DA1 muscles contain from 1-2 nuclei (ovals in K) and sing DA1 muscles are uniformly bi-nucleated (ovals in L), indicating that the first round of fusion occurs normally.

The transcription factor Lmd is expressed in FCMs and is required for their development (Duan et al., 2001; Furlong et al., 2001; Ruiz-Gomez et al., 2002). When we compared Lmd expression in wild-type and sing mutant embryos at stage 12, we saw no difference in the number of Lmd-expressing cells, indicating that absence of sing function is not associated with a defect in FCM specification (Fig. 3E-H).

sing is required after the first round of myoblast fusion

In both Drosophila and vertebrates, myotube formation involves two stages of myoblast fusion (Bate, 1990; Horsley and Pavlath, 2004; Rau et al., 2001): an initial round where bi- or trinucleated muscle precursors form, and sequential rounds where additional FCMs fuse to the precursor until a mature myofiber having its characteristic size is complete (Bate, 1990). Accordingly, mutations in different fusion genes affect the formation of the initial precursors or subsequent fusion events (Chen and Olson, 2004; Schroter et al., 2004). For instance, Duf and Mbc are essential for the formation of the precursor muscle in the first rounds of fusion (Ruiz-Gomez et al., 2000; Rushton et al., 1995). By contrast, rols mutant embryos have myofibers with two to four nuclei, showing that initial fusion events have taken place but subsequent ones have failed. Thus, it is thought that Rols is only required in the muscle precursor to recruit FCMs for subsequent myotube formation (Menon et al., 2005; Rau et al., 2001).

To determine at which round of fusion sing mutants are arrested, we visualized the expression of the transcription factor Even skipped (Eve) in one dorsal muscle (muscle DA1). Muscle DA1 in wild-type embryos contains from 9-14 nuclei at the end of embryogenesis (Fig. 3I; Menon et al., 2005; Rau et al., 2001), whereas mbc mutants—which fail to undergo any fusion—have mononucleated DA1 muscles (Fig. 3J; Carmena et al., 1998). blow mutant embryos show one or two DA1 nuclei (Fig. 3K), indicating that, in the absence of Blow, there is some variability in the capacity to form muscle precursors in the first round of fusion (Menon et al., 2005; Schroter et al., 2004). In contrast, we have observed that sing mutant embryos consistently show binucleated DA1 muscles (Fig. 3L), suggesting that sing is not required for the first round of fusion but it is essential for recruiting additional myoblasts into the myofiber.

sing function is not required to translocate either Rols or Duf to the site of membrane fusion

Since sing is expressed in fusing myoblasts and is required for the second round of fusion, as is rols, we hypothesized that Sing might function in the previously described subcellular localization of Rols (Chen and Olson, 2001; Menon and Chia, 2001; Rau et al., 2001). Immunostaining with a Rols-specific antibody in sing mutant embryos showed that Rols is able to translocate normally from a dispersed localization in the cytoplasm to form aggregates at sites of membrane fusion. Interestingly, however, the amount of Rols aggregation in fusion spots is much higher in sing than in wild-type embryos (Suppl. Fig. 1A,B). This phenotype is similar to what occurs in two other mutants where fusion is arrested, blow and mbc (Menon et al., 2005) and Suppl. Fig. 1C,D). Collectively, these results suggest that none of these proteins is part of the molecular machinery involved in the translocation of Rols to sites of membrane fusion, but that each could be involved in the recycling of Rols as fusion proceeds.

Menon et al. (2005) described that the mechanism by which Rols sustains fusion is by maintaining Duf at the membrane, where they colocalize, and that this process is essential but not sufficient to maintain surface levels of Duf in precursors in the second round of fusion. Thus, in rols mutant embryos, the levels of membrane-bound Duf are undetectable. In contrast, an excess of Duf is found at the surface of growing myotubes in blow and in sing mutant embryos (Suppl. Fig. 1H,I). This latter finding suggests that neither Sing nor Blow is required for Duf translocation to sites of myoblast fusion, but that both proteins might be involved in the recycling of Duf from the muscle cell surface.

Sing is required for progression beyond the pre-fusion complex stage of myoblast fusion and functions independently of Blow

In sing mutants, myoblasts recognize each other and adhere but fail to fuse (Fig. 2E). To examine the defect in membrane fusion that occurs in the absence of sing function, we undertook an electron microscopic analysis of this process in mutant embryos. Given the abovementioned similarity of the muscle fusion phenotypes of sing and blow mutants, we also included blow in this ultrastructural analysis.

Using electron microscopy, Doberstein et al. (1997) previously described myoblast fusion in wild-type embryos as occuring in several distinct stages. They observed that pre-fusion complexes, characterized by electron-dense vesicles paired on either side of the fusing plasma membranes, appear before the actual occurrence of membrane fusion (Doberstein et al., 1997). We found that sing embryos not only have pre-fusion complexes between fusing myoblasts, but they possess a statistically significant higher number of pre-fusion complexes than wild-type embryos (Fig. 4A, B). Several embryos of each genotype and more than one hundred myoblasts per embryo were analyzed for these studies. On average, 22% of myoblasts in wild-type embryos contain pre-fusion complexes, whereas the comparable number for sing mutant myoblasts is 48% (P < 0.0001; Fig. 4C, see Material and Methods for details about the quantitations).

Figure 4.

Figure 4

Open in a new tab

sing is required for progression beyond the pre-fusion complex stage of myoblast fusion. (A) Adhering sing23 myoblasts in the process of fusing contain pre-fusion complexes characterized by groups of electron-dense vesicles on either side of the two apposed plasma membranes. Cell nucleus is indicated with an N. (B) Higher magnification of the indicated area from A illustrating a pre-fusion complex. Electron-dense vesicles are located by the asterisk and apposing plasma membranes indicated by an arrow. Scale bars are shown in black. (C,D) Quantification of pre-fusion complexes (PFCs) and electron-dense vesicles in late stage 12/early stage 13 wild-type, blow and sing mutant embryonic myoblasts. (C) The number of myoblasts having a pre-fusion complex varied significantly among genotypes (F2,98= 27.16, P<0.0001), with sing embryos showing more myoblasts with pre-fusion complexes (48% ± 2.6 SE) than either wild-type or blow embryos, which did not differ from one another (22% ± 2.3 and 21% ± 3, respectively). (D) The number of vesicles per pre-fusion complex varied slightly but significantly among genotypes (F2,98=10.64, P<0.0001), with sing showing more vesicles (1.63 ± 0.07 SE) per pre-fusion complex than either wild-type or blow, which did not differ from one another (1.37 ± 0.06 and 1.23 ± 0.08, respectively). p-values shown indicate pairwise post-hoc contrasts between wild-type and each mutant genotype.

To verify that the higher number of pre-fusion complexes observed in sing embryos was not simply due to a larger number of myoblasts blocked in the process of fusing—which might reflect a general defect of all fusion mutations—we quantified this number in another fusion mutant. For this purpose, we chose blow because this mutant, like sing, also has groups of adhering myoblasts that fail to complete fusion, and because blow is thought to be required for progression beyond the pre-fusion complex step (Doberstein et al., 1997). We observed that 21% of blow mutant myoblasts contain pre-fusion complexes, a value that is not statistically different from what is seen in wild-type embryos (P=0.93; Fig. 4C).

In addition, we quantified the total number of vesicles observed per pre-fusion complex and found that sing embryos contained slightly—but statistically significantly (P < 0.002)—more vesicles per pre-fusion complex than either wild-type or blow embryos (Fig. 4D).

A few electron-dense plaques were observed in all three genotypes, but the numbers were insufficient for a quantitative analysis to be feasible. It is also likely that the few plaques that were observed in these fusion mutants correspond to those occurring during the first round of fusion, which takes place entirely normally in sing mutants and very frequently in blow mutants (Fig. 3L, K) (Menon et al., 2005; Schroter et al., 2004). Thus, the presence of small numbers of electron-dense plaques in sing and blow embryos was not considered to be indicative of the ability of pre-fusion complexes formed in later rounds of fusion to progress to plaque formation in these mutants.

Collectively, the present phenotypic findings suggest that sing acts at a step different from that of blow, and that Sing is required on both FC and FCM membranes to allow progression past the pre-fusion complex stage of myoblast fusion in the rounds of myoblast fusion that follow initial muscle precursor formation. The fact that blow is only expressed in FCMs (Artero et al., 2003; Estrada et al., 2006; Kesper et al., 2007; Schroter et al., 2006) whereas sing is expressed in all myoblasts (Fig. 1), is consistent with the idea that blow and sing act differently during fusion.

Discussion

Myoblast fusion is an essential process by which multinucleated muscles develop, grow and undergo repair. A better understanding of the molecular mechanisms underlying myoblast fusion could improve current attempts to use cell fusion as a therapy for muscle degenerative disorders and for aging-related myopathies (Charge and Rudnicki, 2004; Vassilopoulos and Russell, 2003).

We have identified a new gene that is critical for myoblast fusion in Drosophila. The gene, sing, encodes a MARVEL domain protein which is characterized by four transmembrane helix regions. sing is expressed in both types of embryonic myoblasts, founder cells and fusion-competent myoblasts. Inactivation of sing, either by RNAi or by point mutations in the coding region, leads to failure of myoblast fusion. The initial attraction, recognition and adhesion of myoblasts are not impaired, but the later events of myoblast fusion fail to ensue. Ultrastructural analysis of fusing embryonic myoblasts revealed that sing is required for progression past the pre-fusion complex stage of myoblast fusion. However, sing acts differently than blow, another gene known to be implicated in this fusion step. Whereas electron-dense vesicles accumulated in sing mutant embryos, this defect did not occur in the absence of blow, which is thought to be required for the normal function of the pre-fusion complex, possibly as an enzymatic component of a signaling cascade (Doberstein et al., 1997). The fact that no accumulation of pre-fusion complexes was observed in blow mutants (Doberstein et al., 1997 and our own observations) is consistent with the hypothesis that pre-fusion complexes disappear later during embryogenesis due to their inactivity (Doberstein et al., 1997). The observed differences between blow and sing mutant phenotypes, combined with their differential myoblast expression (blow is only in FCMs whereas sing is in both FCs and FCMs), suggest that Blow and Sing have different mechanisms of action. Despite Sing being a transmembrane domain protein, the present findings indicate that it is not involved in the recognition or adhesion between myoblasts, unlike other membrane proteins involved in fusion, such as Duf, Sns, Rst and Hbs (Artero et al., 2001; Bour et al., 2000; Dworak et al., 2001; Galletta et al., 2004; Ruiz-Gomez et al., 2000; Strunkelnberg et al., 2001).

Given the identity of the encoded protein and the nature of the loss-of-function phenotype observed, we propose that sing could be required for fusion of the electron-dense vesicles to the plasma membrane and thus for the localization of other key components of the fusion machinery to the site of membrane fusion. We favor the hypothesis that vesicles need to fuse to the plasma membrane in order to release other important molecules for fusion to proceed, and that Sing is involved in this process. However, our results do not rule out several other possibilities. For example, the accumulation of vesicles in sing mutant embryos could be caused not only by the failure of vesicles to fuse to the plasma membrane, but also by an abnormal over-production of vesicles or by a failure of vesicle recycling within the fusing myoblasts.

Whatever the actual mechanism involved, the following observations must be taken into account. (1) sing mutant embryos possess a significantly higher number of pre-fusion complexes and vesicles per pre-fusion complex, indicating that vesicles accumulate at the myoblast plasma membrane when Sing function is blocked. (2) sing is expressed in both of the fusing myoblasts, reflecting its potential involvement in pre-fusion complexes, which are inherently symmetrical since they comprise paired vesicles on both sides of the fusing membranes. Indeed, it has previously been proposed that the structure of pre-fusion complexes necessitates that some of the membrane proteins and lipids of the two myoblast plasma membranes must be nearly identical (Doberstein et al., 1997). (3) The material found in vesicles and in the electron-dense plaques originally described by Doberstein et al. is similar, consistent with the idea that vesicles must fuse with the plasma membrane. (4) MARVEL domain proteins in mammals are involved in membrane apposition events, such as tight junction formation and vesicular trafficking (Sanchez-Pulido et al., 2002). In particular, the human MAL protein is thought to be part of the machinery regulating the remodeling of the lipids that are necessary for biogenesis of exocytic and endocytic vesicles (Martin-Belmonte et al., 2003; Puertollano et al., 1997; Puertollano et al., 1999). Also, the gyrin and physin family MARVEL proteins are components of several types of transport vesicles (Sanchez-Pulido et al., 2002), which suggests that Sing could be a functional component of vesicles required for myoblast fusion. Further work will be required to distinguish among these different possibilities for the mechanism by which Sing participates in myoblast fusion.

In addition to or instead of a transport role for the electron-dense vesicles, these organelles could have a structural function. For example, they might serve as anchors for the cytoskeleton. The fact that cytoskeleton mutants such as kette contain pre-fusion complexes and proceed from that stage to form abnormally long plaques would suggest that they are required later than sing during fusion.

Myoblast fusion is the least well-known membrane fusion process. The molecular mechanisms of intracellular fusion and viral-cell fusion are better understood. Interestingly, none of the known myoblast fusion proteins presents a hydrophobic fusion peptide capable of forming alpha-helical bundles, as is found in the other types of fusion (Chen and Olson, 2005). Menon et al. (2005) proposed that the TPR/coiled-coil domain present in Rols could be mediating fusion between the Rols-carrying vesicles and the FC plasma membrane. The early requirement of Rols during fusion, and the absence of pre-fusion complexes in rols mutants, make it difficult to asses if Rols has a later role during fusion other than mediating the translocation of Duf and Titin to the FC plasma membrane.

Examining the predicted amino acid sequence of Sing, we identified a highly hydrophobic region between the third and fourth transmembrane helices that could possibly mediate membrane apposition between the electron-dense vesicles and the plasma membrane in both fusing myoblasts. To our knowledge, no vertebrate MARVEL protein has been implicated in myoblast fusion. There is, however, a transmembrane protein, caveolin-3, which is expressed in cardiac and skeletal muscle, is required for mammalian myoblast fusion, and is the principal component of caveolae, invaginations of the plasma membrane involved in vesicular trafficking and signal transduction (Galbiati et al., 1999; Song et al., 1996). Since there are no caveolin homologs in Drosophila and no MARVEL proteins related to myoblast fusion in vertebrates, it is possible that Sing plays a similar role as caveolins in the formation of lipid rafts in Drosophila myoblasts. This could provide an explanation for how the cellular and molecular processes in myoblast fusion are conserved between vertebrates and Drosophila even though the proteins involved are not identical. Indeed, it has been proposed that the common features between different fusion systems, such as viral and cellular fusion, are based on shared properties of membrane lipids rather than on specific features of the proteins involved (Chernomordik and Kozlov, 2005). Nevertheless, it will be interesting to determine if any of the MARVEL domain proteins in vertebrates has a function in myoblast fusion.

Supplementary Material

01

Supplementary Figure 1. Sing is not required to translocate Rols or Duf to the site of membrane fusion. (A-D) Immunostaining of stage 13-14 embryos with Kruppel (green) and Rols (red) antibodies. In both wild-type and sing mutant embryos, Rols translocates from a dispersed localization in the cytoplasm to form aggregates at sites of membrane fusion (Menon et al 2001, and arrowhead in A and B). However, the amount of Rols aggregation in fusion spots is much higher in sing than in wild-type embryos (compare B to A). Interestingly, the amount of aggregation in blow and mbc embryos is also higher (C and D). (E-I) Immunostaining of stage 15/ early 16 embryos with Duf/Rst (green) and MHC (red) antibodies. Duf/Rst levels in fusing wild-type myoblasts are undetectable with existing antibodies (E-G, Galletta et al 2004, and Menon et al 2005), but visible in some fusion mutants, due to abnormal accumulation of the protein (Menon et al 2005). Both blow and sing mutants localize and accumulate high levels of Duf at the site of membrane fusion (arrowheads, E and F).

Acknowledgements

We would like to thank Cliff Sonnenbrot for technical assistance and Miguel Angel Alonso for helpful discussions throughout the project. We thank Ivan Gomez-Mestre for help with the statistical analysis, Richard Fetter for illuminating suggestions in fixing the embryos for electron microscopy, and Elizabeth Benecchi and Maria Ericsson for help with the electron microscope. We are grateful to D. Menon, S. Abmayr, R. Renkawitz-Pohl, H. Nguyen, D. Kosman, D. Kiehart, J. Skeath, M. Frasch, N. Perrimon, S. Doberstein and E. Chen for fly stocks and reagents. This work was supported by the Howard Hughes Medical Institute and the National Institutes of Health. ADM and NHB were supported by grants from the Wellcome Trust (43015 & 31315).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Artero R, Furlong EE, Beckett K, Scott MP, Baylies M. Notch and Ras signaling pathway effector genes expressed in fusion competent and founder cells during Drosophila myogenesis. Development. 2003;130:6257–72. doi: 10.1242/dev.00843. [DOI] [PubMed] [Google Scholar]
  2. Artero RD, Castanon I, Baylies MK. The immunoglobulin-like protein Hibris functions as a dose-dependent regulator of myoblast fusion and is differentially controlled by Ras and Notch signaling. Development. 2001;128:4251–64. doi: 10.1242/dev.128.21.4251. [DOI] [PubMed] [Google Scholar]
  3. Bate M. The embryonic development of larval muscles in Drosophila. Development. 1990;110:791–804. doi: 10.1242/dev.110.3.791. [DOI] [PubMed] [Google Scholar]
  4. Baylies MK, Michelson AM. Invertebrate myogenesis: looking back to the future of muscle development. Curr. Opin. Genet. Dev. 2001;11:431–439. doi: 10.1016/s0959-437x(00)00214-8. [DOI] [PubMed] [Google Scholar]
  5. Bloor JW, Brown NH. Genetic analysis of the Drosophila alphaPS2 integrin subunit reveals discrete adhesive, morphogenetic and sarcomeric functions. Genetics. 1998;148:1127–42. doi: 10.1093/genetics/148.3.1127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bour BA, Chakravarti M, West JM, Abmayr SM. Drosophila SNS, a member of the immunoglobulin superfamily that is essential for myoblast fusion. Genes & Dev. 2000;14:1498–1511. [PMC free article] [PubMed] [Google Scholar]
  7. Brown NH. Null mutations in the alpha PS2 and beta PS integrin subunit genes have distinct phenotypes. Development. 1994;120:1221–31. doi: 10.1242/dev.120.5.1221. [DOI] [PubMed] [Google Scholar]
  8. Carmena A, Buff E, Halfon MS, Gisselbrecht S, Jimenez F, Baylies MK, Michelson AM. Reciprocal regulatory interactions between the Notch and Ras signaling pathways in the Drosophila embryonic mesoderm. Dev Biol. 2002;244:226–242. doi: 10.1006/dbio.2002.0606. [DOI] [PubMed] [Google Scholar]
  9. Carmena A, Gisselbrecht S, Harrison J, Jiménez F, Michelson AM. Combinatorial signaling codes for the progressive determination of cell fates in the Drosophila embryonic mesoderm. Genes Dev. 1998;12:3910–3922. doi: 10.1101/gad.12.24.3910. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Charge SB, Rudnicki MA. Cellular and molecular regulation of muscle regeneration. Physiol Rev. 2004;84:209–38. doi: 10.1152/physrev.00019.2003. [DOI] [PubMed] [Google Scholar]
  11. Chen EH, Olson EN. Antisocial, an intracellular adaptor protein, is required for myoblast fusion in Drosophila. Dev Cell. 2001;1:705–715. doi: 10.1016/s1534-5807(01)00084-3. [DOI] [PubMed] [Google Scholar]
  12. Chen EH, Olson EN. Towards a molecular pathway for myoblast fusion in Drosophila. Trends Cell Biol. 2004;14:452–60. doi: 10.1016/j.tcb.2004.07.008. [DOI] [PubMed] [Google Scholar]
  13. Chen EH, Olson EN. Unveiling the mechanisms of cell-cell fusion. Science. 2005;308:369–73. doi: 10.1126/science.1104799. [DOI] [PubMed] [Google Scholar]
  14. Chen EH, Pryce BA, Tzeng JA, Gonzalez GA, Olson EN. Control of myoblast fusion by a guanine nucleotide exchange factor, loner, and its effector ARF6. Cell. 2003;114:751–62. doi: 10.1016/s0092-8674(03)00720-7. [DOI] [PubMed] [Google Scholar]
  15. Chernomordik LV, Kozlov MM. Membrane hemifusion: crossing a chasm in two leaps. Cell. 2005;123:375–82. doi: 10.1016/j.cell.2005.10.015. [DOI] [PubMed] [Google Scholar]
  16. Conover WJ, Iman RL. Rank transformations as a bridge between parametric and nonparametric statistics. American Statistician. 1981;35:124–129. [Google Scholar]
  17. Corbin V, Michelson AM, Abmayr SM, Neel V, Alcamo E, Maniatis T, Young MW. A role for the Drosophila neurogenic genes in mesoderm differentiation. Cell. 1991;67:311–323. doi: 10.1016/0092-8674(91)90183-y. [DOI] [PubMed] [Google Scholar]
  18. Doberstein SK, Fetter RD, Mehta AY, Goodman CS. Genetic analysis of myoblast fusion: Blown fuse is required for progression beyond the prefusion complex. J Cell Biol. 1997;136:1249–1261. doi: 10.1083/jcb.136.6.1249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Drysdale R, Rushton E, Bate M. Genes Required for Embryonic Muscle Development in Drosophila-Melanogaster - A Survey of the X-Chromosome. Roux Arch Devel Biol. 1993;202:276–295. doi: 10.1007/BF00363217. [DOI] [PubMed] [Google Scholar]
  20. Duan H, Skeath JB, Nguyen HT. Drosophila Lame duck, a novel member of the Gli superfamily, acts as a key regulator of myogenesis by controlling fusion-competent myoblast development. Development. 2001;128:4489–4500. doi: 10.1242/dev.128.22.4489. [DOI] [PubMed] [Google Scholar]
  21. Dworak HA, Charles MA, Pellerano LB, Sink H. Characterization of Drosophila hibris, a gene related to human nephrin. Development. 2001;128:4265–76. doi: 10.1242/dev.128.21.4265. [DOI] [PubMed] [Google Scholar]
  22. Engel LC, Egar MW, Przybylski RJ. Morphological characterization of actively fusing L6 myoblasts. Eur J Cell Biol. 1986;39:360–5. [PubMed] [Google Scholar]
  23. Erickson MRS, Galletta BJ, Abmayr SM. Drosophila myoblast city encodes a conserved protein that is essential for myoblast fusion, dorsal closure and cytoskeletal organization. J. Cell Biol. 1997;138:589–603. doi: 10.1083/jcb.138.3.589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Estrada B, Choe SE, Gisselbrecht SS, Michaud S, Raj L, Busser BW, Halfon MS, Church GM, Michelson AM. An Integrated Strategy for Analyzing the Unique Developmental Programs of Different Myoblast Subtypes. PLoS Genet. 2006;2:e16. doi: 10.1371/journal.pgen.0020016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Frasch M, Hoey T, Rushlow C, Doyle H, Levine M. Characterization and localization of the even-skipped protein of Drosophila. EMBO J. 1987;6:749–759. doi: 10.1002/j.1460-2075.1987.tb04817.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Furlong EE. Integrating transcriptional and signalling networks during muscle development. Curr Opin Genet Dev. 2004;14:343–50. doi: 10.1016/j.gde.2004.06.011. [DOI] [PubMed] [Google Scholar]
  27. Furlong EE, Andersen EC, Null B, White KP, Scott MP. Patterns of gene expression during Drosophila mesoderm development. Science. 2001;293:1629–33. doi: 10.1126/science.1062660. [DOI] [PubMed] [Google Scholar]
  28. Galbiati F, Volonte D, Minetti C, Chu JB, Lisanti MP. Phenotypic behavior of caveolin-3 mutations that cause autosomal dominant limb girdle muscular dystrophy (LGMD-1C). Retention of LGMD-1C caveolin-3 mutants within the golgi complex. J Biol Chem. 1999;274:25632–41. doi: 10.1074/jbc.274.36.25632. [DOI] [PubMed] [Google Scholar]
  29. Galletta BJ, Chakravarti M, Banerjee R, Abmayr SM. SNS: Adhesive properties, localization requirements and ectodomain dependence in S2 cells and embryonic myoblasts. Mech Dev. 2004;121:1455–68. doi: 10.1016/j.mod.2004.08.001. [DOI] [PubMed] [Google Scholar]
  30. Gisselbrecht S, Skeath JB, Doe CQ, Michelson AM. Heartless encodes a fibroblast growth factor receptor (DFR1/DFGF-R2) involved in the directional migration of early mesodermal cells in the Drosophila embryo. Genes Dev. 1996;10:3003–3017. doi: 10.1101/gad.10.23.3003. [DOI] [PubMed] [Google Scholar]
  31. Greig S, Akam M. Homeotic genes autonomously specify one aspect of pattern in the Drosophila mesoderm. Nature. 1993;362:630–632. doi: 10.1038/362630a0. [DOI] [PubMed] [Google Scholar]
  32. Halfon MS, Carmena A, Gisselbrecht S, Sackerson CM, Jiménez F, Baylies MK, Michelson AM. Ras pathway specificity is determined by the integration of multiple signal-activated and tissue-restricted transcription factors. Cell. 2000;103:63–74. doi: 10.1016/s0092-8674(00)00105-7. [DOI] [PubMed] [Google Scholar]
  33. Halfon MS, Gisselbrecht S, Lu J, Estrada B, Keshishian H, Michelson AM. New fluorescent protein reporters for use with the Drosophila Gal4 expression system and for vital detection of balancer chromosomes. Genesis. 2002;34:135–138. doi: 10.1002/gene.10136. [DOI] [PubMed] [Google Scholar]
  34. Hall A. Rho GTPases and the actin cytoskeleton. Science. 1998;279:509–14. doi: 10.1126/science.279.5350.509. [DOI] [PubMed] [Google Scholar]
  35. Horsley V, Pavlath GK. Forming a multinucleated cell: molecules that regulate myoblast fusion. Cells Tissues Organs. 2004;176:67–78. doi: 10.1159/000075028. [DOI] [PubMed] [Google Scholar]
  36. Kesper DA, Stute C, Buttgereit D, Kreiskother N, Vishnu S, Fischbach KF, Renkawitz-Pohl R. Myoblast fusion in Drosophila melanogaster is mediated through a fusion-restricted myogenic-adhesive structure (FuRMAS) Dev Dyn. 2007;236:404–15. doi: 10.1002/dvdy.21035. [DOI] [PubMed] [Google Scholar]
  37. Knirr S, Frasch M. Molecular integration of inductive and mesoderm-intrinsic inputs governs even-skipped enhancer activity in a subset of pericardial and dorsal muscle progenitors. Developmental Biology. 2001;238:13–26. doi: 10.1006/dbio.2001.0397. [DOI] [PubMed] [Google Scholar]
  38. Kosman D, Small S, Reinitz J. Rapid preparation of a panel of polyclonal antibodies to Drosophila segmentation proteins. Dev Genes Evol. 1998;208:290–4. doi: 10.1007/s004270050184. [DOI] [PubMed] [Google Scholar]
  39. Lieber T, Kidd S, Alcamo E, Corbin V, Young MW. Antineurogenic phenotypes induced by truncated Notch proteins indicate a role in signal transduction and may point to a novel function for Notch in nuclei. Genes and Development. 1993;7:1949–1965. doi: 10.1101/gad.7.10.1949. [DOI] [PubMed] [Google Scholar]
  40. Lin DM, Fetter RD, Kopczynski C, Grenningloh G, Goodman CS. Genetic analysis of Fasciclin II in Drosophila: defasciculation, refasciculation, and altered fasciculation. Neuron. 1994;13:1055–69. doi: 10.1016/0896-6273(94)90045-0. [DOI] [PubMed] [Google Scholar]
  41. Lipton BH, Konigsberg IR. A fine-structural analysis of the fusion of myogenic cells. J Cell Biol. 1972;53:348–64. doi: 10.1083/jcb.53.2.348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Marden JI, Muyot MET. Rank tests for main and interaction effects in analysis of variance. Journal of the American Statistical Association. 1995;90:1388–1398. [Google Scholar]
  43. Martin-Belmonte F, Martinez-Menarguez JA, Aranda JF, Ballesta J, de Marco MC, Alonso MA. MAL regulates clathrin-mediated endocytosis at the apical surface of Madin-Darby canine kidney cells. J Cell Biol. 2003;163:155–64. doi: 10.1083/jcb.200304053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Menon SD, Chia W. Drosophila Rolling pebbles: a multidomain protein required for myoblast fusion that recruits D-Titin in response to the myoblast attractant Dumbfounded. Dev Cell. 2001;1:691–703. doi: 10.1016/s1534-5807(01)00075-2. [DOI] [PubMed] [Google Scholar]
  45. Menon SD, Osman Z, Chenchill K, Chia W. A positive feedback loop between Dumbfounded and Rolling pebbles leads to myotube enlargement in Drosophila. J Cell Biol. 2005;169:909–20. doi: 10.1083/jcb.200501126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Michelson AM, Gisselbrecht S, Buff E, Skeath JB. Heartbroken is a specific downstream mediator of FGF receptor signalling in Drosophila. Development. 1998;125:4379–4389. doi: 10.1242/dev.125.22.4379. [DOI] [PubMed] [Google Scholar]
  47. Nose A, Isshiki T, Takeichi M. Regional specification of muscle progenitors in Drosophila: the role of the msh homeobox gene. Development. 1998;125:215–223. doi: 10.1242/dev.125.2.215. [DOI] [PubMed] [Google Scholar]
  48. Puertollano R, Li S, Lisanti MP, Alonso MA. Recombinant expression of the MAL proteolipid, a component of glycolipid-enriched membrane microdomains, induces the formation of vesicular structures in insect cells. J Biol Chem. 1997;272:18311–5. doi: 10.1074/jbc.272.29.18311. [DOI] [PubMed] [Google Scholar]
  49. Puertollano R, Martin-Belmonte F, Millan J, de Marco MC, Albar JP, Kremer L, Alonso MA. The MAL proteolipid is necessary for normal apical transport and accurate sorting of the influenza virus hemagglutinin in Madin-Darby canine kidney cells. J Cell Biol. 1999;145:141–51. doi: 10.1083/jcb.145.1.141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Rash JE, Fambrough D. Ultrastructural and electrophysiological correlates of cell coupling and cytoplasmic fusion during myogenesis in vitro. Dev Biol. 1973;30:166–86. doi: 10.1016/0012-1606(73)90055-9. [DOI] [PubMed] [Google Scholar]
  51. Rau A, Buttgereit D, Holz A, Fetter R, Doberstein SK, Paululat A, Staudt N, Skeath JB, Michelson AM, Renkawitz-Pohl R. rolling pebbles (rols) is required in Drosophila muscle precursors fo recruitment of myoblasts for fusion. Development. 2001;128:5061–5073. doi: 10.1242/dev.128.24.5061. [DOI] [PubMed] [Google Scholar]
  52. Ruiz-Gomez M, Coutts N, Price A, Taylor MV, Bate M. Drosophila dumbfounded: a myoblast attractant essential for fusion. Cell. 2000;102:189–98. doi: 10.1016/s0092-8674(00)00024-6. [DOI] [PubMed] [Google Scholar]
  53. Ruiz-Gomez M, Coutts N, Suster ML, Landgraf M, Bate M. myoblasts incompetent encodes a zinc finger transcription factor required to specify fusion-competent myoblasts in Drosophila. Development. 2002;129:133–41. doi: 10.1242/dev.129.1.133. [DOI] [PubMed] [Google Scholar]
  54. Ruiz-Gomez M, Romani S, Hartmann C, Jackle H, Bate M. Specific muscle identities are regulated by Kruppel during Drosophila embryogenesis. Development. 1997;124:3407–14. doi: 10.1242/dev.124.17.3407. [DOI] [PubMed] [Google Scholar]
  55. Rushton E, Drysdale R, Abmayr SM, Michelson AM, Bate M. Mutations in a novel gene, myoblast city, provide evidence in support of the founder cell hypothesis for Drosophila muscle development. Development. 1995;121:1979–1988. doi: 10.1242/dev.121.7.1979. [DOI] [PubMed] [Google Scholar]
  56. Sanchez-Pulido L, Martin-Belmonte F, Valencia A, Alonso MA. MARVEL: a conserved domain involved in membrane apposition events. Trends Biochem Sci. 2002;27:599–601. doi: 10.1016/s0968-0004(02)02229-6. [DOI] [PubMed] [Google Scholar]
  57. Schroter RH, Buttgereit D, Beck L, Holz A, Renkawitz-Pohl R. Blown fuse regulates stretching and outgrowth but not myoblast fusion of the circular visceral muscles in Drosophila. Differentiation. 2006;74:608–21. doi: 10.1111/j.1432-0436.2006.00080.x. [DOI] [PubMed] [Google Scholar]
  58. Schroter RH, Lier S, Holz A, Bogdan S, Klambt C, Beck L, Renkawitz-Pohl R. kette and blown fuse interact genetically during the second fusion step of myogenesis in Drosophila. Development. 2004;131:4501–9. doi: 10.1242/dev.01309. [DOI] [PubMed] [Google Scholar]
  59. Sokal R. R. a. R., F.J. “Biometry.”. 1995 [Google Scholar]
  60. Song KS, Scherer PE, Tang Z, Okamoto T, Li S, Chafel M, Chu C, Kohtz DS, Lisanti MP. Expression of caveolin-3 in skeletal, cardiac, and smooth muscle cells. Caveolin-3 is a component of the sarcolemma and co-fractionates with dystrophin and dystrophin-associated glycoproteins. J Biol Chem. 1996;271:15160–5. doi: 10.1074/jbc.271.25.15160. [DOI] [PubMed] [Google Scholar]
  61. Strunkelnberg M, Bonengel B, Moda LM, Hertenstein A, de Couet HG, Ramos RG, Fischbach KF. rst and its paralogue kirre act redundantly during embryonic muscle development in Drosophila. Development. 2001;128:4229–39. doi: 10.1242/dev.128.21.4229. [DOI] [PubMed] [Google Scholar]
  62. Vassilopoulos G, Russell DW. Cell fusion: an alternative to stem cell plasticity and its therapeutic implications. Curr Opin Genet Dev. 2003;13:480–5. doi: 10.1016/s0959-437x(03)00110-2. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01

Supplementary Figure 1. Sing is not required to translocate Rols or Duf to the site of membrane fusion. (A-D) Immunostaining of stage 13-14 embryos with Kruppel (green) and Rols (red) antibodies. In both wild-type and sing mutant embryos, Rols translocates from a dispersed localization in the cytoplasm to form aggregates at sites of membrane fusion (Menon et al 2001, and arrowhead in A and B). However, the amount of Rols aggregation in fusion spots is much higher in sing than in wild-type embryos (compare B to A). Interestingly, the amount of aggregation in blow and mbc embryos is also higher (C and D). (E-I) Immunostaining of stage 15/ early 16 embryos with Duf/Rst (green) and MHC (red) antibodies. Duf/Rst levels in fusing wild-type myoblasts are undetectable with existing antibodies (E-G, Galletta et al 2004, and Menon et al 2005), but visible in some fusion mutants, due to abnormal accumulation of the protein (Menon et al 2005). Both blow and sing mutants localize and accumulate high levels of Duf at the site of membrane fusion (arrowheads, E and F).

NIHMS27349-supplement-01.tif (2.3MB, tif)

RESOURCES