Abstract
What is already known about this subject
There is an ongoing debate regarding the effect of renal impairment on CYP related metabolic activities.
The possible effect of renal impairment on hepatic CYP2B6 activity, or on bupropion pharmacokinetics in renally impaired subjects without dialysis treatment has not yet been investigated.
What this study adds
Bupropion clearance was found to be significantly decreased in patients with renal impairment.
This study provides further evidence for interplay between the role of the kidney and liver in drug disposition, and opens novel lines of research with respect to the regulation of CYP2B6.
Aims
To investigate the effect of kidney disease on bupropion pharmacokinetics and on cytochrome P450 (CYP) 2B6 activity as measured by bupropion hydroxylation.
Methods
In an open parallel group study, 17 healthy, nonsmoking subjects and 10 patients with impaired kidney function received a single 150 mg oral dose of sustained release bupropion. Plasma concentrations of bupropion and its metabolites were measured for up to 72 h. Subjects were genotyped for the CYP2B6 SNPs 1459 C>T, 785 A>G and 516 G>T.
Results
Bupropion AUC was 126% higher (P< 0.0001, 95% CI +72%, +180%), Cmax 86% higher (P = 0.001, 95% CI +40%, +131%), CL/F 63% lower (P = 0.001, 95% CI −29%, −96%), and t1/2 140% longer (P = 0.001, 95% CI +76%, +204%) in renally impaired patients. However, only minor changes were detected in the concentrations of the metabolites. In renally impaired subjects the hydroxybupropion : bupropion AUC ratio was decreased by 66% (P = < 0.0001, 95% CI −19%, −114%) and the hydrobupropion : bupropion AUC ratio by 69% (P = 0.001, 95% CI +8%, −146%) compared with controls.
Conclusions
The CL/F of bupropion was significantly lower in subjects with renal impairment. Because the principal metabolites of bupropion possess similar pharmacological activity to the parent compound, dosage recommendations for patients with renal impairment cannot be given. A direct effect of renal impairment on CYP2B6 activity could not be demonstrated by the present study design.
Keywords: bupropion, cytochrome P450, pharmacokinetics, renal failure
Introduction
Bupropion (INN, amfebutamone) is a monocyclic aminoketone used in smoking cessation and as an antidepressant. It is extensively metabolized in humans, mainly to hydroxybupropion and to a lesser extent to the isomers, erythro- and threohydrobupropion. Hepatic clearance is the major determinant of bupropion elimination and the fraction of an oral dose excreted unchanged in the urine is only about 0.5% [1, 2]. In vitro studies show that hydroxybupropion is predominantly formed by hepatic cytochrome P450 2B6 (CYP2B6) [3, 4] and the hydrometabolites via the ketone reduction pathway [5]. Therefore, bupropion hydroxylation has been suggested to be a selective marker for CYP2B6 activity [3, 4, 6]. Several single nucleotide polymorphisms (SNPs) within the CYP2B6 gene, e.g. CYP2B6*4 and CYP2B6*6, have been reported to have functional consequences [7, 8].
Kidney function is the major determinant of the pharmacokinetics of drugs that are eliminated principally by renal excretion. However, there is evidence that compromised kidney function might lead to effects on other clearance mechanisms, including metabolism by the liver [9]. Recent studies have demonstrated that some CYP enzymes are down regulated in kidney disease, although to a variable extent depending on the enzyme invloved. Thus, studies have suggested that the activities of CYP2C9 and CYP3A4, measured by the warfarin S : R ratio and the erythromycin breath test, respectively, are significantly decreased patients with severe or end-stage renal disease [10, 11]. In addition, selegiline (l-deprenyl) elimination, which is solely dependent on hepatic metabolism [12, 13], was markedly decreased in patients with chronic kidney disease, even though their liver function tests were within the reference range [14].
The risk of convulsions during bupropion is increased in a dose-dependent manner, and the risk of central nervous system toxicity associated with bupropion as a result of interactions with other drugs, may be of clinical importance [15, 16]. The results obtained from a recent study in patients with renal impairment who smoked and underwent haemodialysis suggested significant accumulation of bupropion metabolites and the need for dose adjustment [17]. However, studies exploring the pharmacokinetics of bupropion in nonsmoking renal-impaired subjects who are not on dialysis have not been carried out. Furthermore, the possible effect of renal impairment on hepatic CYP2B6 activity has not been investigated. Thus, the aim of this study was to define the effect of kidney disease on the pharmacokinetics of bupropion and its metabolites, and by implication, on CYP2B6 activity.
Methods
Subjects and ethical aspects
This study was carried out in 17 healthy, nonsmoking subjects (five female and 12 men) and 10 patients with impaired kidney function (five female and five men) (Table 1). The subjects were ascertained to be in good health by medical history, a full clinical examination and standard haematological and blood chemistry laboratory tests before enrolment. Pregnancy was excluded by a serum hCG test. Patients with kidney disease had stable, long-term renal impairment with an elevated serum creatinine concentration and a decreased glomerular filtration rate (eGFR; <60 ml min−1) according to the Cockcroft-Gault equation (The eGFR was corrected in women by multiplying by 0.85):
Table 1.
General characteristics of the participants
| Subjects | Control | Impaired kidney function | anova (P value) |
|---|---|---|---|
| Gender (female/male) | 5/12 | 5/5 | – |
| Age (years) | |||
| Mean ± SD | 27.3 ± 9.3 | 39.6 ± 3.8 | 0.001 |
| Range | 21–50 | 32–43 | – |
| Weight (kg) | 73.9 ± 8.9 | 78.2 ± 18.6 | NS |
| Height (cm) | 177 ± 0.08 | 172 ± 0.08 | NS |
| BMI (kg m−2) | 23.5 ± 2.0 | 26.4 ± 5.3 | NS |
| eGFR* (ml min−1) | 119 ± 14.9 | 30.9 ± 10.8 | <0.0001 |
| fP-Creatinine (µmol l−1) | 86.1 ± 16.1 | 317 ± 99.2 | <0.0001 |
| P-ALT (U l−1) | 20.1 ± 8.1 | 20.2 ± 9.9 | NS |
| P-Alb (g l−1) | – | 38.4 ± 5.1 | – |
The results are presented as mean ± SD. BMI, body mass index; eGFR, estimated glomerular filtration rate; fP, fasting plasma; P, plasma; ALT, alanine aminotransferase; Alb, albumin. NS, not significant.
Calculated from the equation of Cockcroft-Gault.
 |
Liver function test results were within the normal range in all subjects and patients and none had had peritoneal dialysis or haemodialysis treatment. None of the healthy subjects was using oral contraceptives, hormone replacement therapy, or any other chronic medication. The concomitant medication taken by the patient group did not include any known inhibitors or inducers of CYP2B6 [18, 19]. The use of natural products was not allowed in either group. One of the patients with kidney disease smoked occasionally, but stopped for 8 days before and during the study period. All the healthy subjects and patients gave their written informed consent prior to the study, which was designed and monitored in accordance with Good Clinical Practice and the Declaration of Helsinki. The study protocol was approved by the Ethics Committee of the Varsinais-Suomi healthcare district, Finland and by the Finnish National Agency for Medicines.
Study design
An open parallel group study was performed, in which all subjects and patients received a single 150 mg oral dose of bupropion administered with 100 ml of water (Zyban sustained release, 150 mg, GlaxoSmithKline, Uxbridge, UK). Venous blood samples (10 ml) for the determination of bupropion, hydroxybupropion and hydrobupropion, were taken from a forearm cannula prior to drug administration and 1, 2, 3, 4, 5, 6, 8, and 12 h later. Blood samples 24, 48, and 72 h after dosing were drawn into vacuum blood collection tubes. All blood samples were collected into tubes containing lithium-heparin anticoagulant and centrifuged for 10 min at 1600 g. Plasma was separated and stored at −70°C until analyzed.
The study was conducted in a single centre (University of Turku, Department. of Pharmacology and Clinical Pharmacology) and participants were under direct medical supervision during the study. The subjects and patients fasted for 8 h before and 4 h after administration of bupropion. They were also required to refrain from strenuous physical exercise, alcohol- or caffeine-containing drinks and grapefruit juice for 2 days before and after the study.
CYP2B6 genotyping
The subjects and patients were genotyped with respect to the CYP2B6 SNPs 1459 C>T and 516 G>T using a 5′ nuclease assay with an ABI PRISM 7700 sequence detection system (Applied Biosystems, Warrington, Cheshire, UK) described previously [20]. Briefly, extraction and purification of DNA was performed using the PUREGENE® DNA purification kit (Gentra Systems, Minneapolis, MN) according to the manufacturer's instructions. The CYP2B6 516 G>T mutation was identified using the primers cttcttcctaggggccctca and ggtagtggaatcgttttccaaagac and the minor groove binder dark quencher probes 6-FAM-cttcctcttccaGtcca and VIC cctcttccaTtccatt (Applied Biosystems, Warrington, Cheshire, UK). The CYP2B6 1459 C>T assay was performed with the primers ggccccagaagacatcgat and cttccctcagccccttcag, and 6-FAM-cagatcTgcttcctg and VIC-cagatcCgcttcct MGB dark quencher probes. Screening for the SNP 785 A>G was performed by amplifying a DNA-sequence with primers gctctctccctgtgacctgcta (forward) and ccctttccctattctcccctc (reverse), and sequencing the amplified product using the same primers.
Analysis of bupropion and metabolites
The plasma samples were thawed and 800 µl was mixed with 200 µl of acetonitrile containing 700 ng ml−1 phenacetin (ICN Biomedicals Inc., Costa Mesa, CA, USA) as internal standard and centrifuged for 10 min at 12200 g. These samples were extracted with Oasis HLB (10 mg) 96-well solid phase extraction plates (Waters Corp., Milford, MA, USA), by loading 700 µl sample into plates activated with 1 ml of methanol and equilibrated with 1 ml of water. The plates were then washed with 700 µl water and the analytes were eluted with 500 µl of acetonitrile. After dilution 1 : 1 with water, samples were injected onto the liquid chromtagraphy-mass spectrometry (LC/MS) system. The standard and quality control samples were treated similarly, except that the acetonitrile used for protein precipitation also contained bupropion and hydroxybupropion. Chromatographic separation was carried out with a Waters XTerra RP8 column (2.1 × 50 mm, 3.5 µm particle size) and a Phenomenex MAX-RP precolumn (2.0 × 4 mm) (Phenomenex, Torrance, CA, USA) using isocratic elution (20% methanol and 80% ultra-pure grade water containing 0.1% formic acid) with a flow rate of 0.4 ml min−1.Retention times for hydroxybupropion, bupropion, threohydrobupropion, erythrohydrobupropion and phenacetin were 1.4, 1.6, 1.8, 1.8 and 3.0 min, respectively. As threohydrobupropion and erythrohydrobupropion co-eluted from the column and were also indistinguishable by MS detection, they were quantified together as one compound (hydrobupropion). MS detection within the multiple reactions monitoring mode was performed using a Micromass Quattro II triple quadrupole mass spectrometer (Micromass Corp., Altrincham, UK) with positive ion mode electrospray ionization. The capillary voltage used was 1000 V and the cone voltages for hydroxybupropion, hydrobupropion, bupropion and phenacetin were 17, 21, 21 and 25 V, respectively. The fragmentation reactions monitored were from m/z 256 to m/z 238 for hydroxybupropion, from m/z 240 to m/z 184 for bupropion, from m/z 242 to m/z 168 for hydrobupropion, and from m/z 180 to m/z 110 for phenacetin. The flow was delivered directly into the ion source of the mass spectrometer. The desolvation temperature was 320 °C and the source temperature 150 °C. The lower limits of quantification were 0.4 ng ml−1 for both bupropion and hydroxybupropion. Inter- and intraday coefficients of variation were less than 15% for both compounds over the linear quantification range of 0.4–700 ng ml−1. Bupropion and hydroxybupropion standards were generous gifts from GlaxoSmithKline (Uxbridge, Middlesex, UK). Because neither of the hydrobupropion isomers was available, they were determined using the calibration curve of hydroxybupropion, with the assumption that the detector responses of the two compounds were approximately equal.
Data analysis
The pharmacokinetic parameters for bupropion and metabolites were calculated by standard noncompartmental methods. The maximum plasma concentration (Cmax) and the time to Cmax (tmax) were derived directly from the plasma concentration data. The half-life (t1/2) was calculated by least-squares regression analysis of the terminal linear part of the log concentration–time curve. The area under the plasma concentration–time curve (AUC) was determined by use of the linear trapezoidal rule up to the last measurable concentration and thereafter by extrapolation of the terminal elimination phase to infinity. Apparent oral clearance expressed in l h−1 was calculated by dividing the dose by the AUC of bupropion. Owing to the small sample size and skewed distribution of the data, the Mann–Whitney U-test was used to compare absolute changes in the pharmacokinetic parameters between genotypes and between patients and controls. Differences giving P values <0.05 were considered statistically significant. The difference in means between the study groups was tested with an analysis of variance, with gender as confounding variable (Table 1). Pearson's correlation coefficients (r) were calculated to define the relationship between glomerular filtration rate (GFR) and the metabolic ratios. Results are expressed as mean values ± SD in the text and tables and as mean ± SEM in the figures, unless otherwise stated. For tmax, a median and a range is given.
Results
All subjects completed the study protocol. No abnormalities were found in laboratory test values of the healthy controls (Table 1). Patients with impaired kidney function had elevated plasma creatinine concentrations and decreased GFR, but normal plasma albumin concentrations and liver function tests (Table 1). Thirteen individuals were heterozygous (six and seven in the control and patient groups, respectively) and none was homozygous with respect to the CYP2B6 785 A>G SNP. Three of the subjects were homozygous (two and one in the control and patient groups, respectively) and five were heterozygous (three and two in the control and patient groups, respectively) for the 1459 C>T SNP. None of the 27 subjects was homozygous, but 11 (five and six in the control and patient groups, respectively) were found to be heterozygous for the 516 G>T SNP. None of the SNPs studied was found in seven of the subjects (five in controls, two in renally impaired patients). No statistically significant differences were apparent in the pharmacokinetics of bupropion or its metabolites between the different genotype groups (data not shown). No adverse reactions were observed during the study.
The AUC of bupropion was 126% higher (P< 0.0001, 95% CI +72%, +180%) (Table 2, Figure 1A), its Cmax 86% higher (P = 0.001, 95% CI +40%, +131%) and its elimination half-life 140% longer (P = 0.001, 95% CI +76%, +204%) in the renally impaired patients compared with the healthy controls. The apparent oral clearance (CL/F) of bupropion was 63% lower (P = 0.001, 95% CI −29%, −96%) in the patients with renal impairment. There were no significant differences in the tmax of bupropion or its metabolites between control and renal failure groups (Table 2). The AUC of bupropion did not correlate with plasma albumin concentration (r = 0.34, P = 0.33) in renal-impaired group. Individual data for bupropion pharmacokinetics are presented in Figure 2A–D.
Table 2.
Pharmacokinetic parameters of bupropion and its metabolites in 17 healthy subjects (control) and patients with renal impairment after a single oral 150 mg dose
| Parameter | Control | Impaired kidney function | % Difference and P value vs. control |
|---|---|---|---|
| Bupropion | |||
| AUC (µg ml−1 h) | 0.49 ± 0.29 | 1.1 ± 0.37 | +126% (<0.0001) |
| Cmax (ng ml−1) | 66.1 ± 33.7 | 123 ± 41.8 | +86% (0.001) |
| tmax (h) | 4 (2–5) | 3 (2–5) | – (0.39) |
| t1/2 (h) | 8.1 ± 7.2 | 19.4 ± 4.4 | +140% (0.001) |
| CL/F (l h−1) | 414 ± 264 | 155 ± 46.8 | −63% (0.001) |
| Hydroxybupropion | |||
| AUC (µg ml−1 h) | 13.9 ± 7.2 | 12.5 ± 6.3 | −10% (0.57) |
| Cmax (ng ml−1) | 404 ± 175 | 372 ± 151 | −8% (0.50) |
| tmax (h) | 8 (4–12) | 5.5 (4–12) | – (0.39) |
| t1/2 (h) | 23.5 ± 10.2 | 27.5 ± 11.5 | +17% (0.36) |
| Hydrobupropion | |||
| AUC (µg ml−1 h) | 6.6 ± 1.2 | 8.2 ± 5.3 | +24% (0.82) |
| Cmax (ng ml−1) | 208 ± 49.9 | 245 ± 157 | +18% (0.75) |
| tmax (h) | 6 (4–12) | 5 (4–6) | – (0.07) |
| t1/2 (h) | 34.7 ± 14.0 | 49.7 ± 12.5 | +43% (0.005) |
| AUC ratios | |||
| OH-BUP : BUP | 35.8 ± 25.4 | 12.2 ± 6.3 | −66% (<0.0001) |
| H2-BUP : BUP | 23.8 ± 27.8 | 7.5 ± 3.4 | −69% (0.001) |
| OH-BUP : H2-BUP | 2.1 ± 1.1 | 1.7 ± 0.9 | −18% (0.29) |
The results are presented mean ± SD (median with range for t max). The percentage difference was calculated from the means, and the P values are given for the absolute changes. AUC area under plasma concentration-time curve; Cmax maximum plasma concentration; max time to maximum plasma oncentration; t 1/2 half-life; CL/F apparent oral clearance; bupropion, BUP; hydroxybupropion, OH-BUP; hydrobupropion, H2-BUP.
Figure 1.
Mean plasma concentrations (SEM indicated by error bars) of bupropion (A), hydroxybupropion (B) and hydrobupropion (C) after a single 150 mg dose of bupropion in healthy subjects (○) and patients with impaired kidney function (▪)
Figure 2.
Individual and mean values for the area under the plasma concentration–time curves from time 0 to infinity (AUC) (A), peak plasma concentration (Cmax) (B), elimination half-life (t1/2) (C) and apparent oral clearance (CL/F) (D) of bupropion in 17 healthy controls (○) and 10 renally impaired patients (▪) after a single 150 mg dose of bupropion
Compared with the healthy controls, the AUC of hydroxybupropion was 10% lower (P = 0.57, 95% CI−51%, +31%) (Table 2, Figure 1B-C) and Cmax 8% lower (P = 0.5, 95% CI −41%, +25%) in patients with compromised kidney function. The mean difference in hydroxybupropion t1/2 was 17% (P = 0.36, 95% CI −20%, +54%) in renal-impaired subjects compared with controls. The AUC of hydrobupropion was 24% higher (P = 0.82, 95% CI −17%, +66%), its Cmax 18% higher (P = 0.75, 95% CI −22%, +58%) and its t1/2 43% higher (P = 0.005, 95% CI +11%, +75%) (Table 2) in renally impaired patients.
The AUC ratio of hydroxybupropion : bupropion (OH-BUP : BUP) was 66% (P = <0.0001, 95% CI −19%, −114%) lower in renally impaired subjects, the AUC ratio of hydrobupropion : bupropion (H2-BUP : BUP) 69% lower (P = 0.001, 95% CI +8%, −146%), and the metabolite AUC ratio (OH-BUP : H2-BUP) 18% lower (P = 0.29, 95% CI +21, −58%) compared with controls (Table 2). The highest correlation observed was that between the GFR and the. OH-BUP : BUP AUC ratio (r = 0.44, P = 0.02).
Discussion
Considering that bupropion is almost solely cleared by hepatic metabolism, we found a surprisingly large effect of kidney function on its disposition based on a 63% lower apparent oral clearance of bupropion in renally impaired patients not undergoing haemo- or peritoneal dialysis. In addition, the AUC ratios of hydroxybupropion : bupropion and hydrobupropion were 66% and 69% lower in renally impaired patients compared with healthy subjects, respectively, but this effect was mostly due to a higher bupropion AUC, with little effect on those of the metabolites. The liver function of all subjects and patients was normal as assessed by the plasma alanine aminotransferase concentration (Table 1). The AUC of bupropion was somewhat lower in the present work, than in earlier studies in healthy subjects [1, 2, 20], but similar to our earlier data using the same batch of the sustained-release formulation of bupropion [6]. Accordingly, the lower bupropion half-life (only quantifiable to 24 h) in the present work compared with earlier studies [1, 2, 20] does not represent the terminal elimination phase. However, this should not affect the interpretation of the present results, since both groups received the same formulation of drug.
A recent study by Worrall and coworkers [17] in a small group of renally impaired smokers undergoing haemodialysis, demonstrated that hydroxy- and hydrobupropion may accumulate after a single dose of the drug, but demonstrated that the pharmacokinetics of the parent compound were unaffected. Although there are few studies of bupropion pharmacokinetics in renally impaired subjects, data from experimentally induced renal failure in animals have been published. De Vane et al.[21] reported the accumulation of the parent drug, hydroxybupropion and threohydrobupropion, but not erythrohydrobupropion in uranyl nitrate treated guinea pigs. Kaka et al.[22] demonstrated a significant increase in bupropion AUC and Cmax in gentamicin treated rats compared with the control group. In our study, exposure to bupropion metabolites was similar between the groups, but a clear effect on bupropion clearance, Cmax, AUC and half-life was evident in renally impaired patients.
We determined plasma albumin concentration in order to explore the possible difference in binding of bupropion to albumin between the study groups. Plasma albumin concentrations were found to be normal in nine out of 10 subjects with renal impairment (mean 38.4, range 25.6–43.6) and no correlation between plasma protein concentrations and any of the pharmacokinetic parameters was found. It is known that hydroxybupropion binds to plasma proteins to the same extent as bupropion [19, 21], and therefore, similar findings would be expected for the parent compound and metabolite pharmacokinetics. Accordingly, our findings suggest that the differences in bupropion pharmacokinetics between the study groups are more likely to be in the metabolism of the drug than in its plasma protein binding. Owing to the extensive metabolism of bupropion, the fraction of an oral dose excreted unchanged in the urine is only approximately 0.5% [23] and therefore the renal clearance of bupropion was not assessed in the present work.
The majority of the patients had renal impairment induced by diabetes, but the influence of the latter on bupropion pharmacokinetics is not known. Concomitant medication in the patient group did not include any known CYP2B6-inhibitors, e.g. clopidogrel [6] or hormone replacement therapy [20]. In the present study, the mean age in the patient group was approximately 12 years higher than the controls. A study by Sweet and coworkers [24] reported an approximately 20% lower bupropion CLapp in elderly subjects aged 63–76 years compared with historical controls. Another study [2] with two groups of subjects aged either <40 years or >65 years demonstrated a slightly higher bupropion Cmax in the older population, but no difference in the AUC of the parent drug or its metabolites between the two groups. In conclusion, age alone does not explain the 60% decrease in CLapp observed in our present study.
Several studies have reported an overall decrease in CYP activities in patients with chronic kidney disease [25, 26]. However, only few isoform-specific effects have been characterized. The activities of CYP2C9, CYP2D6 and CYP3A4 have been shown to be lower in renally impaired patients [10, 11, 27]. A study by Nolin and coworkers [28] demonstrated an elevated chlorzoxazone metabolic ratio (a marker for CYP2E1), but no effect on chlorzoxazone metabolite formation clearance in patients with kidney disease.
Recent studies indicate that the ketone reduction pathway leading to the formation of isomeric hydrometabolites becomes increasingly important in the clearance of bupropion when the CYP2B6 dependent pathway is inhibited [20]. In the present study no statistically significant difference was seen in bupropion metabolite exposure between healthy subjects and renally impaired patients, but a moderate metabolic shift from hydroxylation to the formation of hydrometabolites was evident. Accordingly, our results do not directly suggest that the difference in bupropion clearance between the study groups is due to decreased CYP2B6 activity in renally impaired patients. However hydroxybupropion concentrations depend both on the formation and elimination, by hepatic metabolism or urinary excretion, respectively, of this metabolite. Thus, if formation and elimination of hydroxybupropion are equally affected, no difference in the hydroxybupropion concentration would be seen. Thus, our results do not exclude the possibility that the large effect of kidney disease on bupropion clearance could be at least partly caused by decreased CYP2B6 activity. More detailed studies are needed to define unequivocally the mechanism of decreased bupropion clearance in renal disease.
In conclusion, bupropion clearance was significantly decreased in patients with renal impairment, a surprising finding since the drug is almost entirely cleared by metabolism. Thus, a plausible explanation for this observation is a decrease in the metabolic clearance of bupropion. Because principal bupropion metabolites possess similar pharmacological activity to the parent compound, dosage recommendations for patients with renal impairment await more detailed pharmacokinetic-pharmacodynamic investigations.
Acknowledgments
The authors want to acknowledge Mrs Elina Kahra for invaluable technical assistance and Dr Mika Ilves, MSc and Dr Jorma Jalonen, PhD for their contribution to this work. This study was funded by the grants from the Finnish Technological Research Agency (Pelkonen), Turku University Hospital Grant (EVO13390; Laine), Swedish Science Council (Medicine 04496 2R; Rane) and supported by the funding of the Clinical Drug Research Graduate School (Turpeinen).
None of the authors has a conflict of interest related to this study.
References
- 1.Holm KJ, Spencer CM. Bupropion: a review of its use in the management of smoking cessation. Drugs. 2000;59:1007–24. doi: 10.2165/00003495-200059040-00019. [DOI] [PubMed] [Google Scholar]
- 2.Jefferson JW, Pradko JF, Muir KT. Bupropion for major depressive disorder: Pharmacokinetic and formulation considerations. Clin Ther. 2005;27:1685–95. doi: 10.1016/j.clinthera.2005.11.011. [DOI] [PubMed] [Google Scholar]
- 3.Hesse LM, Venkatakrishnan K, Court MH, von Moltke LL, Duan SX, Shader RI, Greenblatt DJ. CYP2B6 mediates the in vitro hydroxylation of bupropion: potential drug interactions with other antidepressants. Drug Metab Dispos. 2000;28:1176–83. [PubMed] [Google Scholar]
- 4.Faucette SR, Hawke RL, Lecluyse EL, Shord SS, Yan B, Laethem RM, Lindley CM. Validation of bupropion hydroxylation as a selective marker of human cytochrome P450 2B6 catalytic activity. Drug Metab Dispos. 2000;28:1222–30. [PubMed] [Google Scholar]
- 5.Borges V, Yang E, Dunn J, Henion J. High-throughput liquid chromatography-tandem mass spectrometry determination of bupropion and its metabolites in human, mouse and rat plasma using a monolithic column. J Chromatogr B Anal Technol Biomed Life Sci. 2004;804:277–87. doi: 10.1016/j.jchromb.2004.01.024. [DOI] [PubMed] [Google Scholar]
- 6.Turpeinen M, Tolonen A, Uusitalo J, Jalonen J, Pelkonen O, Laine K. Effect of clopidogrel and ticlopidine on cytochrome P450 2B6 activity as measured by bupropion hydroxylation. Clin Pharmacol Ther. 2005;77:553–9. doi: 10.1016/j.clpt.2005.02.010. [DOI] [PubMed] [Google Scholar]
- 7.Xie HJ, Yasar U, Lundgren S, Griskevicius L, Terelius Y, Hassan M, Rane A. Role of polymorphic human CYP2B6 in cyclophosphamide bioactivation. Pharmacogenomics J. 2003;3:53–61. doi: 10.1038/sj.tpj.6500157. [DOI] [PubMed] [Google Scholar]
- 8.Kirchheiner J, Klein C, Meineke I, Sasse J, Zanger UM, Murdter TE, Roots I, Brockmoller J. Bupropion and 4-OH-bupropion pharmacokinetics in relation to genetic polymorphisms in CYP2B6. Pharmacogenetics. 2003;13:619–26. doi: 10.1097/00008571-200310000-00005. [DOI] [PubMed] [Google Scholar]
- 9.Nolin TD, Frye RF, Matzke GR. Hepatic drug metabolism and transport in patients with kidney disease. Am J Kidney Dis. 2003;42:906–25. doi: 10.1016/j.ajkd.2003.07.019. [DOI] [PubMed] [Google Scholar]
- 10.Dreisbach AW, Japa S, Gebrekal AB, Mowry SE, Lertora JJ, Kamath BL, Rettie AE. Cytochrome P4502C9 activity in end-stage renal disease. Clin Pharmacol Ther. 2003;73:475–7. doi: 10.1016/s0009-9236(03)00015-8. [DOI] [PubMed] [Google Scholar]
- 11.Dowling TC, Briglia AE, Fink JC, Hanes DS, Light PD, Stackiewicz L, Karyekar CS, Eddington ND, Weir MR, Henrich WL. Characterization of hepatic cytochrome P4503A activity in patients with end-stage renal disease. Clin Pharmacol Ther. 2003;73:427–34. doi: 10.1016/s0009-9236(03)00056-0. [DOI] [PubMed] [Google Scholar]
- 12.Heinonen EH, Anttila MI, Lammintausta RA. Pharmacokinetic aspects of 1-deprenyl (selegiline) and its metabolites. Clin Pharmacol Ther. 1994;56:742–9. doi: 10.1038/clpt.1994.204. [DOI] [PubMed] [Google Scholar]
- 13.Hidestrand M, Oscarson M, Salonen JS, Nyman L, Pelkonen O, Turpeinen M, Ingelman-Sundberg M. CYP2B6 CYP2C19 as the major enzymes responsible for the metabolism of selegiline, a drug used in the treatment of Parkinson's disease, as revealed from experiments with recombinant enzymes. Drug Metab Dispos. 2001;29:1480–4. [PubMed] [Google Scholar]
- 14.Anttila M, Sotaniemi EA, Pelkonen O, Rautio A. Marked effect of liver and kidney function on the pharmacokinetics of selegiline. Clin Pharmacol Ther. 2005;77:54–62. doi: 10.1016/j.clpt.2004.09.004. [DOI] [PubMed] [Google Scholar]
- 15.Storrow AB. Bupropion overdose and seizure. Am J Emerg Med. 1994;12:183–4. doi: 10.1016/0735-6757(94)90243-7. [DOI] [PubMed] [Google Scholar]
- 16.Davidson J. Seizures and bupropion: a review. J Clin Psychiatry. 1989;50:256–61. [PubMed] [Google Scholar]
- 17.Worrall SP, Almond MK, Dhillon S. Pharmacokinetics of bupropion and its metabolites in haemodialysis patients who smoke. A single dose study. Nephron Clin Pract. 2004;97:83–9. doi: 10.1159/000078635. [DOI] [PubMed] [Google Scholar]
- 18.Turpeinen M. Raunio, Pelkonen O. The functional role of CYP2B6 in human drug metabolism: substrates and inhibitors in vitro, in vivo and in silico. Curr Drug Metab. 2006;7:705–14. doi: 10.2174/138920006778520633. [DOI] [PubMed] [Google Scholar]
- 19.Loboz KK, Gross AS, Williams KM, Liauw WS, Day RO, Blievernicht JK, Zanger UM, McLachlan AJ. Cytochrome P450 2B6 activity as measured by bupropion hydroxylation: effect of induction by rifampin and ethnicity. Clin Pharmacol Ther. 2006;80:75–84. doi: 10.1016/j.clpt.2006.03.010. [DOI] [PubMed] [Google Scholar]
- 20.Palovaara S, Pelkonen O, Uusitalo J, Lundgren S, Laine K. Inhibition of cytochrome P450 2B6 activity by hormone replacement therapy and oral contraceptive as measured by bupropion hydroxylation. Clin Pharmacol Ther. 2003;74:326–33. doi: 10.1016/S0009-9236(03)00202-9. [DOI] [PubMed] [Google Scholar]
- 21.DeVane CL, Laizure SC, Stewart JT, Kolts BE, Ryerson EG, Miller RL, Lai AA. Disposition of bupropion in healthy volunteers and subjects with alcoholic liver disease. J Clin Psychopharmacol. 1990;10:328–32. [PubMed] [Google Scholar]
- 22.Kaka JS, Al-Khamis KI, Tanira MO. Effect of hepatic and renal dysfunction on disposition of bupropion in rats. Eur J Drug Metab Pharmacokinet. 1988;13:149–53. doi: 10.1007/BF03189933. [DOI] [PubMed] [Google Scholar]
- 23.Findlay JW, Van Wyck Fleet J, Smith PG, Butz RF, Hinton ML, Blum MR, Schroeder DH. Pharmacokinetics of bupropion, a novel antidepressant agent, following oral administration to healthy subjects. Eur J Clin Pharmacol. 1981;21:127–35. doi: 10.1007/BF00637513. [DOI] [PubMed] [Google Scholar]
- 24.Sweet RA, Pollock BG, Kirshner M, Wright B, Altieri LP, DeVane CL. Pharmacokinetics of single- and multiple-dose bupropion in elderly patients with depression. J Clin Pharmacol. 1995;35:876–84. doi: 10.1002/j.1552-4604.1995.tb04132.x. [DOI] [PubMed] [Google Scholar]
- 25.Dreisbach AW, Lertora JJ. The effect of chronic renal failure on hepatic drug metabolism and drug disposition. Semin Dial. 2003;16:45–50. doi: 10.1046/j.1525-139x.2003.03011.x. [DOI] [PubMed] [Google Scholar]
- 26.Elston AC, Bayliss MK, Park GR. Effect of renal failure on drug metabolism by the liver. Br J Anaesth. 1993;71:282–90. doi: 10.1093/bja/71.2.282. [DOI] [PubMed] [Google Scholar]
- 27.Rostami-Hodjegan A, Kroemer HK, Tucker GT. In vivo indices of enzyme activity. the effect of renal impairment on the assessment of CYP2D6 activity. Pharmacogenetics. 1999;9:277–86. doi: 10.1097/00008571-199906000-00002. [DOI] [PubMed] [Google Scholar]
- 28.Nolin TD, Gastonguay MR, Bies RR, Matzke GR, Frye RF. Impaired 6-hydroxychlorzoxazone elimination in patients with kidney disease: Implication for cytochrome P450 2E1 pharmacogenetic studies. Clin Pharmacol Ther. 2003;74:555–68. doi: 10.1016/j.clpt.2003.09.003. [DOI] [PubMed] [Google Scholar]