Oral Immunization of BALB/c Mice with Giardia duodenalis Recombinant Cyst Wall Protein Inhibits Shedding of Cysts

Abstract

The process of encystation is a key step in the Giardia duodenalis life cycle that allows this intestinal protozoan to survive between hosts during person-to-person, animal-to-person, waterborne, or food-borne transmission. The release of cysts from infected persons and animals is the main contributing factor to contamination of the environment. Genes coding for cyst wall proteins (CWPs), which could be used for developing a transmission-blocking vaccine, have been cloned. Since the immunogenicity of recombinant Giardia CWP is unknown, we have investigated the immunogenicity of recombinant CWP2 (rCWP2) and its efficacy in interfering with the phenomenon of encystation taking place in the small bowels of BALB/c mice vaccinated with the recombinant protein. Here we report that the immunization of BALB/c mice with rCWP2 stimulated the immune system in a manner comparable to that for a live infection with Giardia muris cysts. Fecal and serum anti-rCWP2 immunoglobulin A (IgA) antibodies were detected in the immunized mice. In addition, anti-rCWP2 IgG1 and IgG2a antibodies were detected in the serum. mRNAs coding for Th1 and Th2 types of cytokines were detected in spleen and Peyer's patch cells from immunized mice. When the vaccinated mice were challenged with live cysts, the animals shed fewer cysts. We conclude that rCWP2 is a possible candidate antigen for the development of a transmission-blocking vaccine.

Giardia duodenalis is a worldwide-distributed protozoan parasite of humans and other vertebrates. This primitive eukaryotic cell has two forms: the trophozoite and the cyst. The trophozoites spend their entire life within the intestinal lumen of their host, whereas cysts are released within fecal material, which constitutes the mode of spreading the infection from host to host. The infective dose in humans is between 10 and 100 cysts (19, 25). Farm animals and wildlife excrete high numbers of Giardia cysts during the acute phase of the infection. Diarrheic calves can shed as many as 2.5 × 10⁴ cysts per g of feces (unpublished observations). Cattle are considered to be one of the most important sources of Giardia cysts found in surface waters (23, 28). Infected humans also contribute to the pollution, since they can release between 150 and 2 × 10⁴ cysts per g of fecal material (2, 8, 17).

The modification of the culture medium TYI-S-33 by Gillin et al. (9) for allowing encystation of Giardia trophozoites in vitro has provided a means to study antigenic changes occurring at the surface membrane during the encystation process. Cysts obtained from axenic cultures appear to be similar to those produced within the intestine of the host after a natural infection; they are resistant to water and infective to newborn mice (9) and adult gerbils (3). The development of specific antibodies to cyst wall proteins (CWPs) has contributed significantly to the understanding of the encystation phenomenon (7). Using immunofluorescence and immunogold staining, McCaffery et al. (16) have reported that cyst antigens are found in perinuclear and cytoplasmic endoplasmic reticulum cisternae which appear to be the site of cyst antigen synthesis. Encystation begins with the appearance of CWPs on small protusions of the trophozoite membrane, which enlarge to form cap-like structures with progression to formation of the cyst wall. These structures are usually called encystation-specific vesicles (ESVs) (20). They are seen over the entire trophozoite surface, including the adherence disk, and flagella (4, 5). The localization of cyst proteins within ESVs early and late in encystation confirms that these structures may play a role in transport of these proteins to the nascent cyst wall.

The presence of cyst antigens in the ESVs led us to the working hypothesis that specific antibodies to cyst antigens(s) directed during the early phase of encystation could interfere with the building of the cyst wall structure. For instance, the addition of cyst-specific immunoglobulin G1 (IgG1) monoclonal antibody (MAb) 8C5.C11 and complement to encysting culture medium in the first 9 h of encystation results in a 70% reduction in the output of water-resistant cysts. However, a significantly lower percentage of encystation is observed when the antibodies are added after 12 h of encystation (3). These results indicate that the encysting cells are vulnerable to immune attack at a time when the cyst wall thickness is relatively thin.

Lujan et al. (12) used MAb 7D2, which reacts with a 39-kDa CWP, to screen a cDNA expression library prepared from encysting trophozoite mRNA. The gene coding for this novel 39-kDa CWP was named cwp2. The DNA sequence of cwp2 has an open reading frame of 1,089 nucleotides that extends the cDNA sequence by 26 bp to include the putative initiation codon (12). CWP2 contains five tandem copies of a 24-residue leucine-rich repeat. MAb 8C5.C11, which has been used to study the transport of a major cyst epitope during encystation in vitro (6, 16), also reacts with recombinant CWP2 (rCWP2) (T. E. Nash personal communication).

The objectives of this study were twofold: to determine the immunogenicity of G. duodenalis rCWP2 expressed in Escherichia coli cells and to determine its efficacy as a transmission-blocking vaccine. We report that when rCWP2 is given alone orally, only mucosal IgA antibodies are detected. However, the administration of rCWP2 with the cholera toxin (CT) adjuvant stimulates both the local and systemic immune responses. The immunization regimen induced both Th1 and Th2 cytokine mRNAs in spleen cells and Peyer's patch (PP) cells. The vaccinated mice shed significantly fewer cysts than nonvaccinated mice.

MATERIALS AND METHODS

Animals.

Eight-week-old female BALB/c and CD-1 mice were purchased from Charles River Breeding Laboratories (St. Constant, Quebec, Canada). BALB/c mice were used for the immunization experiments, and CD-1 mice were used to maintain Giardia muris in our laboratory. All of the animals were kept under standard laboratory conditions according to the rules and regulations of the Canadian Council for Animal Care.

Parasites.

Trophozoites of the G. duodenalis WB strain (ATCC 30957), originally isolated from a patient with chronic symptomatic giardiasis (22), were used to prepare soluble antigenic extracts. Trophozoites were grown axenically in filter-sterilized TYI-S-33 medium (containing Trypticase, yeast extract, iron, and serum) adapted for G. duodenalis (9) (supplemented with 10% adult bovine serum [Sigma Chemical Co., St. Louis, Mo.], 100 U of penicillin [Sigma] per ml, and 100 μg of dihydrostreptomycin sulfate salt [Sigma] per ml) in the absence of bovine bile at pH 7.0; trophozoites were passaged twice weekly. Live G. muris cysts were kindly provided by M. Belosevic, University of Alberta, Edmonton, Canada. They were stored at 4°C in phosphate-buffered saline (PBS) (pH 7.2) until mice were infected orally with 10⁴ cysts suspended in 0.5 ml of PBS.

Encystation in vitro.

To induce encystation in vitro, the method of Campbell and Faubert (3) was used. Briefly, spent medium from fully grown G. duodenalis cultures (72 h) was removed, and the adherent trophozoite monolayer was supplemented with complete encystation medium (TYI-S-33 [pH 7.8] supplemented with 0.25 mg of porcine bile [Sigma] per ml and 0.55 mg of lactic acid [Sigma] per ml). G. duodenalis trophozoites cultures were kept in encystation medium for 72 h. and subsequently underwent water treatment according to the method of Faubert et al. (6) to lyse nonencysted trophozoites and water-sensitive cysts. The remaining water-resistant cysts were then collected by centrifugation at 150 × g for 5 min at room temperature.

Preparation of soluble antigenic extracts.

G. duodenalis trophozoites grown in encysting medium were used to prepare the soluble antigenic extracts. All cells were sedimented by centrifugation at 800 × g for 10 min at 4°C. Encysted cells were then lysed by using a Vibra-Cell sonicator (Fisher, Montreal, Canada) set at 30-s bursts for 10 min in an ice bath. The sonicated cell debris was removed by centrifuging the suspension at 23,300 × g for 20 min at 4°C. The supernatant was collected and used as antigenic extract. The protein concentration was determined by the Lowry method (14).

p53.

The tumor suppressor protein p53 in the proline and arginine form together with MAbs PB1801 and PB1802 were kindly provided by G. Matlashewski, Department of Microbiology and Immunology, McGill University, Montreal, Canada.

Amplification of cwp2 gene by PCR.

The cwp2 gene segment encoding the 39-kDa pro-CWP2 was amplified by PCR with plasmid PMM 109 as the template (kindly provided by T. E. Nash, National Institutes of Health, Bethesda, Md.). The primers used were 5′-CGGGATTCATCGCAGCCCTTGTT-3′ (BamHI) for the coding strand and 5′-GCCCTGCAGTCACCTTCTGCCGAC-3′ (PstI) for the complementary strand. The PCR product (1,086 bp) was cloned into the pQE30 expression vector (Qiagen).

E. coli cells expressing rCWP2 from pQE30 were grown in Luria-Bertani medium containing 100 μg of ampicillin per ml. Cells were incubated overnight at 37°C in a shaking incubator (225 rpm). To determine whether the pQE30-CWP2 construct was correctly engineered, digestion profiles with the same restriction enzymes utilized during the engineering process were determined. When digested with either PstI or BamHI, the pQE30-CWP2 construct produces a band of approximately 4.5 kb when visualized through a 0.8% agarose gel. The size of the band represents the sum of pQE30 (3.5 kb) and CWP2 (1.1 kb), indicating that CWP2 was correctly inserted into the vector. On the other hand, double digestion with both BamHI and PstI resulted in two bands representing the pQE30 vector (3.5 kb) and the CWP2 insert (1.1 kb) when run on an 0.8% agarose gel.

For expression of rCWP2, 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) was added, and the cells were incubated for 6 h at 37°C with constant shaking. To determine the expression of rCWP2 in inclusion bodies upon induction with IPTG, stimulated cells were collected by centrifugation at 325 × g for 10 min and lysed by sonication as described for the preparation of the cyst antigenic extract (see above). After sonication, the cells were sedimented by centrifugation at 11,000 × g for 15 min at 4°C. Both the pellet and the supernatant were suspended in protein sample buffer containing 10% glycerol, 2% sodium dodecyl sulfate (SDS), 5% β-mercaptoethanol, and 0.1% bromophenol blue. The buffer solution was adjusted pH 6.8 and used in dot blot analysis.

Isolation of CWP2 from inclusion bodies and solubility assay.

Inclusion bodies are aggregated, dense structures of proteins produced mostly in the cytoplasm of E. coli, which are the result of a high rate of protein expression in an overexpression system. To determine whether rCWP2 was localized in inclusion bodies, the bacteria were lysed with lysozyme and centrifuged at 12,000 × g for 10 min at 4°C. rCWP2 was expressed in inclusion bodies and was further isolated by the method described by Marston et al. (15). Briefly, E. coli expressing rCWP2 was grown overnight at 37°C in Luria-Bertani medium containing 100 μg of ampicillin per ml and induced with IPTG for 4 h. The cells were then centrifuged and resuspended in 100 mM NaCl-1 mM EDTA-50 mM Tris (pH 8) supplemented with lysozyme (Sigma). After centrifugation, the cells were lysed by freezing and thawing three times. The pellet was resuspended in ice-cold 100 mM NaCl-1 mM EDTA-0.1% sodium deoxycholate-50 mM Tris (pH 8). MgCl₂ and DNase I (Sigma) were added to the cell suspension. Inclusion bodies were isolated from the suspension by centrifugation at 10,000 × g for 10 min. The pellet was washed twice in 1% NP-40-100 mM NaCl-1 mM EDTA-50 mM Tris (pH 8). The last wash was done without 1% NP-40. The protein concentration was determined by the Lowry method (14). The rCWP2 antigenic extract was stored at −20°C until used for immunization. In order to determine the solubility of rCWP2 expressed by E. coli cells, the supernatant and pellet generated during the isolation procedure were resuspended in protein sample buffer and used in dot blot analysis.

Western blotting.

For SDS-polyacrylamide gel electrophoresis (SDS-PAGE), rCWP2 was boiled for 10 min in an equal volume of reducing sample buffer and applied in volumes of 15 μl containing a 20-μg/ml concentration of protein per lane. Proteins were separated on a 4% stacking gel and 12% separating gel by using a Bio-Rad (Hercules, Calif.) Protean electrophoresis unit. Resolved proteins were transferred onto a nitrocellulose membrane by using a Bio-Rad blotting chamber set at 75 V for 2 h at 4°C. Protein transfer was confirmed by staining with Coomassie blue. The nitrocellulose strips were blocked with 5% skim milk for 1 h at room temperature and washed with Tween 20-Tris-buffered saline. They were incubated for 1 h at room temperature with MAb 8C5.C11 ascites diluted 1/1,000. Following washing with Tween 20-Tris-buffered saline, the strips were probed with an anti-mouse secondary antibody (whole Ig) conjugated to horseradish peroxidase. The signal was detected by using enhanced chemiluminescent reagent (Amersham Pharmacia Biotech, Montreal, Canada).

Dot blotting.

Dot blot assays were chosen to determine the solubility of rCWP2 because of their high sensitivity and speed of execution (15). The protein solution was added directly onto a nitrocellulose membrane, allowed to bind for 15 min, and dried at 37°C for 15 min before use. Two cyst-specific MAbs were used in the dot blot assay. MAb 8C5.C11 was developed in our laboratory and is specific to CWP2. MAb 5-3C is a generous gift of Henry Stibbs and is specific to CWP1. The antibody capture on the nitrocellulose was done as described for Western blotting.

Immunizations.

Five groups of BALB/c mice were immunized by oral gavage as described in Fig. 1A. The first group (four mice) was injected with PBS supplemented with 3% NaHCO₃ and served as a negative control for the diluent used to prepare the antigenic soluble extract. The second group (eight mice) was immunized with a soluble extract of G. duodenalis encysting cells mixed with the CT adjuvant (Gibco BRL) and served as a cyst antigen positive control, while the third control group (four mice) received CT only. The fourth group (eight mice) was immunized with rCWP2, and the fifth group (eight mice) was immunized with rCWP2 and CT. Mice received 0.5 mg of rCWP2 per dose. The protein concentration of rCWP2 or G. duodenalis encysting cell proteins inoculated into each mouse was 4 mg/ml. The total volume of the inoculation given by gavage to each mouse was 0.5 ml. When required, 10 μg of CT was coadministered with rCWP2 (total of 40 μg of protein per ml). Mice were immunized once a week for a period of 4 weeks. They were sacrificed at 1 week following the last immunization as described in Fig. 1B. The immunization experiment was performed twice.

FIG. 1.

(A) Oral immunization of mice. Three of these groups serve as controls: mice receiving PBS served as negative controls, mice injected with encysting cells (Enc) and CT act as comparative controls for the recombinant protein, and mice injected with CT only serve as controls for the adjuvant. The remaining two groups were immunized with rCWP2 alone or together with CT. (B) Immunization schedule.

Challenge infection.

For the challenge infection, 30 mice were divided into five groups of six mice. The immunization with rCWP2, rCWP2 combined with CT, or CT alone was similar to that in the previous experiment (Fig. 1). In addition, two other groups of mice were added and served as controls for sodium Tris-EDTA buffer (pH 8.0) (STE) and to determine the infectivity of the live cysts. One week after the last immunization injection, all of the mice were infected by gavage, without anesthesia, with 10⁴ live G. muris cysts. Mice were challenged with G. muris for the following reasons: first, G. muris is a natural parasite of mice and cysts are shed in fecal pellets for at least 30 days; second, we were interested to see whether the immune response to G. duodenalis CWPs would reduce G. muris cyst formation. The challenge experiment was performed twice. To determine the efficacy of our immunization, an average of 0.3 g of feces from each individual mouse was collected every 3 days starting at day 5 after infection. Fecal material was processed as described below. The number of cysts per gram of feces is reported.

Isolation of G. muris cysts from fecal pellets.

For collection of feces, individual mice were placed in separate cages and the fecal pellets excreted over a 1-h period were collected in 12- by 75-mm glass tubes. Cysts were isolated by a sucrose gradient centrifugation technique adapted by Belosevic and Faubert (1). Briefly, feces were collected, emulsified in PBS, layered on sucrose (specific gravity, 1.12), and centrifuged at 400 × g for 15 min. Cysts were counted with a Spencer Bright Line hemacytometer (Fisher Scientific).

Blood samples.

Blood samples were collected after the last day of immunization to determine the presence of circulating antibodies. The immunized BALB/c mice were anesthetized with ether and bled from the orbital plexus. Serum was collected by centrifuging the blood samples at 800 × g for 10 min and stored at −70°C until use.

Determination of antibodies in fecal samples.

Fecal pellets were collected from each immunized mouse 1 week after the last immunization. For the group of mice infected with G. muris, feces were collected at 14 days postinfection (acute phase), 29 days postinfection (elimination phase), and 56 days (late elimination phase). The pellets were weighed and frozen at −20°C. Soluble fecal extracts were prepared by the technique of Steidler et al. (26) to measure the presence of fecal anti-Giardia antibodies. Briefly, fecal soluble extracts were prepared by adding 1 ml of PBS containing 1% bovine serum albumin (Boehringer, Mannheim, Germany) and 1 mM freshly added phenylmethylsulfonyl fluoride (Gibco BRL) per 0.1 mg of fecal material. The tubes were incubated overnight at 4°C to softened the fecal material. The suspension was mixed by vortexing to disrupt solid matter. The samples were centrifuged in a Eppendorf microcentrifuge at 14,000 rpm for 5 min. The supernatants were collected and stored at −20°C.

ELISA.

Enzyme-linked immunosorbent assay (ELISA) was carried out by using a standard technique as described by Miles and Hales (18). ELISA plate wells (Falcon VWR) were coated with 50 μl of rCWP2 diluted in PBS. The total protein present was 1 μg/ml per well. The plates were incubated at 4°C overnight and washed with PBS-Tween before use. Plates were blocked with PBS-1% bovine serum albumin (200 μl/well). The serum or soluble fecal extract samples were diluted 1/100 in PBS-Tween and tested in triplicate for antibodies. Sera or fecal pellets obtained from normal mice of the same age of the immunized animals served as negative controls. After incubation at room temperature for 1 h, the plates were washed with PBS-Tween and an anti-mouse secondary antibody conjugated to horseradish peroxidase was added to each well. The Ig isotypes IgA, IgM, IgG1, and IgG2a, which were diluted as suggested by the manufacturer (Sigma), were used as the secondary antibody. The signal was detected by using 2,2-azino-di-(3-ethylbenzthiazoline)-sulfonate diammonium salt (ABTS) (ICN Biochemicals). The plates were read at a wavelength of 405 nm with a microplate reader (Mandel Scientific, Guelph, Canada).

Preparation of lymphocyte total RNA for detection of cytokine mRNA.

Lymphocytes from the spleens and PPs of immunized or control mice were isolated and stimulated with concanavalin A (ConA), rCWP2, or PBS for 24 h at 37°C. After centrifugation, cells were collected and resuspended in Trizol (Gibco Life Technologies) and frozen at −70°C until use. Total RNA was extracted from the cells according to the recommendations of Gibco BRL.

RT-PCR amplification.

The sequences of the primers used for reverse transcription-PCR (RT-PCR) amplification of cytokine mRNA and the expected sizes of the PCR products are listed in Table 1. The interleukin-4 (IL-4) and transforming growth factor β (TGF-β) primers were purchased from Operon Inc. (Alameda, Calif.), whereas the gamma interferon (IFN-γ), IL-2, IL-5, and IL-10 primers were purchased from Invitrogen Life Technologies (Burlington, Canada). Qiagen's single-step RT-PCR kit was used according to the manufacturer's suggestions, with 0.15 μg of total RNA as the template and primers at a final concentration of 0.2 μM. Individual cytokine cDNA bands were resolved by 2.0% agarose gel electrophoresis and visualized by ethidium bromide staining (10). Gel pictures were taken with a Bio-Rad Gel Doc 2000 and accompanying Bio-Rad (Montreal, Canada) software.

TABLE 1.

Primers used for RT-PCR analysis of murine cytokine mRNAs

Target mRNA	Genbank accession no.	Primer sequences		Size of PCR amplicon (bp)	Refer- ence
		Sense	Antisense
β-Actin	M12481	GTGGGCCGCTCTAGGCACCA	CGGTTGGCCTTAGGGTTCAGGGGGG	245	24
IL-2	NM_008366	ACTTCAAGCTCCACTTCAAG	GAGTCAAATCCAGAACATGC	256	27
IL-4	NM_021283	CCAGCTAGTTGTCATCCTGCTCTT CTTTCTCG	CAGTGATGTGGACTTGGACTCATTCATGGTGC	358	17
IL-5	NM_010558	GACAAGCAATGAGACGATGA	GAACTCTTGCAGGTAATCCA	235	27
IL-10	NM_010548	GTGAAGACTTTCTTTCAAACAAAG	CTGCTCCACTGCCTTGCTCTTATT	274	24
IFN-γ	M28621	AACGCTACACACTGCATCTT	GACTTCAAAGAGTCTGAGGT	237	27
TGF-β	BC013738	TGGACCGCAACAACGCCATCTATG AGAAAACC	TGGAGCTGAAGCAATAGTTGGTATCCAGGGCT	525	28

Statistical analysis.

Statistical significance was determined by Student's t test (Sigma Stat Software; Jarol Scientific). A P value of <0.05 was considered significant.

RESULTS

rCWP2 expression and enrichment from inclusion bodies.

A dot blotting assay with two cyst wall antigen-specific MAbs (8C5.C11 and 5-3C) was used to determine whether rCWP2 was properly expressed as a recombinant protein. An untransformed E. coli cell lysate served as a negative control, while a soluble extract of encysting Giardia lamblia cells served as a positive control (Fig. 2A). With the cyst-specific MAb 8C5.C11 as the probe, the data confirmed that the induction process was successful (Fig. 2A, induced E. coli lysate) and that the protocol which was used for rCWP2 enrichment from inclusion bodies was also successful (Fig. 2A, inclusion bodies). With MAb 5-3C (a gift from H. Stibbs, Waterborne Inc.), which is specific for native CWP1 and rCWP1, only the lane containing a soluble extract of encysting G. lamblia cells was positive. Moreover, induced E. coli cells containing an empty pQE30 vector did not react with either MAb (data not shown), thereby confirming that rCWP2 expression in E. coli cells was successful.

FIG. 2.

(A) Dot blot assay of E. coli cell lysate expressing rCWP2. The protein solutions were added directly to the nitrocellulose membrane. MAb 8C5.C11 or MAb 5-3C was added to the nitrocellulose, and anti-mouse whole Ig conjugated to horseradish peroxidase acted as the secondary antibody. (B) Western blot of the insoluble fraction of E. coli cell lysate (inclusion bodies) containing rCWP2 (arrow). Samples were resolved by SDS-PAGE, transferred to a nitrocellulose membrane, and probed with MAb 8C5.C11. Molecular mass standards are shown on the left.

To confirm that rCWP2 was indeed present in inclusion bodies, Western blot analysis was performed with MAb 8C5.C11 (Fig. 2B) G. lamblia trophozoite antigens were used as a negative control, whereas the positive control was similar to that used in the dot blot assay. The lane containing enriched rCWP2 from inclusion bodies resulted in a cleaner and sharper band at the expected size range of 39 to 46 kDa than the lane containing induced E. coli cell lysate, indicating that the enrichment process aided in isolating and purifying rCWP2. Additionally, the specificity of the Western blot was confirmed by running two additional samples, which were induced E. coli cell samples containing an empty pQE30 vector and Entamoeba histolytica proteins isolated from inclusion bodies. Both samples failed to react with MAb 8C5.C11 (data not shown). We also confirmed that our results were not due to nonspecific binding by the Ig isotype by employing an Ig isotype control. For this purpose we used IgG1 MAbs PB-1801 and PB-1802, which are specific for the cellular tumor suppressor protein p53, and the results were negative (data not shown).

Detection of cytokine mRNAs in spleen and PP cells.

Semiquantitative RT-PCR was used to monitor IL-2, IL-4, IL-5, IL-10, IFN-γ, and TGF-β gene expression in spleen and PP cells isolated from mice vaccinated with rCWP2. Committed cells isolated from these two lymphoid organs were cultured for 24 h in the presence of ConA, rCWP2, or PBS. RNA isolated from splenocytes of nonimmunized BALB/c mice was used as a control. The cDNA products were visualized at the expected size for each amplicon. The housekeeping β-actin gene was used to normalize the levels of RNA used in the assay. When the spleen cells were stimulated with the mitogen ConA or rCWP2, all of the genes specific for the cytokines under study were expressed (Fig. 3A and B). However, when PP cells were stimulated with rCWP2, the IL-2, IL-10, and TGF-β genes were expressed. When the spleen cells were cultured in the presence of PBS (control), the IL-2 and TGF-β genes were expressed. However, a much weaker reaction was obtained with IL-5 and IL-10. When cultured in the presence of PBS, PP cells expressed a weak signal only with IL-2. (Fig. 3C).

FIG. 3.

Analysis of cytokine gene expression by RT-PCR. Semiquantitative RT-PCR amplification of pooled mRNAs extracted from spleens or PP lymphocytes of mice orally immunized with rCWP2 and stimulated in vitro with ConA (A), rCWP2 (B), or PBS (C) was performed. +, positive control RT-PCR signal. All RT-PCR amplicons were resolved by 2% PAGE, stained with ethidium bromide, and visualized with a Geldoc 2000 gel documentation system.

Fecal anti-rCWP2 antibodies.

The presence of specific anti-rCWP2 antibodies in fecal pellets in immunized mice was determined by ELISA. The assay was done with the Ig isotypes IgA, IgM, IgG1, and IgG2a. Only antibodies of the IgA isotype were detected in the fecal pellets (Fig. 4) in both immunizations. No antibodies to rCWP2 were detected in fecal pellets released by mice injected with CT. However, a significantly higher reactivity was obtained with the group of mice injected with an extract of encysting cells with CT as an adjuvant. The group of mice immunized with the crude extract of encysting cells was used to compare the immunogenicities of the crude extract of the parasitic cell and rCWP2. Compared to the negative control groups (mice injected with PBS or CT), specific antibodies were obtained in the groups of mice immunized with rCWP2 alone or with rCWP2 and CT. No significant differences were observed between the two different groups. The addition of CT to the immunizing proteins (rCWP2 or encysting cells) did not significantly increase the level of specific anti-rCWP2 IgA antibodies.

FIG. 4.

Fecal anti-rCWP2-specific antibodies of the IgA subclass after oral immunization with rCWP2, rCWP2 plus CT, encysting cells (ENC) plus CT, or CT alone. BALB/c mice were immunized once a week for 4 weeks. Fecal pellets were collected 1 week after the last immunization. The horizontal line indicates the mean optical density at 405 nm (OD₄₀₅) + 2 SEMs for the group of mice receiving PBS, which represents the cutoff point for positivity of the ELISA. The assay was done twice. Results are expressed as means ± SEMs.

Serum anti-rCWP2 antibodies.

To determine if the oral immunization was able to stimulate the systemic immune response, mice were bled 1 week after the last immunization. Significantly higher levels of circulating IgA, IgG1, and IgG2a antibodies to rCWP2 antigens were detected only in the sera of mice immunized with rCWP2 and CT. Positive results were obtained with sera diluted 1/300 or higher. Serum dilutions of lower than 1/300 were not considered significant, since they fell within the mean plus 2 standard errors of the mean (SEMs) of the cutoff line. When CT was not used as an adjuvant, only IgA and IgG2a antibodies against rCWP2 were detected (Fig. 5). To our surprise, no serum antibodies were detected in the group of mice immunized with the soluble extract of encysting cells. In addition, no specific antibodies to rCWP2 were detected in the sera of mice immunized with CT alone. Circulating IgM antibodies were not detected at a significant level in any of the groups.

FIG. 5.

Serum anti-rCWP2 antibodies of four Ig isotypes after oral immunization with rCWP2, rCWP2 plus CT, encysting cells (ENC) plus CT, or CT alone. BALB/c mice were immunized every week for 4 weeks. Serum was collected 1 week after the last immunization. The horizontal line indicates the mean optical density at 405 nm (OD₄₀₅) + 2 SEMs for the group of mice receiving PBS, which represents the cutoff point for positivity of the ELISA. The assay was done twice. Results are expressed as means ± SEMs. *, P ≤ 0.05.

Fecal IgA antibodies to rCWP2 in mice infected with live G. muris cysts.

We were interested to see whether local IgA antibodies to rCWP2 were present in fecal pellets released by mice infected with G. muris. For this purpose we collected fecal pellets at three different times after the infection: the acute phase (day 14), the elimination phase (day 29), and the late elimination phase (day 56). The results show that anti-rCWP2 IgA antibodies are present in infected mice (Fig. 6) during the three phases of the infection. The significance of these results are twofold: first, fecal IgA antibodies against rCWP2 are produced during a live infection with G. muris, and second, these antibodies react with cyst structure epitopes belonging to two different species of Giardia.

FIG. 6.

Fecal IgA anti-rCWP2 antibodies in mice infected with G. muris. BALB/c mice were infected with 10³ cysts of G. muris. Fecal pellets were collected at days 14, 29, and 56 postinfection and processed for antibody detection as described in Materials and Methods. The horizontal line indicates the mean optical density at 405 nm (OD₄₀₅) + 2 SEMs for the group of mice receiving PBS, which represents the cutoff point for positivity of the ELISA. The assay was done twice. Results are expressed as means ± SEMs.

Challenge infection.

Since local anti-rCWP2 IgA antibodies were detected during a live infection, we determined the efficacy of rCWP2 in reducing cyst output. For this purpose, mice were immunized with rCWP2 and subsequently challenged with live G. muris cysts. The challenge infection was performed twice. For each experiment, six mice were infected with live cysts and served as controls for the infectivity of the cysts. Mice were inoculated at the same time with the same lot of cysts. A group of mice treated with STE also served as controls to demonstrate the nonimmunogenic effect of the diluent used for suspension of the recombinant protein. When we compared the average number of cysts shed per gram of feces to those for the control G. muris and STE groups, the vaccinated mice had a 65 and 80% reductions, respectively, compared to the nonimmunized mice infected with G. muris (P < 0.001) (Fig. 7). The variation in the number of cysts released between the immunized mice is minimal compared to that between the control groups, which show a greater variation (data not shown). Mice receiving CT alone also showed a significant reduction of cyst shedding (50%). This reduction is likely to be explained by the affinity of the nonspecific IgA for rCWP2.

FIG. 7.

Mean number (±SEM) of cysts released per group. The total number of cysts released during the entire experiment (day 5 to 35) was divided by the number of mice (six) in each group. Mice were vaccinated with rCWP2 alone or together with the adjuvant CT. The other groups, i.e., mice injected with CT or STE or mice infected with the cysts, served as controls. All of the groups were infected by gavage with 10⁴ G. muris cysts.

DISCUSSION

The giardial cyst wall is a rigid structure that allows the trophozoites to survive in the environment. The cyst wall is composed of approximately 40% protein, and the remainder is carbohydrate (11). Because Giardia is considered one of the earliest eukaryotic cells, it occupies an enviable position on the scale of evolution of eukaryotic cells. For this reason, the Giardia Genome Project Database (www.mbl.edu/Giardia) is developing rapidly. Genes coding for CWPs have been cloned and sequenced (12). Experiments done in vitro have shown that the expression of CWP2 increases significantly after exposure to an encysting stimulus (12, 13). However, the immunogenicities of the products of these genes are unknown. The objectives of this study were twofold: to determine the immunogenicity of G. duodenalis rCWP2 expressed in E. coli cells and to determine its efficacy as a transmission-blocking vaccine. Before using any recombinant proteins for developing a vaccine, one should ask whether the recombinant protein is comparable to the native antigen in terms of immunogenicity. Another question to be asked is whether a live infection with the infectious agent will produce antibodies against the recombinant protein. Here we report data from experiments designed to address these specific questions. We selected this protein as a target vaccine molecule because we found that MAbs developed earlier in our laboratory were specific to CWP2. When these MAbs were added as a supplement to the encysting culture medium, encystation of trophozoites in vitro decreased significantly (3). In view of these previous findings, we reasoned that the epitope reacting with the MAbs could be a suitable candidate for the development of a transmission-blocking vaccine. Here we report that the immunization of BALB/c mice with rCWP2 stimulated the immune system in a manner comparable to a live infection with G. muris cysts. For example, fecal and serum anti-rCWP2 IgA antibodies were detected in the immunized mice. In addition, anti-rCWP2 IgG1 and IgG2a antibodies were detected in the serum. However, as is the case during a live infection, the presence of circulating antibodies was inconsistent and unpredictable (Fig. 5). Therefore, the oral immunization of mice with rCWP2 mimics the immune response observed during a live infection (7, 8). mRNAs coding for Th1 and Th2 types of cytokines were detected in spleen cells and, to a lesser extent, in PP cells from immunized mice. When the vaccinated mice were challenged with live cysts, the animals shed fewer cysts. These results confirm the potential of rCWP2 as a candidate antigen for the development of a transmission-blocking vaccine. The product of cwp2 is transported to the nascent wall by the ESVs (13, 16, 21). In giardial infections, expression of the CWP genes and formation of the ESVs are taken as measures of commitment to the encystation pathway (21). The availability of a transmission-blocking vaccine will decrease the contamination of surface water and the environment by cysts of Giardia. Essentially, the idea pursued in the development of a transmission-blocking vaccine is to improve the health of the environment, thus preventing infections of the people and animals living in it.

Two MAbs specific to cyst antigens were used to evaluate the efficacy of our immunization (Fig. 2). Although these two MAbs were specific to cyst antigens, only MAb 8C5.C11 reacted with the rCWP2. This result confirmed that the cyst wall structure is not made of homogenous protein. Attempts to solubilize the rCWP2 in inclusion bodies were unsuccessful, mainly because of the protein-rich composition in cysteine residues and because of the hydrophobic leucine-rich repeat motif implicated in protein-protein interactions. However, the insolubility of rCWP2 became an advantage for oral immunization, since it was able to resist the harsh environment of the stomach and therefore its immunogenicity was preserved. The presence of circulating IgG1 antibodies in the sera of mice immunized with rCWP2 and CT as an adjuvant is of interest, since we have reported that IgG1 MAb 8C5.C11 can interfere with cyst formation in vitro (3). The detection of fecal IgA antibodies to rCWP2 in mice infected with G. muris (Fig. 6) is interesting, since it indicates that rCWP2 is not a unique protein found in the G. duodenalis cyst wall structure and that CWP2 is synthesized during the encystation process in vivo.

After oral immunization of BALB/c mice with rCWP2, we detected mRNAs for cytokines of Th1 and Th2 subsets (Fig. 3). The mRNA was detected in PP and spleen cells, which play roles in the local and systemic immune responses, respectively. We selected these cytokines because of their biological functions in both humoral and cell-mediated immunity. The functional importance of the humoral and cell-mediated arms of the immune system of the mucosa-associated lymphoid tissue is well known. This is attested to by the presence of a large population of antibody-producing plasma cells at the mucosal sites. On the other hand, many of the small lymphocytes in the mucosa-associated lymphoid tissue are T cells. Both arms of the immune system play a role in the immune response to this intestinal protozoan (7, 8).