Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2003 Oct;71(10):5733–5738. doi: 10.1128/IAI.71.10.5733-5738.2003

The Vsa Proteins Modulate Susceptibility of Mycoplasma pulmonis to Complement Killing, Hemadsorption, and Adherence to Polystyrene

Warren L Simmons 1,*, Kevin Dybvig 1
PMCID: PMC201092  PMID: 14500494

Abstract

The variable surface antigens (Vsa) of the murine respiratory pathogen Mycoplasma pulmonis are associated with the virulence of the microorganism in the lung. In strain UAB CT, the antigens consist of an N-terminal region that is combined with one of seven different C-terminal variable regions comprised of tandem repeats. M. pulmonis producing a VsaA protein with about 40 tandem repeats (R40) does not adhere to red blood cells or polystyrene. Strains that produce VsaH contain a short C-terminal region that lacks tandem repeats and adhere to red blood cells and plastic. We isolated and analyzed M. pulmonis strain CT variants (CT182 and derivatives) that produced a VsaA protein with only three tandem repeats (R3). These variants adhered to plastic and red blood cells similarly to the VsaH-producing strain. When the R3-producing CT182 strain or the VsaH-producing strains were incubated with normal guinea pig serum, they were efficiently killed. Killing was abolished when the serum was heat inactivated. In contrast, the M. pulmonis strains that produced VsaA R40 were highly resistant to complement killing. CT182R3 variants that survived the complement killing reactions all produced the R40 form of VsaA and were resistant to complement killing. VsaA R40 is the first mycoplasmal protein shown to be associated with resistance to complement. As both VsaH and VsaA can mediate adherence to plastic, cytadherence, and susceptibility to complement, we propose that Vsa modulates these phenotypes by nonspecific interactions.


Mycoplasmas cause a variety of acute and chronic diseases in animals and humans as a result of their ability to infect the respiratory tract, joints, the reproductive tract, and other tissues and to evade the host immune system (19, 26, 27, 35). Atypical pneumonia in humans, which is caused by Mycoplasma pneumoniae, is generally a self-limiting disease. During the course of severe infection, influx of neutrophils and edema into the airspaces (acute phase), large accumulations of lymphoid cells into the respiratory tract (chronic phase), small-airway hyperreactivity, and increased levels of inflammatory cytokines detected in the bronchoalveolar lavage fluids of patients are seen (26). Despite the presence of a strong immune response, M. pneumoniae can be detected or isolated from the respiratory tract for up to several months after resolution of the pneumonia (20). These features are typical of many mycoplasmal respiratory infections and highlight the importance of the host inflammatory and immune response in the disease. Other than the attachment tip structure possessed by some species such as M. pneumoniae (24, 25), mycoplasma factors that confer virulence and resistance to the host immune system are not well understood.

Murine respiratory mycoplasmosis (MRM) caused by Mycoplasma pulmonis represents a model of interactions between the murine host and its natural pathogen. MRM has features similar to the respiratory mycoplasmoses seen in humans and animals (7, 8). MRM has an acute, often fatal, phase which is associated with large influxes of neutrophils and edema into the terminal airspaces and a chronic phase that is associated with peribronchial accumulations of lymphocytes (27). M. pulmonis produces a set of phase-variable surface antigens (Vsa) which influence virulence (10, 40). The Vsa proteins modulate the ability of the mycoplasma to adhere to polystyrene, to adsorb red blood cells (48), and to adsorb mycoplasma virus P1 (13). The vsa locus of M. pulmonis strain UAB CT codes for a repertoire of seven different phase-variable Vsa proteins (VsaA, VsaC, VsaE, VsaF, VsaG, VsaH, and VsaI). Variation in vsa gene expression results from site-specific DNA inversions that combine one of the seven vsa genes with the vsa expression site (2, 34, 37). Most vsa genes have an extensive tandem repeat region at the 3′ end. In addition to phase variation, variation in the number of tandem repeats results in size variation of Vsa (2). The production of VsaH by M. pulmonis is associated with the ability to adhere to plastic (polystyrene adherence-positive [PA+] phenotype) and to hemadsorb (hemadsorption-positive [HA+] phenotype), while cells that produce VsaA are reported to be HA− and PA− (44, 45). Anecdotal reports link VsaH production to experimentally induced chronic airway infection in mice, while VsaA production is linked to the acute alveolar form of MRM (39, 48).

Little is known about how mycoplasmal surface proteins affect host interactions. Vsa variation, as well as the variation of surface molecules in other mycoplasmas, has been proposed to function in evasion of the host immune system and/or to function in tissue tropism (9, 34, 37, 49). Several cytadherence molecules of the M. pneumoniae tip structure mediate attachment to the host epithelium (23). Many species of mycoplasmas lack an attachment tip yet adhere well to epithelial surfaces, presumably as a result of the presence of surface molecules that mediate cytadherence. Many mycoplasmas are resistant to complement-mediated killing (3), but no studies have linked any mycoplasmal surface protein with serum resistance. In Mycoplasma hyorhinis, the length of the tandem repeat region of the Vlp surface proteins is associated with resistance to metabolic inhibition by specific antibodies (9).

The Vsa proteins affect the surface properties of M. pulmonis and thereby have the potential to affect host-pathogen interactions. We report here on the analysis of variants of M. pulmonis strain UAB CT that produce a shortened form of the VsaA protein and are HA+ and PA+. Thus, factors other than VsaH can mediate PA and HA. Additionally, we show that M. pulmonis variants that produce short forms of VsaA are highly susceptible to complement killing whereas variants that produce longer forms are serum resistant. Our studies are the first to associate a mycoplasmal protein (VsaA) with resistance to complement and with the modulation of other surface properties such as HA.

MATERIALS AND METHODS

Mycoplasma strains and characterization.

The murine pathogen M. pulmonis strain UAB CT (12) was passaged in mycoplasma broth 12 times and designated strain CTp12. M. pulmonis strains CT182 and CT228 are previously described (38, 42) mutants of strain CTp12 that contain transposon Tn4001T (14) inserted in their genomes at nucleotide positions 652759 and 656621, respectively. In strain CT228, the transposon disrupts the gene encoding the HvsR recombinase that catalyzes vsa gene rearrangement (38). Thus, strain CT228 produces VsaA and cannot switch to production of an alternative Vsa protein. In strain CT182, Tn4001T truncates the last codon of the vsaH gene. M. pulmonis strain CT39-6-2 was derived from UAB strain CT39-6, a VsaH-producing M. pulmonis variant that is associated with causing the airway form of MRM (39, 48). Some properties of the M. pulmonis strains used in this study are summarized in Table 1.

TABLE 1.

Summary of the characteristics of the M. pulmonis strains used in this study

Strain(s) Vsa protein Mode HA score PA Complement susceptibilitya Comment
CT182 VsaA R3 3 + NDb
CT182R3-1, -2, and -3 VsaA R3 2 + S Filter clones from CT182
CT182R40-1, -2, and -3 VsaA R40 1 − R Filter clones from CT182
CT182R3R40-1 and -2 VsaA R40 ND ND R R3 survivors from complement killing assay
CT39-6-2 VsaH 2 + S
CT228 VsaA R40 1 − R hvsR mutant of CTp12
CTp12 VsaA R40 0 − R
a

Complement susceptibility presented as R for resistant and S for sensitive to complement.

b

ND, not done.

Mycoplasmas were grown in mycoplasma broth supplemented with 10% heat-inactivated whole horse serum (HyClone) as described previously (11). Cultures containing 107 CFU/ml in broth supplemented with 10% glycerol were stored at −80°C in 1.5-ml aliquots. The vsa gene that occupied the vsa expression site of the M. pulmonis strain in a cell culture was determined by semiquantitative PCR using methods and primers previously described (18). PCR analysis with a forward primer (o.6666) that binds to the vsa expression site (18) and a vsaA-specific reverse primer (5′ TTTTGTCTAATTTATTGAACCTG 3′) was used to determine the nucleotide length of the vsaA tandem repeat region. The nucleotide sequence of the resulting PCR product was determined using oligonucleotide primers o.6666 and L4.667 (5′ AAAAACATCAAATAATGAACAAGG 3′). Also, PCR products from the semiquantitative reactions using the vsaA primer set were sequenced with primer o.6666. The sequence data were analyzed with an ABI PRISM model 377 software package (DNA Synthesis and Sequencing Facility, Iowa State University, Ames, Iowa).

Immunoblot analysis.

Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to nitrocellulose (Bio-Rad) by the method of Towbin et al. (43). All immunological reactions were performed at room temperature as previously described (47). The Vsa-specific monoclonal antibody (MAb) 7.1-2 [immunoglobulin G1(κ)] (44, 47) was diluted 1:500 and the alkaline phosphatase-conjugated secondary sheep anti-murine immunoglobulin G (Serotec, Kidlington, Oxford, United Kingdom) was diluted 1:2,000. The Vsa protein bands were visualized by development of the immunoblots with 5-bromo-4-chloro-3-indolylphosphate (Sigma) as the substrate.

PA.

Frozen starter stocks (25 μl) of M. pulmonis strains UAB CTp12, CT182, and CT228 were used to inoculate 3 ml of mycoplasma broth in a 25-cm2 tissue culture flask (Falcon catalog no. 353082). After overnight growth at 37°C, the broth was pipetted from the flask (nonadherent phase), the flask was gently washed three times with 5 ml of phosphate-buffered saline (PBS) at room temperature, and the attached mycoplasmas were scraped from the bottom of the flask (adherent phase) with a cell scraper (Falcon 353085) into 1 ml of mycoplasma broth. The nonadherent and adherent phases were assayed for CFU to determine the percentage of CFU that had adhered to the flask.

HA.

The HA analysis procedure has been previously described (17). Briefly, the mycoplasmas were serially diluted in mycoplasma broth and grown on 60-mm-diameter mycoplasma agar plates for 5 to 7 days in a humidified incubator at 37°C. Agar plates with 30 to 100 colonies were overlaid with 3 ml of 0.5% sheep red blood cells (sRBC) in 1× PBS and incubated at 37°C for 30 min without rocking. The sRBC suspension was pipetted off, and the plates were gently washed three times by hand rocking with 3 ml of PBS. The colonies were observed with a Leica WILD M3Z dissecting microscope at ×6.5 to ×40 magnification as needed. A colony was assigned an HA score of 0 when few or no sRBC were attached to the colony, a score of 1 when up to 25% of the colony surface area was covered, a score of 2 when 25 to 50% of the colony was covered, a score of 3 when 50 to 75% of the colony was covered, and a score of 4 when 75 to 100% of the colony was covered. The mean HA score (and standard error) and the median and mode HA scores for each strain were determined by pooling the data from several experiments. Images of sRBC adsorbing to representative colonies of the different strains were taken at various magnifications with a Leica HC microscope (Diagnostics Instruments, Inc.) and evaluated with SPOT imaging software.

Complement killing assays.

Complement killing of M. pulmonis strains was performed on the basis of the results of assays by Taylor-Robinson et al. (41). Briefly, lyophilized guinea pig complement (Colorado Serum Company, Denver, Colo.) was rehydrated, aliquoted, and stored at −80°C until use. Several aliquots were heat inactivated at 56°C for 30 min before being frozen for storage. Complement or heat-inactivated complement was diluted to 20% in sterile normal saline (0.9% NaCl) at 4°C. Approximately 104 CFU of the mycoplasma strain in 50 μl of broth was added to a 1.5-ml microcentrifuge tube containing 50 μl of the diluted complement, heat-inactivated complement, or normal saline. Mg2+ and Ca2+ were supplemented to the reaction mixtures at final concentrations of 5 and 1 mM, respectively. After incubation in a water bath at 37°C for 30 min, the tubes were placed on ice and the contents were serially diluted in mycoplasma broth and assayed for CFU. In all cases, several replicate tubes were assayed. The data for each replicate tube were represented as the fraction of CFU recovered after complement treatment relative to that recovered after treatment with heat-inactivated complement. The M. pulmonis strains that were derived from strain CT182 and used in the complement killing assays were CT182R3-1, CT182R3-2, CT182R40-1, and CT182R40-2. Colony strains that were isolated and recovered after strain CT182R3-2 was incubated with complement (i.e., strains CT182R3R40-1 and CT182R3R40-2) are referred to as R3 (VsaA with 3 tandem repeats) survivors and produce a VsaA protein with about 40 tandem repeats (VsaAR40).

Statistical analysis.

Statistical analysis was performed with a Sigma Stat version 2.03 software package (SPSS Inc., Chicago, Ill.). Data were analyzed by analysis of variance by comparing the complement killing or polystyrene attachment of all the strains producing VsaA R40 to those producing the short VsaA R3 and to those producing VsaH. Analysis of variance was also used to compare the level of killing of each strain to those of all other strains. All pairwise multiple comparisons were performed by a Student-Newman-Keuls method. P values of ≤0.001 were considered significant.

RESULTS

M. pulmonis strain CT182 produces a short (R3) form of VsaA.

Immunoblot analysis of the M. pulmonis strains using the Vsa-specific MAb showed the typical Vsa ladder pattern (46, 47), with the apparent molecular mass of the uppermost, major band being in excess of 200 kDa (strain CTp12), about 180 kDa (strain CT228), and about 30 kDa (strain CT39-6-2) (Fig. 1). Strain CT182 had a predominant Vsa band that migrated at an apparent molecular mass of 60 kDa in addition to other major bands indicative of a mixed population of cells producing Vsa protein variants. Subcloning of this parental CT182 strain yielded progeny producing a variety of Vsa molecules ranging from 60 to more than 200 kDa (Fig. 1B). Strains CT182R3-1, CT182R3-2, and CT182R3-3 are subclones of strain CT182 that produced a Vsa protein (results for representative strain CT182R3-1 are shown in Fig. 1B, lane -R3-1) that comigrated with the 60-kDa major band of the parental CT182 strain (Fig. 1A). Strain CT182R40-1 produced a Vsa protein of 150 kDa, while strains CT182R40-2 and CT182R40-3 produced a VsaA protein of about 200 kDa.

FIG. 1.

FIG. 1.

Western analysis of M. pulmonis proteins detected with Vsa-specific MAb 7.1-2. (A) Analysis of M. pulmonis strains CT228, CT39-6-2, CTp12, and CT182. (B) Analysis of strain CT182 and representative subclones CT182R40-1 (lane -R40-1), CT182R40-2 (lane -R40-2), and CT182R3-1 (lane -R3-1). (C) Analysis of the R3 survivor strains CT182R3R40-1 (lane -R3-R40-1) and CT182R3R40-2 (lane -R3-R40-2).

Semiquantitative PCR analysis using a battery of vsa oligonucleotide primers indicated that more than 95% of the M. pulmonis cells in all stock cultures of CT182 and its progeny tested had the vsaA gene occupying the vsa expression site. Thus, they produced VsaA (18). The nucleotide sequence of the PCR product obtained by PCR amplification using primers that flanked the 3′ vsaA repetitive region revealed that strain CT182 and its R3 progeny had only three tandem copies of the 51-bp vsaA repeat. Thus, these strains are referred to as CT182R3 variants. Most strains of M. pulmonis have 30 to 40 of these tandem repeat units (2, 34, 37). For this reason, we refer to the CT182 strains producing the long form of VsaA as strain CT182R40 variants. Strain CT182 and its R3 variants represent the first isolation of cells producing a short R3 form of VsaA.

M. pulmonis strains that produce the R3 form of VsaA hemadsorb and adhere to polystyrene.

M. pulmonis colonies grown on agar were scored on their ability to adsorb sRBC (Materials and Methods). Their mean, median, and mode HA scores are shown in Table 2. Of the M. pulmonis strain CTp12 colonies, almost none adsorbed sRBC (mode HA score = 0) and virtually all remained HA− even when the PBS washes of the culture plates were omitted. The hvsR mutant strain CT228, which exclusively produces VsaA, had a mode HA score of 1. Although some strain CT228 colonies did not adsorb sRBC and other colonies scored more than 1, the typical pattern of sRBC adsorption was to the margin of the colony (referred to here as ring adsorption). The remainder of the M. pulmonis strains adsorbed sRBC to greater degrees. The mode HA scores were 3 for strain CT182, 2 for the CT182R3 strains, 1 for the CT182R40 strains, and 2 for the CT39-6-2 strain. The results were reproducible over several different experiments. The assays for the CT182R3 colonies (n = 806) versus the CT182R40 colonies (n = 726) were performed separately from the assays for the colonies of strains CT182 (n = 562 colonies), CT228 (n = 680), CTp12 (n = 743), and CT39-6-2 (n = 450).

TABLE 2.

HA and PA analysis of M. pulmonis strain UAB CT-derived clones

CT strain(s) HA result
PA result
Mean score SE Median Mode Score (% attached) SE
CT182 2.6 0.14 3 3 67 0.07
CT39-6-2 2.5 0.08 2 2 55 0.08
CT228 1.4 0.05 1 1 5.9 0.01
CTp12 0.0 0.01 0 0 0.1 0.00
CT182R3-1, -2, and -3 2.5 0.13 2 2 55 0.07
CT182R40-1, -2, and -3 1.3 0.10 1 1 1.3 0.00

Strains that readily hemadsorbed also adhered strongly to the polystyrene surface of tissue culture flasks. Less than 6% of the cells in cultures of M. pulmonis strains CT182R40, CT228, and CTp12, all producing the R40 form of VsaA, adhered to the polystyrene during growth (Table 2). More than 50% of the populations of strains that produced the R3 form of VsaA (CT182R3 and CT182) and VsaH (CT39-6-2) adhered to the polystyrene.

M. pulmonis strain CT variants that produce Vsa R3 are susceptible to complement killing.

As the above-described experiments indicated that VsaA size variation changed the cell surface of the mycoplasma, we reasoned that mycoplasma-host interactions might be affected. Analyses of the efficiency of killing of M. pulmonis by complement in vitro have given mixed results (21, 41). However, a recent comparison of the Vsa proteins produced during the infection of immunocompetent versus immunocompromised mice indicated that Vsa protects the mycoplasma from the host immune system (A. M. Denison and K. Dybvig, unpublished data). We hypothesized that Vsa might affect the susceptibility of M. pulmonis to complement. Table 3 shows the percentages of CFU recovered from reactions in which M. pulmonis strains that produced different forms of Vsa were incubated in 10% dilutions of guinea pig serum (without the addition of M. pulmonis-specific antibody). Only 12% of the CFU of the CT182R3 strains were recovered, while about 94% of the CT182R40 strains were recovered (a statistically significant [P < 0.001] result). This indicates that CT182R3 strains were killed more efficiently than CT182R40 strains. Killing was abolished by heat inactivation of the serum. There was a nonstatistically significant trend for the more efficient complement killing of strain CT182R40-1 (76% of CFU were recovered) than strain CT182R40-2 (109% of CFU were recovered). Strains CT228 and CTp12 were as resistant to complement killing as the CT182R40 strains (P < 0.001). Strain UAB CT39-6-2 (producing VsaH) was significantly more sensitive to complement killing than the mycoplasmas that produced the R40 form of VsaA (P < 0.001). There was not a significant difference in complement sensitivity between the CT182R3 strains and strain CT39-6-2. The R3 survivors of complement-treated CT182R3 that were subjected to immunoblot analysis produced an alternate form of Vsa that resembled VsaA R40 (images of two representative survivors are shown in Fig. 1C). The analysis of two of these variants, strains CT182R3R40-1 and CT182R3R40-2, revealed that they were resistant to complement killing (Table 3).

TABLE 3.

Percentages of CFU of M. pulmonis strain UAB CT-derived clones recovered after complement treatment

CT strain(s) % Recovered after complement treatment (SE) % Recovered after HIA serum treatment (SE) n
CT182R3-1 and -2 12 (2.0) 103 (6.9) 13
CT182R40-1 and -2a 94 (8.9) 109 (8.6) 13
CT39-6-2 26 (6.9) 97 (5.7) 6
CT228 107 (13) 105 (15) 7
CTp12 102 (6.2) 95 (5.5) 6
CT182R3R40-1 and -2 101 (5.5) 116 (8.1) 14
a

A total of 76% of strain CT182R40-1 CFU were recovered (n = 6), while a total of 109% of strain CT182R40-2 CFU were recovered (n = 7). The difference between the results for these two strains was not statistically significant. These data are combined, and the strains are referred to as CT182R40 strains in the text.

DISCUSSION

The innate immune system appears to provide the antimycoplasma host defense in the lungs (4, 5), while adaptive immunity contributes to lung lesion severity in mice infected with M. pulmonis (6, 36). The nature of the lung lesions suggests that the host inflammatory response contributes to MRM, while the chronicity of the disease suggests that M. pulmonis evades the immune system despite an intense immune response. The data we present in this study indicate that variation in the length of the Vsa repetitive region affects M. pulmonis interactions with surfaces (PA and HA) and the innate immune system component complement. Our data also extend previous observations in which VsaA was associated with the HA− and PA− phenotypes and VsaH was associated with the HA+ and PA+ phenotypes (37, 45, 48). These studies indicate that the length of VsaA affects the ability of M. pulmonis to adhere to surfaces. The correlation between HA and PA and their association with both VsaH and VsaA R3 production suggest that the Vsa proteins can exert a general (nonspecific) effect on mycoplasma surface properties. Possibly, Vsa proteins with long repetitive regions hinder access to binding moieties on the mycoplasma surface. These moieties could mediate specific or nonspecific interactions such as hydrophobic attractions (45). Such a nonspecific mechanism would not preclude specific effects mediated by Vsa.

Our data also indicate that VsaA functions in resistance to complement. M. pulmonis strain CT isolates that produced short R3 forms of the VsaA or VsaH were sensitive to killing by guinea pig serum. This killing was eliminated when the serum was heat inactivated. In contrast, strains that produced the R40 form of VsaA were significantly resistant to complement. Resistance to complement was slightly, but not statistically significantly, reduced in strain CT182R40-1 compared to that in strain CT182R40-2. This result could be due to the somewhat smaller VsaA protein (150-kDa major band) in strain CT182R40-1. Most complement-mediated killing of gram-positive bacteria is the result of enhanced opsonophagocytosis resulting from C3 deposition on the bacterial surface (32). Our assays were cell-free. Therefore, the mechanism of killing was mediated by cell lysis, presumably by the insertion of the complement's terminal membrane attack complex into the mycoplasma membrane. The lack of a cell wall should make mycoplasmas inherently susceptible to complement lysis. It follows that pathogenic species of mycoplasma must produce factors, such as the R40 form of VsaA, to evade complement.

The mechanism by which the R40 form of VsaA mediates resistance to complement killing is presently under investigation. It may be that M. pulmonis variants producing any of the other Vsa types (e.g., VsaI) with long C-terminal repetitive regions (34) are also resistant to complement. There are many strategies employed by bacteria to confer complement resistance. Capsular material or surface proteins can hinder the access of many complement components to the surface of the cell or inhibit activation of the complement pathway (32). Feeney et al. (15) determined that intermolecular aggregation was more favorable with peptide sequences with long, perfect, tandem-repetitive sequences than with those with short, imperfect sequences. The VsaA C-terminal repetitive region is comprised of 17 amino acid units that are nearly perfect in sequence. Possibly, the resistance of R40-producing cells to complement killing is due to steric hindrance imparted by the formation of a barrier by VsaA. Alternately, VsaA could bind C3 but inhibit further activation of the complement cascade.

Microorganisms that are resistant to opsonophagocytosis demonstrate an increased virulence in animal models (1, 29). Additionally, mice and humans that lack an intact complement system are susceptible to pulmonary infections and systemic dissemination (16, 33). These relationships underscore the importance of complement as a pulmonary host defense and the importance of resistance to complement as a microbial virulence factor. This is especially so when the mechanism of resistance involves phase-variable molecules. As the Vsa system is a phase-variable system, M. pulmonis may use a strategy in which increased abilities to adhere to surfaces, even in the case of increased susceptibility to complement, are beneficial. Whether the resistance of M. pulmonis to complement killing can alter the outcome of MRM remains to be determined, but the implications are clear. Mycoplasma cells that are resistant to complement killing could still be opsonized but not cleared by alveolar phagocytes. As alveolar macrophages have been shown to be an important host defense for clearing M. pulmonis from the respiratory tract (30, 31), mycoplasma-complement interactions might have a profound effect on MRM pathogenesis. Thus, defining the interactions between phagocytes, M. pulmonis, and complement will better define the role of the Vsa proteins in mycoplasmoses. The implications go further in that mycoplasmal resistance to complement killing might enhance the ability of mycoplasmas to disseminate to other tissues (4, 22).

Mycoplasmal resistance to complement killing has significance for human respiratory and systemic mycoplasmoses. Respiratory infections with mycoplasmas lead to exacerbations of airway hypersensitivity in asthmatics (28, 50), increased influxes of polymorphonuclear cells in the airspaces, and chronic infections that are difficult to clear (27). Activated (surface-bound) complement results in the release of anaphylatoxins and chemotactic agents (e.g., C3a and C5a) (16, 33). The ability of a mycoplasma to resist immune killing despite complement deposition and the resultant release of immunomodulatory substances could define a potential host-pathogen mechanism that is responsible for the lung injury seen in human mycoplasmoses.

Acknowledgments

We thank P. Caldwell for technical assistance.

This work was supported by Public Health Service grants GM51126 and Al41113 from the National Institutes of Health.

Editor: J. N. Weiser

REFERENCES

  • 1.Alitalo, A., T. Meri, L. Ramo, T. S. Jokiranta, T. Heikkila, I. J. T. Seppala, J. Oksi, M. Viljanen, and S. Meri. 2001. Complement evasion by Borrelia burgdorferi: serum-resistant strains promote C3b inactivation. Infect. Immun. 69:3685-3691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bhugra, B., L. L. Voelker, N. Zou, H. Yu, and K. Dybvig. 1995. Mechanism of antigenic variation in Mycoplasma pulmonis: interwoven, site-specific DNA inversions. Mol. Microbiol. 18:703-714. [DOI] [PubMed] [Google Scholar]
  • 3.Bredt, W., M. Kist, and E. Jacobs. 1981. Phagocytosis and complement action. Isr. J. Med. Sci. 17:637-640. [PubMed] [Google Scholar]
  • 4.Cartner, S. C., J. R. Lindsey, J. Gibbs-Erwin, G. H. Cassell, and J. W. Simecka. 1998. Roles of innate and adaptive immunity in respiratory mycoplasmosis. Infect. Immun. 66:3485-3491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Cartner, S. C., J. W. Simecka, D. E. Briles, G. H. Cassell, and J. R. Lindsey. 1996. Resistance to mycoplasmal lung disease in mice is a complex genetic trait. Infect. Immun. 64:5326-5331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Cartner, S. C., J. W. Simecka, J. R. Lindsey, G. H. Cassell, and J. K. Davis. 1995. Chronic respiratory mycoplasmosis in C3H/HeN and C57BL/6N mice: lesion severity and antibody response. Infect. Immun. 63:4138-4142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cassell, G. H. 1982. Derrick Edward Award lecture. The pathogenic potential of mycoplasmas: Mycoplasma pulmonis as a model. Rev. Infect. Dis. 4:S18-34. [DOI] [PubMed] [Google Scholar]
  • 8.Cassell, G. H., J. W. A. Clyde, and J. K. Davis. 1985. Mycoplasmal respiratory infections, p. 65-106. In S. Razin and M. F. Barile (ed.), The mycoplasmas: mycoplasma pathogenicity, vol. 4. Academic Press, Orlando, Fla.
  • 9.Citti, C., M. F. Kim, and K. S. Wise. 1997. Elongated versions of Vlp surface lipoproteins protect Mycoplasma hyorhinis escape variants from growth-inhibiting host antibodies. Infect. Immun. 65:1773-1785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Davidson, M. K., J. R. Lindsey, J. K. Davis, R. F. Parker, S. E. Ross, H. L. Watson, J. G. Tully, and G. H. Cassell. 1990. Alternative approach to identification of virulence mechanisms of Mycoplasma pulmonis, p. 695-697. In G. Stanek, G. H. Cassell, J. G. Tully, and R. F. Whitcomb (ed.), Recent advances in mycoplasmology, vol. 20. Gustav Fischer Verlag, New York, N.Y.
  • 11.Davidson, M. K., J. R. Lindsey, R. F. Parker, J. G. Tully, and G. H. Cassell. 1988. Differences in virulence for mice among strains of Mycoplasma pulmonis. Infect. Immun. 56:2156-2162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Davis, J. K., R. B. Thorp, R. F. Parker, H. White, D. Dziedzic, J. D'Arcy, and G. H. Cassell. 1986. Development of an aerosol model of murine respiratory mycoplasmosis in mice. Infect. Immun. 54:194-201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Dybvig, K., J. Alderete, H. L. Watson, and G. H. Cassell. 1988. Adsorption of mycoplasma virus P1 to host cells. J. Bacteriol. 170:4373-4375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Dybvig, K., C. T. French, and L. L. Voelker. 2000. Construction and use of derivatives of transposon Tn4001 that function in Mycoplasma pulmonis and Mycoplasma arthritidis. J. Bacteriol. 182:4343-4347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Feeney, K. A., N. Weener, S. M. Gilbert, N. G. Halford, A. S. Tatham, P. R. Shewry, and P. S. Belton. 2003. Molecular structures and interactions of repetitive peptides based on wheat glutenin subunits depend on chain length. Biopolymers 72:123-131. [DOI] [PubMed] [Google Scholar]
  • 16.Figueroa, J. E., and P. Densen. 1991. Infectious diseases associated with complement deficiencies. Clin. Microbiol. Rev. 4:359-395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Gardella, R. S., and R. A. DelGiudice. 1983. Hemagglutination, hemadsorption, and hemolysis, p. 379-384. In S. Razin and J. G. Tully (ed.), Methods in mycoplasmology. Academic Press, New York, N.Y.
  • 18.Gumulak-Smith, J., A. Teachman, A. H. Tu, J. W. Simecka, J. R. Lindsey, and K. Dybvig. 2001. Variations in the surface proteins and restriction enzyme systems of Mycoplasma pulmonis in the respiratory tract of infected rats. Mol. Microbiol. 40:1037-1044. [DOI] [PubMed] [Google Scholar]
  • 19.Hardy, R. D., H. S. Jafri, K. Olsen, J. Hatfield, J. Iglehart, B. B. Rogers, P. Patel, G. H. Cassell, G. H. McCracken, and O. Ramilo. 2002. Mycoplasma pneumoniae induces chronic respiratory infection, airway hyperreactivity, and pulmonary inflammation: a murine model of infection-associated chronic reactive airway disease. Infect. Immun. 70:649-654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hardy, R. D., H. S. Jafri, K. Olsen, M. Wordemann, J. Hatfield, B. B. Rogers, P. Patel, L. Duffy, G. H. Cassell, G. H. McCracken, and O. Ramilo. 2001. Elevated cytokine and chemokine levels and prolonged pulmonary airflow resistance in a murine Mycoplasma pneumoniae pneumonia model: a microbiologic, histologic, immunologic, and respiratory plethysmographic profile. Infect. Immun. 69:3869-3876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Jones, T. C., and L. Yang. 1977. Attachment and ingestion of mycoplasmas by mouse macrophages. Am. J. Pathol. 87:331-345. [PMC free article] [PubMed] [Google Scholar]
  • 22.Keystone, E., D. Taylor-Robinson, C. Pope, G. Taylor, and P. Furr. 1978. Effect of inherited deficiency of the fifth component of complement on arthritis induced in mice by Mycoplasma pulmonis. Arthritis Rheum. 21:792-797. [DOI] [PubMed] [Google Scholar]
  • 23.Krause, D. C. 1998. Mycoplasma pneumoniae cytadherence: organization and assembly of the attachment organelle. Trends Microbiol. 6:15-18. [DOI] [PubMed] [Google Scholar]
  • 24.Krause, D. C., D. K. Leith, and J. B. Baseman. 1983. Reacquisition of specific proteins confers virulence in Mycoplasma pneumoniae. Infect. Immun. 39:830-836. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Krause, D. C., D. K. Leith, R. M. Wilson, and J. B. Baseman. 1982. Identification of Mycoplasma pneumoniae proteins associated with hemadsorption and virulence. Infect. Immun. 35:809-817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Krause, D. C., and D. Taylor-Robinson. 1992. Mycoplasmas which infect humans, p. 417-444. In J. Maniloff, R. N. McElhaney, L. R. Finch, and J. B. Baseman (ed.), Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology, Washington, D.C.
  • 27.Lindsey, J. R., and G. H. Cassell. 1973. Experimental Mycoplasma pulmonis infection in pathogen-free mice. Am. J. Pathol. 72:63-83. [PMC free article] [PubMed] [Google Scholar]
  • 28.Martin, R. J., H. W. Chu, J. M. Honour, and R. J. Harbeck. 2001. Airway inflammation and bronchial hyperresponsiveness after Mycoplasma pneumoniae infection in a murine model. Am. J. Respir. Cell Mol. Biol. 24:577-582. [DOI] [PubMed] [Google Scholar]
  • 29.Neeleman, C., S. P. Geelen, P. C. Aerts, M. R. Daha, T. E. Mollnes, J. J. Roord, G. Posthuma, H. van Dijk, and A. Fleer. 1999. Resistance to both complement activation and phagocytosis in type 3 pneumococci is mediated by the binding of complement regulatory protein factor H. Infect. Immun. 67:4517-4524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Parker, R. F., J. K. Davis, D. K. Blalock, R. B. Thorp, J. W. Simecka, and G. H. Cassell. 1987. Pulmonary clearance of Mycoplasma pulmonis in C57BL/6N and C3H/HeN mice. Infect. Immun. 55:2631-2635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Parker, R. F., J. K. Davis, G. H. Cassell, H. White, D. Dziedzic, D. K. Blalock, R. B. Thorp, and J. W. Simecka. 1989. Short-term exposure to nitrogen dioxide enhances susceptibility to murine respiratory mycoplasmosis and decreases intrapulmonary killing of Mycoplasma pulmonis. Am. Rev. Respir. Dis. 140:502-512. [DOI] [PubMed] [Google Scholar]
  • 32.Rautemaa, R., G. A. Jarvis, P. Marnila, and S. Meri. 1998. Acquired resistance of Escherichia coli to complement lysis by binding of glycophosphoinositol-anchored protectin (CD59). Infect. Immun. 66:1928-1933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Regal, J. F. 1997. Role of the complement system in pulmonary disorders. Immunopharmacology 38:17-25. [DOI] [PubMed] [Google Scholar]
  • 34.Shen, X., J. Gumulak, H. Yu, C. T. French, N. Zou, and K. Dybvig. 2000. Gene rearrangements in the vsa locus of Mycoplasma pulmonis. J. Bacteriol. 182:2900-2908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Simecka, J. W., J. K. Davis, M. K. Davidson, S. E. Ross, C. T. K.-H. Städtlander, and G. H. Cassell. 1992. Mycoplasma diseases of animals, p. 391-415. In J. Maniloff, R. N. McElhaney, L. R. Finch, and J. B. Baseman (ed.), Mycoplasmas: molecular biology and pathology. American Society for Microbiology, Washington, D.C.
  • 36.Simecka, J. W., P. Patel, J. K. Davis, and G. H. Cassell. 1989. Upper respiratory tract is the major site of antibody production in mycoplasmal induced chronic respiratory disease. Reg. Immunol. 2:385-389. [PubMed] [Google Scholar]
  • 37.Simmons, W. L., C. Zuhua, J. I. Glass, J. W. Simecka, G. H. Cassell, and H. L. Watson. 1996. Sequence analysis of the chromosomal region around and within the V-1-encoding gene of Mycoplasma pulmonis: evidence for DNA inversion as a mechanism for V-1 variation. Infect. Immun. 64:472-479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Sitaraman, R., A. M. Denison, and K. Dybvig. 2002. A unique, bifunctional site-specific DNA recombinase from Mycoplasma pulmonis. Mol. Microbiol. 46:1033-1040. [DOI] [PubMed] [Google Scholar]
  • 39.Stadtlander, C. T., H. L. Watson, J. W. Simecka, and G. H. Cassell. 1991. Cytopathic effects of Mycoplasma pulmonis in vivo and in vitro. Infect. Immun. 59:4201-4211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Talkington, D. F., M. T. Fallon, H. L. Watson, R. K. Thorp, and G. H. Cassell. 1989. Mycoplasma pulmonis V-1 surface protein variation: occurrence in vivo and association with lung lesions. Microb. Pathog. 7:429-436. [DOI] [PubMed] [Google Scholar]
  • 41.Taylor-Robinson, D., H. U. Schorlemmer, P. M. Furr, and A. C. Allison. 1978. Macrophage secretion and the complement cleavage product C3a in the pathogenesis of infections by mycoplasmas and L-forms of bacteria and in immunity to these organisms. Clin. Exp. Immunol. 33:486-494. [PMC free article] [PubMed] [Google Scholar]
  • 42.Teachman, A. M., C. T. French, H. Yu, W. L. Simmons, and K. Dybvig. 2002. Gene transfer in Mycoplasma pulmonis. J. Bacteriol. 184:947-951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76:4350-4354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Watson, H. L., D. K. Blalock, and G. H. Cassell. 1988. Characterization of the variable V-1 antigen of Mycoplasma pulmonis, p. 529-534. In G. Stanek, G. H. Cassell, J. G. Tully, and R. F. Whitcomb (ed.), Recent advances in mycoplasmology, vol. 20. Gustav Fischer Verlag, New York, N.Y.
  • 45.Watson, H. L., D. K. Blalock, and G. H. Cassell. 1990. Relationship of hydrophobicity of the V-1 antigen of Mycoplasma pulmonis to adherence. Rec. Adv. Mycoplasmol. 20:650-654. [Google Scholar]
  • 46.Watson, H. L., K. Dybvig, D. K. Blalock, and G. H. Cassell. 1989. Subunit structure of the variable V-1 antigen of Mycoplasma pulmonis. Infect. Immun. 57:1684-1690. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Watson, H. L., L. S. McDaniel, D. K. Blalock, M. T. Fallon, and G. H. Cassell. 1988. Heterogeneity among strains and a high rate of variation within strains of a major surface antigen of Mycoplasma pulmonis. Infect. Immun. 56:1358-1363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Watson, H. L., X. Zheng, and G. H. Cassell. 1993. Structural variations and phenotypic switching of mycoplasmal antigens. Clin. Infect. Dis. 17:S183-S186. [DOI] [PubMed] [Google Scholar]
  • 49.Wise, K. S., D. Yogev, and R. Rosengarten. 1992. Antigenic variation, p. 473-490. In J. Maniloff, R. N. McElhaney, L. R. Finch, and J. B. Baseman (ed.), Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology, Washington, D.C.
  • 50.Yano, T., Y. Ichikawa, S. Komatu, S. Arai, and K. Oizumi. 1994. Association of Mycoplasma pneumoniae antigen with initial onset of bronchial asthma. Am. J. Respir. Crit. Care Med. 149:1348-1353. [DOI] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES