Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2003 Oct;71(10):5633–5639. doi: 10.1128/IAI.71.10.5633-5639.2003

The luxS Gene of Streptococcus pyogenes Regulates Expression of Genes That Affect Internalization by Epithelial Cells

Mehran J Marouni 1, Shlomo Sela 2,*
PMCID: PMC201110  PMID: 14500483

Abstract

The gram-positive pathogen Streptococcus pyogenes was recently reported to possess a homologue of the luxS gene that is responsible for the production of autoinducer 2, which participates in quorum sensing of both gram-positive and gram-negative bacteria. To test the effect of LuxS on streptococcal internalization, a LuxS mutant was constructed in strain SP268, an invasive M3 serotype. Functional analysis of the mutant revealed that it was internalized by HEp-2 cells with higher efficiency than the wild type (wt). Several genes, including hasA (hyaluronic acid synthesis), speB (streptococcal pyrogenic exotoxin B), and csrR (capsule synthesis regulator), a part of a two-component regulatory system, are known to affect the internalization of strain SP268 (J. Jadoun, O. Eyal, and S. Sela, Infect. Immun. 70:462-469, 2002). Therefore, the expression of these genes in the mutant and in the wt was examined. LuxS mutation significantly reduced the mRNA level of speB and increased the mRNA level of emm3. No substantial effect was observed on transcription of hasA and csrR. Yet less hyaluronic acid capsule was expressed in the mutant. Further analysis revealed that luxS is under the regulation of the two-component global regulator CsrR. Our results indicate that LuxS activity in strain SP268 plays an important role in the expression of virulence factors associated with epithelial cell internalization.


Many species of bacteria regulate gene expression in response to cell population density through a mechanism called quorum sensing (14, 20). Intercellular communication controls gene expression in response to population density (10, 40). Response to environmental stress enables bacteria to acquire an adaptive response to provide significant benefits in the colonization of hosts, defense against competitors, adaptation to varying physical conditions, cellular differentiation, and species evolution (36). Cell-cell communication in the quorum-sensing process involves the synthesis, secretion, and detection of extracellular signaling molecules termed autoinducers. When these molecules reach a critical threshold concentration within a population, a signal transduction cascade is triggered, which forms the basis for alterations in gene expression (2).

In gram-negative bacteria, autoinducers are known to be derivatives of N-acyl homoserine lactones, which diffuse freely in and out of cells and interact directly with intracellular regulatory proteins (2). In gram-positive bacteria, autoinducers are generally secreted peptides that are processed from larger propeptides. These peptide autoinducers function as ligands for signal receptors such as two-component membrane-bound sensor with histidine protein kinase activity (2, 21). Recently, another quorum-sensing system has been identified that produces the signaling molecule autoinducer-2 (AI-2) in Vibrio harveyi (40). This system is highly conserved in both gram-positive and gram-negative bacteria and is likely to be used for interspecies communication (1). AI-2 is detected by a sensory histidine kinase located within the cytoplasmic membrane (32), and its chemical structure has recently been predicted as a furanone (33). A gene termed luxS has been identified that is essential for the production of AI-2 (39, 40). This gene is highly conserved among numerous bacterial species, including both gram-positive and gram-negative bacteria (24). In pathogenic bacteria, the AI-2 signaling system plays an important role in the regulation of virulence factors, including the type III secretion system in enterohemorrhagic Escherichia coli (37). However, the role of the AI-2 system in the regulation of virulence genes is still unclear in many pathogenic bacteria.

Group A streptococcus (GAS) is a major human pathogen that causes a wide array of diseases ranging from mild pharyngotonsillitis and pyodermas to severe and life-threatening infections. Poststreptococcal sequelae of acute rheumatic fever and glomerulonephritis might also be caused by this pathogen (8, 12). The apparent increase in incidences of severe invasive infections during the last 2 decades has promoted intensive research on GAS pathogenesis (8, 34, 38). Much knowledge has now been accumulated regarding adherence to, and internalization of, GAS by epithelial cells. Numerous surface-associated and secreted components have been implicated in GAS internalization, including M protein (4, 11, 17), hyaluronic acid (HA) capsule (18, 35, 43), and streptococcal pyrogenic exotoxin B (SpeB) (5, 7, 42).

Recently, the presence of a luxS homolog in GAS was reported by Lyon et al., and the expression of AI-2 was demonstrated (23). Lyon et al. have generated a mutation in luxS and found the aberrant expression of several virulence properties that are regulated in response to growth phase, including enhanced hemolytic activity linked with an increase in expression of the hemolysin S-associated gene (sagA) and a dramatic reduction in the expression, but not transcription, of secreted proteolytic activity SpeB. These findings suggest that luxS has a prominent role in the regulation of GAS virulence gene factors (23). Here we report on the role of luxS gene on expression of virulence factors in GAS and the effect upon internalization by HEp-2 epithelial cells.

MATERIALS AND METHODS

Bacterial strains, plasmids, and tissue culture cells.

GAS strain SP268 serotype M3 was originally isolated from a patient with an invasive disease (28). The hasA and speB isogenic mutants of SP268 were previously described (19). Streptococcal strains were grown in Todd-Hewitt broth (Difco Laboratories, Detroit, Mich.) supplemented with 0.2% yeast extract (THY). Strains were grown in standing culture overnight (16 h) at 37°C. E. coli strain DH5αMCR (Life Technologies, Paisley, United Kingdom) was used for cloning procedures. Antibiotics were used at the following concentrations: for GAS, erythromycin (1 μg/ml); for E. coli, erythromycin (500 μg/ml). The epithelial cell line employed in this study was HEp-2 (human larynx). The cells were maintained in Dulbecco's modified Eagle medium containing 2 mM l-glutamine and 10% fetal calf serum (Biological Industries, Kibbutz Bet-HaEmek, Israel) and supplemented with 200 μg of streptomycin/ml and 200 U of penicillin/ml.

DNA techniques.

Purification of GAS chromosomal DNA and plasmid electroporation were performed as previously described (6). Restriction enzymes, T4-DNA ligase, and Taq polymerase were used according to the manufacturer's instructions (Fermentas Inc., Hanover, Md.). Purifications of plasmids and PCR-amplified fragments were performed with the Plasmid Midi kit (Qiagen Inc., Santa Clarita, Calif.) and High Pure PCR product purification kit (Boehringer Mannheim, GmbH, Mannheim, Germany), respectively.

Site-specific mutagenesis of the luxS gene.

An in-frame deletion in luxS was constructed, as depicted in Fig. 1. DNA primers of the luxS gene were designed based on the Streptococcus pyogenes genome sequence. Primer pairs Pse-104-Pse-105 and Pse-106-Pse-107 were used to amplify a 1,412-bp DNA fragment consisting of the 5′ region of luxS and a 533-bp fragment consisting of the 3′ end of the gene, respectively (Table 1). Amplification was performed in a PCR machine (PTC-150, MiniCycler MJ RESEARCH) using a 5-min hot start and the following reaction conditions: 94°C for 1 min, 58°C for 1 min, and 72°C for 1 min for 33 cycles. The 1,412-bp DNA fragment was digested with BamHI and XbaI, and the product was ligated to an XbaI/HindIII digest of the 533-bp DNA fragment. The ligated fragment, which contained an in-frame deletion of 325 bp in the luxS gene, was ligated to a BamHI/HindIII digest of pJRS233 (kindly provided by J. Scott, Emory University, Atlanta, Ga.). This plasmid is a temperature-sensitive E. coli gram-positive shuttle vector that replicates in gram-positive bacteria at 30°C but not at 37°C (30). The recombinant plasmid pJRS233/luxS was purified from E. coli DH5αMCR and transformed into GAS strain SP268 by electroporation. Integration of the plasmid into the SP268 chromosome and allelic replacement was selected essentially as described previously (18). The presence of a luxS deletion in 20 clones was verified by PCR analysis using primer pair Pse-111-Pse-112 (Table 1; Fig. 1). One clone harboring a smaller PCR product than the wild-type (wt) strain was selected for further analysis. Sequencing data of the amplified chromosomal gene confirmed the presence of the specific in-frame deletion of 325 bp within the luxS gene.

FIG. 1.

FIG. 1.

Construction of the LuxS mutant. Chromosomal DNA regions surrounding an internal DNA fragment of luxS were amplified by PCR, digested, and ligated to each other to generate a fragment with a 325-bp deletion within luxS. The fragment was then ligated to a BamHI/HindIII digest of pJRS233 to create plasmid pJRS233ΔluxS. The recombinant plasmid was introduced into SP268 strain by electroporation. Homologous recombination and allelic replacement resulted in an in-frame chromosomal deletion in luxS. Arrows indicate primers used in the study (see details in Table 1). B, BamHI; X, XbaI; H, HindIII. *, designation according to the complete genome sequence of S. pyogenes MGAS315 (accession number NC_004070).

TABLE 1.

List of oligonucleotide primers used in this study

Primer Sequence Location Source or reference
Pse-75 ACGCTGCGACCAAATTAAACAACTAGAGGAG 3′ region of emm3 31
Pse-76 AACTGCAGAGCTTAGTTTTCTTCTTTGCG 5′ region of emm3 31
Pse-104 CGGGATCCTTGCTACCAGCTTGGTCATT Upstream of luxS gene This study
Pse-105 GCTCTAGACTGCACTAGGCGAACATCAA 5′ of luxS gene This study
Pse-106 GCTCTAGATCCTTTTAGTCGCCATGTCA 3′ of luxS gene This study
Pse-107 CCCAAGCTTGGATCAAGCAGCTCAAGGAC Downstream of luxS gene This study
Pse-111 TCAGCTATTACCGGCTCTTCT Upstream of luxS gene This study
Pse-112 TCAAGGCTGATGCTAATTTTG Downstream of luxS gene This study
PpUC-F GTAAAACGACGGCCAGTG Upstream to MCS of pJRS233
LMB-3 CAGGAAACAGCTATGAC Downstream to MCS of pJRS233
PhasA-F ACGTTATCGTTCACCGTTCCC 5′ region of hasA 9
PhasA-R GGGGCTGCAGAGTGACCTTTTTACGTGCCCC 3′ region of hasA 9
PspeB-F GATCAAAACTTTGCTCGTAACG Upstream region of speB 42
PspeB-R CTAAGGTTTGATGCCTACAACAG Downstream region of speB 42
JL2F TTGCAAGGGTTGTTTGATG 5′ region of csrR 19
JL20R GGCAATCAGTGTAAAGGCAG 3′ region of csrR 19
PrpslF GAATGTAGATGCCTACAATTAACCA 5′ region of rpsL 13
PrpslR TTTACGACTCATTTCTCTCTTTATCCC 3′ region of rpsL 13

Transcription analysis.

Total RNA was isolated from GAS strains as previously described (19). Briefly, 3 ml of bacterial culture from mid-log or stationary phase (overnight) were centrifuged, and the pellet was resuspended in 90 μl of TE (10 mM Tris-HCl [pH 8] and 1 mM EDTA [pH 8]). Five microliters of 10% sodium dodecyl sulfate and 5 μl of Tween lysing solution (2 ml of Tween 20, 5 ml of 1 M Tris-HCl [pH 8.0], 10 ml of 0.5 M EDTA [pH 8.0] and 83 ml of double-distilled water) were added, and the suspension was mixed and incubated at 65°C for 15 min. Total RNA was purified following the addition of TRI reagent according to the manufacturer's instructions (Molecular Research Center, Inc., Cincinnati, Ohio). The pellet (RNA) was immediately frozen in dry ice-acetone solution and was kept at −70°C until used.

DNA probes derived from internal fragments of hasA, speB, csrR, emm3, and luxS genes were PCR amplified from SP268 chromosome using primer pairs PhasA-F-PhasA-R, PspeB-F-PspeB-R, JL2F-JL20R, Pse-75-Pse-76, and Pse-111-Pse-112, respectively (Table 1). A probe derived from the housekeeping gene rpsL served as an internal control to assess the amount of total mRNA in the various samples, as described previously (13). The rpsL probe was amplified using PrpslF and PrpslR primers (Table 1). The probes were labeled by digoxigenin (DIG)-dUTP, according to the manufacturer's instructions (Boehringer Mannheim). For Northern blot hybridization, 5 μg of total RNA was loaded and run on a formaldehyde gel, as described previously (32). The labeled DNA fragments were used to detect the corresponding transcripts following hybridization, according to the manufacturer's instructions (Roche). Visualization of hybridized mRNA bands was performed by adding the chemiluminescent substrate CSPD (Boehringer Mannheim) and exposing the membrane to Kodak film (X-omat AR). To quantify the amount of specific mRNA transcripts, the intensity of the hybridized bands was measured by densitometry using Kodak 1D image analysis software (Eastman Kodak Co., Rochester, N.Y.). Intensities of hybridizing bands were quantified by densitometry, and the relative abundance of each specific message was calculated as the ratio of the message of interest to that of the fluorescence intensity of the 23S rRNA band obtained for the identical sample. Intensities of the transcripts derived only from exponential growth cultures were also compared to the intensity of the rpsL-hybridized band in each lane. Both quantification methods yielded similar results.

Quantification of cysteine protease activity.

Cysteine protease activity was measured by the azocasein assay, as described previously (42). Briefly, 200 μl of overnight culture supernatant was added to 400 μl of a prewarmed reaction mixture (2.7 mg of azocasein per ml in 50 mM Tris-HCl [pH 8.0]), and the mixture was incubated at 37°C for 20 min. The reaction was stopped by addition of 100 μl of 15% ice-cold trichloroacetic acid and incubation on ice for 15 min. After centrifugation, an equal volume of 0.5 M NaOH was added to the supernatant, and the absorbance was measured at 450 nm. In control experiments, 200 μl of sterile THY medium was used. To verify that the protease activity measured was indeed due to cysteine protease activity, the effect of the specific cysteine-protease inhibitor, E64, on the protease activity was tested. It was found that E64 completely inhibited the protease activity (data not shown).

HA determination.

Bacteria were grown in THY broth (10 ml) to early logarithmic phase and centrifuged, and the pellet was resuspended in 0.5 ml of DDW. Cell-associated HA was extracted once with chloroform (1 ml) at room temperature for 1 h. Samples were then centrifuged, and the aqueous layer was taken for the determination of HA, as described previously (35). HA from Streptococcus zooepidermicus (General Biotechnology, Rehovot, Israel) was used as a standard.

Growth curves.

One milliliter of an overnight culture of each strain was used to inoculate 50 ml of THY broth at 37°C. Samples (1 ml) were removed at hourly intervals, and the absorbance at 600 nm was determined by spectrophotometry (Pye Unicam, SP8-400).

Internalization assays.

Internalization of GAS strains into epithelial cells was determined as described previously (17). Briefly, streptococci (106 CFU) suspended in RPMI-1640 devoid of serum were incubated with epithelial cells for 2 h at 37°C. Nonadherent bacteria were removed by washing with 1 ml of warm RPMI-1640 devoid of serum, and then extracellular adherent bacteria were killed by adding 1 ml of fresh RPMI-1640 supplemented with gentamicin (100 μg/ml) and penicillin (5 μg/ml) for 2 h. Control experiments using bacteria alone in RPMI-1640 or RPMI-1640 containing cell lysates verified that the indicated antibiotic concentrations killed 108 CFU/ml under the assay conditions. The infected monolayer was washed once with RPMI-1640 and lysed with ice-cold DDW (15 min at 4°C). Viable streptococci that survived antibiotic treatment were enumerated by plating serial dilutions (in duplicate) of cell lysate on Trypticase soy agar plates.

Statistical analysis.

All assays were performed in triplicate and repeated at least three times on different days. Statistical analysis was performed by using Student's t test. P values were considered significant if P < 0.05.

RESULTS

Generation and characterization of an isogenic luxS-deficient mutant.

A deletion mutant of strain SP268 was constructed by replacing the wt luxS allele with a disrupted allele containing a 325-bp in-frame deletion, as depicted in Fig. 1. The mutant colonies appeared to be smaller than the wt colonies on Trypticase soy agar plates (data not shown). Therefore, the growth rates of the wt and the mutant strains were studied. No difference in the growth rates was observed in THY broth medium (Fig. 2).

FIG. 2.

FIG. 2.

Growth curve of the LuxS mutant. Bacterial growth of wt (•) and mutant (⧫) strains in THY broth was measured by recording the absorbance of the culture at 600 nm. The results of a single representative experiment are presented.

Uptake of S. pyogenes wt and LuxS mutant by epithelial cells.

Antibiotic protection assays were used to compare the internalization capacity of the wt and isogenic LuxS mutant strains in a HEp-2 cell model. The results showed that the LuxS mutant displayed significantly higher (about fivefold) internalization efficiency compared to the wt (Fig. 3).

FIG. 3.

FIG. 3.

Internalization of strain SP268 and its LuxS mutant. Bacteria were incubated for 2 h with the indicated epithelial cells, washed, and treated with antibiotics for another 2 h. Data are presented as the mean number of intracellular bacteria (CFU) per well that survived antibiotic treatment. The results are the averages of three independent experiments (± standard errors of the mean). *, P < 0.05.

Interactions between luxS and various S. pyogenes virulence genes.

Since several streptococcal virulence genes have been previously implicated in internalization and a mutant deficient in LuxS expression had aberrant expression of several virulence properties (23), we have tested a possible effect of luxS mutation upon the transcription of some virulence genes previously associated with GAS internalization. Northern blot analysis showed that the luxS mutation had no effect on the transcription of hasA and resulted in a slight increase of csrR transcription (Fig. 4). However, the mutant transcribed significantly higher levels of emm3 compared to the wt. In addition, the mutant transcribed significantly less (more than 10-fold) speB mRNA compared to the wt. It has been shown that CsrR affects the transcription of several virulence factors of S. pyogenes, including capsule and SpeB (13, 16, 19, 22). To test whether CsrR also regulates luxS, we have examined the transcription of the luxS gene in a CsrR-deficient mutant. Northern blot analysis of wt, LuxS −, and CsrR − strains revealed that transcription of the luxS gene was much elevated in the CsrR mutant (Fig. 5), suggesting that luxS is repressed by CsrR. Interestingly, transcription of the truncated luxS was found to be much reduced in the LuxS mutant (Fig. 5).

FIG. 4.

FIG. 4.

Transcription analysis of hasA, emm3, speB, and csrR genes. Shown are Northern blots containing 5 μg of total RNA derived from the indicated strains, hybridized with DIG-labeled DNA probes specific for internal parts of the tested genes. Numbers represent relative abundance of the indicated message of the mutant strains and reflect the ratio of the transcript of interest relative to that of the 23S rRNA. The ratios for the mutant strains are shown compared with the wt, which has been assigned a value of 1.0.

FIG. 5.

FIG. 5.

Transcription analysis of the luxS gene. A Northern blot containing 5 μg of total RNA of the indicated strains was hybridized with DIG-labeled DNA probes specific for the luxS gene. Numbers represent relative abundance of the indicated message of the mutant strains and reflect the ratio of the transcript of interest relative to that of the 23S rRNA. The ratios for the mutant strains are shown compared with the wt strain, which has been assigned a value of 1.0.

Activity of SpeB and expression of capsule in the LuxS mutant.

Augmentation of the internalization rate in GAS was previously shown to be associated with inactivation of speB (7, 19). Since the LuxS mutant transcribed significantly less speB mRNA, the elevated internalization rate of the mutant might be related to the lack of speB expression. Therefore, the SpeB cysteine protease activity of the wt and the LuxS mutant was examined. The cysteine-protease activity in the mutant was significantly lower than that of the wt and comparable to that of a SpeB-deficient mutant (Table 2).

TABLE 2.

Relative amounts of cell-associated HA capsule and cysteine protease activity of SP268 and its isogenic mutants

Strain Amt of HAa Cysteine protease activitya
SP268 (wt) 100 ± 14.3 100 ± 5.1
LuxS− 52.3 ± 10.9b 16 ± 2.7b
SpeB− NDc 3.2 ± 1.9b
HasA− 2.7 ± 0.45b ND
a

The amounts of cell-associated capsule or cysteine protease activity were measured as described in Materials and Methods. Data are presented as the percent of the cell-associated capsule (fg/CFU) or cysteine protease activity of the control (SP268) ± standard error of the mean.

b

Statistically significant difference compared to SP268 (P < 0.05).

c

ND, not determined.

It has been demonstrated that GAS internalization is hindered by HA capsule (18, 19, 35). As shown in Table 2, the LuxS mutant expressed about 50% less cell-associated HA than the wt. This may suggest that capsule expression is controlled at a posttranscription level by LuxS and that a lower amount of capsule in the mutant has contributed to the higher internalization rate of the mutant.

DISCUSSION

Conserved luxS homologs exist in over 30 species of both gram-negative and gram-positive bacteria, and it has been proposed that the AI-2 system plays an important role in interspecies communication (2, 40). Recently, Lyon et al. have shown that AI-2 is also expressed in S. pyogenes HSC5, an M6 serotype (23). An insertion mutation in luxS was reported to reduce the secretion and protease activity (but not gene transcription) of SpeB and to increase expression of the hemolysin S-associated gene sagA (23). In this study we have examined the role of LuxS in the internalization of an M3 invasive serotype (SP268) by HEp-2 cells. We have constructed an isogenic mutant harboring an in-frame deletion within the luxS gene. The mutant had a growth rate similar to that of the wt; however, transcription of the emm3 gene was greatly increased. In contrast, transcription of the speB gene and the truncated luxS was much reduced. The effect of the mutation on the transcription of the truncated gene could be attributed simply to instability of the mutated gene. Alternatively, this finding might reflect an autoregulation by the LuxS product.

Our findings contradict those of Lyon et al. in two points. First, these authors have reported that a LuxS mutation resulted in a 30% reduction in growth rate in the same medium as we have used (THY), while we did not observe such a difference. Interestingly, Lyon et al. found no such difference when the strains were grown in C medium, a peptide-rich, carbohydrate-poor medium. It is unlikely that the nature of the luxS mutation in the two studies affected these results, since we have generated an in-frame deletion within the luxS gene, while Lyon et al. have constructed an insertion mutation. However, a control mutant that harbored insertion downstream to luxS had a phenotype similar to the wt, negating the possibility of a polar effect (23). Therefore, the dissimilar results might be strain specific. Second, a defect in SpeB expression was reported that was not associated with impaired speB transcription (23), while we found that reduction in SpeB expression was related to decreased transcription of the gene (Fig. 4). This disparity might be due to the growth medium used to cultivate the bacterium for growing the GAS prior to the preparation of RNA for Northern blot analysis or for SpeB determination. We have employed THY medium, while C medium, an optimal medium to support high-level expression of the GAS cysteine protease, was used by Lyon et al. Furthermore, in the study of Lyon et al., mRNA for transcription analysis of SpeB was isolated from GAS following growth to early stationary phase (4.5 h), while we isolated the mRNA at late stationary phase (overnight 16 h) of GAS. Taken together, it is possible that the growth phase and culture environment utilized in the two studies have differently affected speB regulation.

Although transcription of the hasA gene was not affected in the mutant, it expresses about 50% of the amount of capsule expressed in the wt. The latter observation might indicate that LuxS is also responsible for posttranscriptional control of capsule expression, which might explain the small colony phenotype observed in the mutant.

It might be hypothesized that the effect of LuxS on the expression of SpeB, M3, and capsule is responsible for the increased internalization rate observed in the mutant. Still other, yet-unknown luxS-regulated genes might contribute to this effect. One might also suggest that the LuxS mutant replicates at a higher growth rate than the wt during the internalization assay, which may have a significant impact on interpretation of the internalization data. However, it was previously found that strain SP268 could not replicate in cell culture medium (RPMI-1640) devoid of serum, thus negating this possibility (24). Still, it has recently been reported that GAS could replicate within HEp-2 cells (27). Although we have no indication for such a phenomenon in the SP268 strain, we cannot rule out the possibility that the luxS mutation has affected intracellular replication.

Both capsule SpeB and M3 proteins were previously implicated in GAS internalization (4, 5, 18, 19, 35, 42). Capsule and SpeB impede bacterial uptake (5, 18, 19, 35, 42), while expression of M3 protein promotes internalization (4). SpeB is a cysteine protease that could cleave host cell molecules, such as fibronectin (8), and release several bacterial surface proteins, including C5a peptidase, and M1 protein (3). Previous studies have demonstrated that isogenic speB mutants were internalized better than their wt strains by both endothelial and epithelial cells (5, 19). Since both fibronectin (17, 24, 29, 41) and M3 protein (4) were shown to promote GAS internalization, it is possible that the lack of active SpeB in the LuxS mutant enables intact surface molecules, such as M3 protein and fibronectin-binding molecules, to mediate internalization. Thus, it might be concluded that expression of LuxS directly or indirectly affects the expression of a variety of surface determinants that are also involved in GAS internalization. Unlike other strains, SP268 does not express the Fn-binding protein, PrtF1/SfbI (28), previously associated with GAS internalization (17, 26), and the nature of its fibronectin-binding molecules remains unknown.

In order to adapt to and survive at various niches in the human host, GAS must be able to finely regulate gene expression. It has recently been reported that inactivation of a response regulator of a two-component regulatory system, CsrRS (recently renamed CovRS, for control of virulence) (13), represses transcription of HA capsule (16, 19, 22) and expression of SpeB (16, 19), which are two principle virulence factors that also affect SP268 internalization (19). A recent genome scale analysis revealed that CsrR (CovR) controls, directly and indirectly, the expression of as much as 15% of all GAS chromosomal genes (15). However, the sequence corresponding to the luxS gene was not found among them (15). This might be explained by difference in times where mRNA was extracted (16 h in our study, compared to 10 h). In addition, a low abundance of the luxS transcript in the wt strain and a higher sensitivity of the Northern blot analysis might have influenced these results.

Finally, our results suggest that CsrR also affects the transcription of luxS; therefore, even though this finding has not been reported by Graham et al., some of the CsrR-regulated genes in fact might be controlled at least partially by the AI-2 quorum-sensing system. The majority of bacterial functions controlled by LuxS in pathogenic and nonpathogenic species have not yet been identified (2). Our results provide further insight regarding the role of LuxS in the global network regulatory system of GAS, which regulates, among other things, the expression of major virulence factors and epithelial cell internalization. The current knowledge regarding the interactions between luxS, CsrR, SpeB, capsule, and M3 and their effects upon GAS internalization is summarized in Fig. 6.

FIG. 6.

FIG. 6.

A schematic model showing the interactions between luxS, CsrR, SpeB, capsule, and M3 protein. Positive and negative effect are indicated by + and −, respectively. Solid lines represent effect on gene expression, and lines with dashes indicate effect on internalization. CsrR down-regulates the expression of capsule and transcription of luxS. In contrast, it activates expression of SpeB. AI-2, the product of the LuxS pathway, activates the expression of SpeB and capsule. On the other hand, AI-2 negatively regulates the expression of M3 protein. Both capsule and SpeB negatively affect GAS internalization (5, 19, 35, 42), while expression of M3 protein enhances uptake by epithelial cells (4). The outlined interactions between CsrR, capsule, and SpeB are based on previous reports (13, 16, 18, 19, 22).

Acknowledgments

We thank J. Scott (Emory University, Atlanta, Ga.) for providing pJRS233 plasmid.

This study was supported in part by a grant from the Chief Scientist's Office of the Ministry of Health, Israel, and by a grant from the Israel Science Foundation awarded to S. Sela.

Editor: V. J. DiRita

REFERENCES

  • 1.Bassler, B. L., E. P. Greenberg, and A. M. Stevens. 1997. Cross-species induction of luminescence in the quorum-sensing bacterium Vibrio harveyi. J. Bacteriol. 179:4043-4045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bassler, B. L. 1999. How bacteria talk to each other: regulation of gene expression by quorum sensing. Curr. Opin. Microbiol. 2:582-587. [DOI] [PubMed] [Google Scholar]
  • 3.Berge, A., and L. Bjorck. 1995. Streptococcal cysteine proteinase releases biologically active fragments of streptococcal surface proteins. J. Biol. Chem. 270:9862-9867. [DOI] [PubMed] [Google Scholar]
  • 4.Berkower, C., M. Ravins, A. E. Moses, and E. Hanski. 1999. Expression of different group A streptococcal M proteins in an isogenic background demonstrates diversity in adherence to and invasion of eukaryotic cells. Mol. Microbiol. 31:1463-1475. [DOI] [PubMed] [Google Scholar]
  • 5.Burns, E. H., Jr., S. Lukomski, J. Rurangirwa, A. Podbielski, and J. M. Musser. 1998. Genetic inactivation of the extracellular cysteine protease enhances in-vitro internalization of group A streptococci by human epithelial and endothelial cells. Microb. Pathog. 24:333-339. [DOI] [PubMed] [Google Scholar]
  • 6.Caparon, M. G., and J. R. Scott. 1991. Genetic manipulation of pathogenic streptococci. Methods Enzymol. 204:556-586. [DOI] [PubMed] [Google Scholar]
  • 7.Chaussee, M. S., R. L. Cole, and J. P. Van-Putten. 2000. Streptococcal erythrogenic toxin B abrogates fibronectin-dependent internalization of Streptococcus pyogenes by cultured mammalian cells. Infect. Immun. 68:3226-3232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cunningham, M. W. 2000. Pathogenesis of group A streptococcal infections. Clin. Microbiol. Rev. 13:470-511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.DeAngelis, P. L., J. Papaconstantinou, and P. H. Weigerl. 1993. Molecular cloning, identification, and sequence of the hyaluronan synthase gene from group A Streptococcus pyogenes. J. Biol. Chem. 268:19181-19184. [PubMed] [Google Scholar]
  • 10.De Kievit, T. R., and B. H. Iglewski. 2000. Bacterial quorum sensing in pathogenic relationships. Infect. Immun. 68:4839-4849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Dombek, P. E., D. Cue, J. Sedgewick, H. Lam, S. Ruschkowski, B. Finlay, and P. P. Cleary. 1999. High-frequency intracellular invasion of epithelial cells by serotype M1 group A streptococci: M1 protein mediated invasion and cytoskeletal rearrangements. Mol. Microbiol. 31:859-870. [DOI] [PubMed] [Google Scholar]
  • 12.Efstratiou, A. 2000. Group A streptococci in the 1990s. J. Antimicrob. Chemother. 45:S3-S12. [DOI] [PubMed] [Google Scholar]
  • 13.Federle, M. J., K. S. McIver, and J. R. Scott. 1999. A response regulator that represses transcription of several virulence operons in the group A streptococcus. J. Bacteriol. 181:3649-3657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Fuqua, W. C., S. C. Winans, and E. P. Greenberg. 1994. Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators. J. Bacteriol. 176:269-275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Graham, M. R., L. M. Smoot, C. A. Lux Migliaccio, K. Virtaneva, D. E. Sturdevant, S. F. Porcella, M. J. Federle, G. J. Scott, and J. M. Musser. 2002. Virulence control in group A streptococci by a two-component gene regulatory system: global expression profiling and in vivo infection modeling. Proc. Natl. Acad. Sci. USA 99:13855-13860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Heath, A., V. J. DiRita, N. L. Barg, and N. C. Engleberg. 1999. A two-component regulatory system, CsrR-CsrS, represses expression of three Streptococcus pyogenes virulence factors, hyaluronic acid capsule, streptolysin S, and pyrogenic exotoxin B. Infect. Immun. 67:5298-5305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Jadoun, J., V. Ozeri, E. Burstein, E. Skutelsky, E. Hanski, and S. Sela. 1998. Protein F1 is required for efficient entry of Streptococcus pyogenes into epithelial cells. J. Infect. Dis. 178:147-158. [DOI] [PubMed] [Google Scholar]
  • 18.Jadoun, J., and S. Sela. 2000. Mutation in CsrR global regulator reduces Streptococcus pyogenes internalization. Microb. Pathog. 29:311-317. [DOI] [PubMed] [Google Scholar]
  • 19.Jadoun, J., O. Eyal, and S. Sela. 2002. Role of CsrR, hyaluronic acid, and SpeB in the internalization of Streptococcus pyogenes M type 3 by epithelial cells. Infect. Immun. 70:462-469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kleerebezem, M., L. E. Quadri, O. P. Kuipers, and W. M. De Vos. 1997. Quorum sensing by peptide pheromones and two-component signal-transduction systems in gram-positive bacteria. Mol. Microbiol. 24:895-904. [DOI] [PubMed] [Google Scholar]
  • 21.Lazazzera, B. A., and A. D. Grossman. 1998. The ins and outs of peptide signaling. Trends Microbiol. 6:288-294. [DOI] [PubMed] [Google Scholar]
  • 22.Levin, J. C., and M. R. Wessels. 1998. Identification of csrR/csrS, a genetic locus that regulates hyaluronic acid capsule synthesis in group A streptococci. Mol. Microbiol. 30:209-219. [DOI] [PubMed] [Google Scholar]
  • 23.Lyon, W. R., J. C. Madden, J. Stein, and M. G. Caparon. 2001. Mutation of luxS affects growth and virulence factors expression in Streptococcus pyogenes. Mol. Microbiol. 42:145-157. [DOI] [PubMed] [Google Scholar]
  • 24.Marouni, M. J., A. Barzilai, N. Keller, E. Rubinstein, and S. Sela. Intracellular survival of persistent group A streptococci in cultured epithelial cells. Int. J. Med. Microbiol, in press. [DOI] [PubMed]
  • 25.Miller, M. B., and B. L. Bassler. 2001. Quorum sensing in bacteria. Annu. Rev. Microbiol. 55:165-199. [DOI] [PubMed] [Google Scholar]
  • 26.Molinari, G., S. R. Talay, P. Valentin-Weigand, M. Rohde, and G. S. Chhatwal. 1997. The fibronectin-binding protein of Streptococcus pyogenes, SfbI, is involved in the internalization of group A streptococci by epithelial cells. Infect. Immun. 65:1357-1363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Molinari, G., M. Rohde, C. A. Guzman, and G. S. Chhatwal. 2000. Two distinct pathways for the invasion of Streptococcus pyogenes in non-phagocytic cells. Cell. Microbiol. 2:145-154. [DOI] [PubMed] [Google Scholar]
  • 28.Natanson, S., S. Sela, A. E. Moses, J. M. Musser, M. G. Caparon, and E. Hanski. 1995. Distribution of fibronectin-binding proteins among group A streptococci of different M types. J. Infect. Dis. 171:871-878. [DOI] [PubMed] [Google Scholar]
  • 29.Okada, N., I. Tatsuno, E. Hanski, M. Caparon, and C. Sasakawa. 1998. Streptococcus pyogenes protein F promotes invasion of HeLa cells. Microbiology 144:3079-3086. [DOI] [PubMed] [Google Scholar]
  • 30.Perez-Casal, J., J. A. Price, E. Maguin, and J. R. Scott. 1993. An M protein with a single C repeat prevents phagocytes of Streptococcus pyogenes: use of a temperature-sensitive shuttle vector to deliver homologous sequences to the chromosome of S. pyogenes. Mol. Microbiol. 8:809-819. [DOI] [PubMed] [Google Scholar]
  • 31.Podbielski, A., B. Melzaer, and R. Lutticken. 1991. Application of the polymerase chain reaction to study the M protein (-like) gene family in beta-hemolytic streptococci. Med. Microbiol. Immunol. 180:213-227. [DOI] [PubMed] [Google Scholar]
  • 32.Sambrook, J., E. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • 33.Schauder, S., K. Shokat, M. G. Surette, and B. Bassler. 2001. The LuxS family of bacterial autoinducers: biosynthesis of a novel quorum-sensing signal molecule. Mol. Microbiol. 41:463-476. [DOI] [PubMed] [Google Scholar]
  • 34.Schlievert, P. M., A. P. Assimacopoulos, and P. P. Cleary. 1996. Severe invasive group A streptococcal disease: clinical description and mechanisms of pathogenesis. J. Lab. Clin. Med. 127:13-22. [DOI] [PubMed] [Google Scholar]
  • 35.Schrager, H. M., J. G. Rheinwald, and M. R. Wessels. 1996. Hyaluronic acid capsule and the role of streptococcal entry into keratinocytes in invasive skin infection. J. Clin. Investig. 98:1954-1958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Shapiro, J. A. 1998. Thinking about bacterial populations as multicellular organisms. Annu. Rev. Microbiol. 52:81-104. [DOI] [PubMed] [Google Scholar]
  • 37.Sperandio, V., J. L. Mellies, W. Nguyen, S. Shin, and J. B. Kaper. 1999. Quorum sensing controls expression of the type III secretion gene transcription and protein secretion in enterohemorrhagic and enteropathogenic Escherichia coli. Proc. Natl. Acad. Sci. USA 96:15196-15201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Stevens, D. L. 1999. The flesh eating bacterium: what's next? J. Infect. Dis. 179:S366-S374. [DOI] [PubMed] [Google Scholar]
  • 39.Surette, M. G., and B. Bassler. 1999. Regulation of autoinducer production in Salmonella typhimurium. Mol. Microbiol. 31:585-595. [DOI] [PubMed] [Google Scholar]
  • 40.Surette. M. G., M. B. Miller, and B. Bassler. 1999. Quorum sensing in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: a new family of genes responsible for autoinducer production. Proc. Natl. Acad. Sci. USA 96:1639-1644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Terao, Y., S. Kawabata, E. Kunitomo, J. Murakami, I. Nakagawa, and S. Hamada. 2001. Fba, a novel fibronectin-binding protein from Streptococcus pyogenes, promotes bacterial entry into epithelial cells, and the fba gene is positively transcribed under the Mga regulator. Mol. Microbiol. 42:75-86. [DOI] [PubMed] [Google Scholar]
  • 42.Tsai, P. J., C. F. Kuo, K. Y. Lin, Y. S. Lin, H. Y. Lei, F. F. Chen, J. R. Wang, and J. J. Wu. 1998. Effect of group A streptococcal cysteine protease on invasion of epithelial cells. Infect. Immun. 66:1460-1466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Wessels, M. R., J. B. Goldberg, and A. E. Moses. 1994. Effects on virulence of mutations in a locus essential for hyaluronic acid capsule expression in group A streptococci. Infect. Immun. 62:433-441. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES