Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2003 Oct;47(10):3214–3221. doi: 10.1128/AAC.47.10.3214-3221.2003

Antimicrobial Resistance Genes in Enterotoxigenic Escherichia coli O149:K91 Isolates Obtained over a 23-Year Period from Pigs

Christine Maynard 1, John M Fairbrother 1, Sadjia Bekal 2, François Sanschagrin 3, Roger C Levesque 3, Roland Brousseau 2, Luke Masson 2, Serge Larivière 1, Josée Harel 1,*
PMCID: PMC201132  PMID: 14506033

Abstract

A total of 112 Escherichia coli O149:K91 strains isolated from pigs with diarrhea in Quebec, Canada, between 1978 and 2000 were characterized for their genotypic antimicrobial resistance profiles. Tests for resistance to 10 antimicrobial agents were conducted. Resistance to tetracycline and sulfonamides was found to be the most frequent, but resistance to cefotaxime and ceftiofur was absent. An increase in the number of isolates resistant to at least three antimicrobials was observed over time. The distribution of 28 resistance genes covering six antimicrobial families (beta-lactams, aminoglycosides, phenicols, tetracycline, trimethoprim, and sulfonamides) was assessed by colony hybridization. Significant differences in the distributions of tetracycline [tet(A), tet(B), tet(C)], trimethoprim (dhfrI, dhfrV, dhfrXIII), and sulfonamide (sulI, sulII) resistance genes were observed during the study period (1978 to 2000). Sixty percent of the isolates possessed a class 1 integron, illustrating the importance of integrons in the epidemiology of antibiotic resistance in E. coli strains from pigs. Amplification of the integron's variable region resulted in four distinct fragments of 1, 1.3, 1.6, and 1.8 kb, with the 1.6- and 1.8-kb fragments appearing only during the last half of the study period. Examination of linkages among the different resistance genes showed a variety of positive and negative associations. Association analysis of isolates divided into two groups, those isolated between 1978 and 1989 and those isolated between 1990 and 2000, revealed the appearance of new positive resistance gene associations. Our genotypic resistance analyses of ETEC isolates from pigs indicate that many of the antibiotic resistance genes behind phenotypic resistance are not static but, rather, are in a state of flux driven by various selection forces such as the use of specific antimicrobials.


Enterotoxigenic Escherichia coli (ETEC) is an important pathogen of swine, causing diarrhea in newborn and postweaning pigs. ETEC serotype O149:K91 has been found more frequently in recent years and is the predominant serotype universally associated with diarrhea in pigs (3, 19, 31). ETEC strains are also associated with several other serogroups, i.e., O8, O9, O20, O101, O138, and O141 (15). Despite this limited number of serogroups, ETEC strains show diverse genetic backgrounds. With the worldwide progressive increase in antimicrobial resistance among E. coli isolates, treatment of diarrhea in postweaning pigs has become increasingly difficult. In Quebec, Canada, aminopenicillins, chlortetracycline, trimethoprim-sulfonamides, and, to a lesser extent, the aminoglycosides neomycin and apramycin are the usual antimicrobials used to treat diarrhea; however, with the appearance of increased antimicrobial resistance, the expanded-spectrum cephalosporin (ceftiofur) is seeing increased usage (3).

The dissemination of antibiotic resistance genes among bacterial strains is an increasing problem in infectious diseases. Many antibiotic resistance genes are located on plasmids and/or transposons, enabling their transfer among a variety of bacterial species. In recent years, another mechanism of resistance gene dissemination has been discovered. That mechanism involves a DNA element that mediates the integration of resistance genes by a site-specific recombinational mechanism. This newly recognized DNA element, called an integron, either is found as part of a transposon within the Tn21 family or is found independently on several groups of broad-host-range plasmids. Class 1 integrons possess two conserved segments separated by a variable region (VR) which includes integrated antibiotic resistance genes or cassettes of unknown function (25). The 3′ conserved segment contains the qacEΔ1 and sulI genes and an open reading frame (ORF) called orf5. The qacEΔ1 and sulI genes determine resistance to ethidium bromide and quaternary ammonium compounds and resistance to sulfonamide, respectively (25).

Hence, a study to analyze the evolution of different antimicrobial resistance phenotypes in ETEC O149:K91 strains isolated from piglets with clinical cases of diarrhea and other intestinal disorders from 1978 to 2000 (F. Fontaine, N. Nadeau, S. D'Allaire, S. Péres, and J. M. Fairbrother, unpublished data) revealed an increase in the number of multiantimicrobial-resistant strains in a bacterial population with time. In the present study, these ETEC O149:K91 strains were characterized for their genotypic resistance gene profiles. Our findings show that during the 23-year study period, the antimicrobial resistance gene distribution among E. coli O149:K91 isolates has been dynamic and that the observed increases in phenotypic resistance correlate with an increase in multigene resistance.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

Numerous E. coli isolates from diseased animals are sent to The E. coli Laboratory at the Faculté de Médecine Vétérinaire, at Saint-Hyacinthe, Quebec, Canada, for serotyping and virulence factor determination (11). For our study, we selected all the ETEC isolates in this collection that came from pigs with diarrhea, belonged to serogroup O149:K91, contained virulence factors typically associated with the ETEC pathotype (e.g., heat-stable enterotoxins a and b, F4, and heat-labile enterotoxin), and were resistant to one of the antimicrobials for which genes for resistance were tested. In order to minimize any selection bias, only one isolate per farm was selected. The farms from which the isolates were obtained were distributed throughout the various regions of the province of Quebec. After 21 isolates which were susceptible to all antimicrobials tested were excluded, the remaining 112 ETEC isolates which were obtained over a 23-year period were divided into four groups on the basis of the year of isolation: 1978 to 1984, 1985 to 1989, 1990 to 1994, and 1995 to 2000. The reference strain, E. coli ATCC 25922, was used to test each lot of antimicrobial agents by the disk diffusion method. The bacterial strains, kept at −80°C in tryptic soy broth medium containing 10% glycerol, were cultured on tryptic soy agar supplemented with 5% (vol/vol) sheep blood.

The 28 strains used as positive controls and templates for DNA amplification were obtained from different laboratories (Table 1). These strains were kept at −80°C as frozen stocks in tryptic soy broth medium containing 10% glycerol (vol/vol) and were propagated on Luria-Bertani broth or agar containing one of the following antimicrobial agents at the appropriate concentrations: ampicillin (50 μg/ml), gentamicin (30 μg/ml), kanamycin (50 μg/ml), tetracycline (10 μg/ml), chloramphenicol (10 μg/ml), trimethoprim (10 μg/ml), and sulfamethazine (200 μg/ml).

TABLE 1.

PCR primers used for antimicrobial resistance gene and class 1 integron amplifications

Antimicrobial family Resistance gene Forward PCR primer sequence (5′-3′) Reverse PCR primer sequence (5′-3′) Amplicon size (bp) GenBank accession no. Source of DNA
Beta-lactams blaTEM GAGTATTCAACATTTTCGT ACCAATGCTTAATCAGTGA 857 AF309824 R. C. Levesque
blaSHV TCGCCTGTGTATTATCTCCC CGCAGATAAATCACCACAATG 768 AF148850 R. C. Levesque
blaOXA-1 GCAGCGCCAGTGCATCAAC CCGCATCAAATGCCATAAGTG 198 AJ238349 Pasteur Institute
blaOXA-7 AGTTCTCTGCCGAAGCC TCTCAACCCAACCAACCC 591 X75562 R. C. Levesque
blaPSE-4 CTGCTCGTATAGGTGTTTCC TCGCATCATTTCGCTCTTC 705 J05162 R. C. Levesque
blaCTX-M-3 AATCACTGCGTCAGTTCAC TTTATCCCCCACAACCCAG 701 X92506 A. Huletsky
Aminoglycosides ant(2")-Ia(aadB)a TCCAGAACCTTGACCGAAC GCAAGACCTCAACCTTTTCC 700 X04555 R. C. Levesque
aac(3)-IIa(aaaC2) CGGAAGGCAATAACGGAG TCGAACAGGTAGCACTGAG 740 X54723 D. Sandvang
aac(3)-IV GTGTGCTGCTGGTCCACAGC AGTTGACCCAGGGCTGTCGC 627 X01385 J. Harel
apk(3′)-Ia(aphA1) ATGGGCTCGCGATAATGTC CTCACCGAGGCAGTTCCAT 600 M18329 J. Harel
aph(3′)-IIa(aphA2) GAACAAGATGGATTGCACGC GCTCTTCAGCAATATCACGG 680 V00618 J. Harel
Tetracycline tet(A) GTGAAACCCAACATACCCC GAAGGCAAGCAGGATGTAG 888 X00006 J. Harel
tet(B) CCTTATCATGCCAGTCTTGC ACTGCCGTTTTTTCGCC 774 J01830 J. Harel
tet(C) ACTTGGAGCCACTATCGAC CTACAATCCATGCCAACCC 881 J01749 J. Harel
tet(D) TGGGCAGATGGTCAGATAAG CAGCACACCCTGTAGTTTTC 827 X65876 S. B. Levy
tet(E) TTAATGGCAACAGCCAGC TCCATACCCATCCATTCCAC 853 L06940 M. C. Roberts
tet(Y) ACCGCACTCATTGTTGTC TTCCAAGCAGCAACACAC 823 AF070999 M. C. Roberts
Phenicols catI AGTTGCTCAATGTACCTATAACC TTGTAATTCATTAAGCATTCTGCC 547 M62822 J. Harel
catII ACACTTTGCCCTTTATCGTC TGAAAGCCATCACATACTGC 543 X53796 Pasteur Institute
catIII TTCGCCGTGAGCATTTTG TCGGATGAGTATGGGCAAC 286 X07848 I. A. Murray
floR CGCCGTCATTCCTCACCTTC GATCACGGGCCACGCTGTGTC 215 AF252855 D. G. White
Trimethoprim dhfrI AAGAATGGAGTTATCGGGAATG GGGTAAAAACTGGCCTAAAATTG 391 X00926 J. Harel
dhfrV CTGCAAAAGCGAAAAACGG AGCAATAGTTAATGTTTGAGCTAAAG 432 X12868 O. Sköld
dhfrVII GGTAATGGCCCTGATATCCC TGTAGATTTGACCGCCACC 265 X58425 O. Sköld
dhfrIX TCTAAACATGATTGTCGCTGTC TTGTTTTCAGTAATGGTCGGG 462 X57730 C. Wallen
dhfrXIII CAGGTGAGCAGAAGATTTTT CCTCAAAGGTTTGATGTACC 294 Z50802 P. V. Adrian
Sulfonamides sulI TTCGGCATTCTGAATCTCAC ATGATCTAACCCTCGGTCTC 822 X12869 R. C. Levesque
sulII CGGCATCGTCAACATAACC GTGTGCGGATGAAGTCAG 722 M36657 J. Harel
Class 1 integron qacEΔI-sulI ATCGCAATAGTTGGCGAAGT GCAAGGCGGAAACCCGCGCC 797 X12870
VR GGCATCCAAGCAGCAAGC AAGCAGACTTGACCTGAT Variable X12870
a

Alternative nomenclature.

Antimicrobial susceptibility testing.

Antimicrobial susceptibility testing was carried out by the disk diffusion method according to the recommendations reported by the National Committee for Clinical Laboratory Standards (NCCLS) (33). As recommended by the NCCLS, Mueller-Hinton agar batches were used as the culture medium. The antimicrobial agent disks used in this study were beta-lactams (ampicillin [10 μg], ceftiofur [30 μg], cefotaxime [30 μg]); aminoglycosides (gentamicin [10 μg], kanamycin [30 μg], neomycin [30 μg]), tetracycline (30 μg), chloramphenicol (30 μg), trimethoprim (5 μg), and sulfaminoxazole (250 μg) (BBL, Bristol, Conn.).

The zone diameters around all disks except the neomycin disk were interpreted by using the recommendations of the NCCLS; the breakpoints used for neomycin were those recommended by the manufacturer. In the case of trimethoprim, the zone diameters were interpreted by the method in the NCCLS recommendations for enterobacteria from the urinary tract.

PCR primers and amplification.

Resistance gene primers were designed by using the software program Prime (Genetics Computer Group, Madison, Wis.). Oligonucleotide primers were synthesized with a DNA synthesizer (BioCorp Inc., Montreal, Quebec, Canada). The PCR primers, their amplified product sizes, as well as the references for the corresponding strains used as amplification templates are listed in Table 1. The class 1 integron is characterized by the qacEΔ1 and sulI genes at its 3′ conserved segment. Primers located at the 3′ conserved segment were used as described by Sandvang and Aarestrup (27) to investigate whether the class 1 integron was present (Table 1).

Amplifications were performed with 5 μl of supernatant from bacterial preparations that had been boiled for 10 min (8). The PCR mixture (total volume, 50 μl) included 29.6 μl of H2O, 5.0 μl of 10× PCR buffer (Amersham Pharmacia Biotech Inc., Piscataway, N.J.), 5.0 μl of 2 mM deoxynucleoside triphosphates, 1 U of Taq polymerase (Amersham Pharmacia Biotech Inc.), and 25 pmol of each primer. DNA amplification was carried out in a GeneAmp PCR system 9700 (Perkin-Elmer, Foster City, Calif.) by using the following conditions: 5 min at 94°C, followed by 30 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 1.5 min. A sample of 3 μl of the PCR product was verified for size and purity by gel electrophoresis (1.2% [wt/vol] agarose in 1× TAE [Tris-acetate-EDTA] buffer).

All isolates that contained the 3′ conserved segment of the class 1 integron were further investigated by another PCR amplification of a VR within the integron by using the following primers described by Sandvang and Aarestrup (27) (Table 1). Amplification conditions for these primers were as follows: 5 min at 94°C, followed by 35 cycles of 94°C for 1 min, 50°C for 1 min, and 72°C for 5 min.

DNA sequencing.

The amplified products were purified with a QIAquick gel extraction kit (QIAgen Inc., Mississauga, Ontario, Canada). Their sequences were confirmed with the dRhodamine Terminator Cycle Sequencing Ready Reaction kit by using a model 377 DNA sequencer (Applied Biosystems, Foster City, Calif.). Sequences were submitted to the National Center for Biotechnology Information (Bethesda, Md.) for comparison with sequences in GenBank by use of the BLAST program. Multiple DNA alignments were performed by using the CLUSTALW program (32).

Colony hybridization.

The amplicons were labeled with [α-32P]CTP by using a DNA labeling beads kit (Amersham Pharmacia Biotech Inc.). Colony hybridizations were performed as described previously (11).

Statistical methods.

Comparisons of the associations between resistance genes in the total population were made by using Pearson's chi-square exact test (SAS, version 8.2; SAS Institute, Inc., Cary, N.C.). The statistical significance was set at a P value of <0.05. An association between two genes can be positive, indicating that the genes are found together, or negative, indicating that the genes are not found together.

RESULTS

Antimicrobial resistance phenotype characteristics.

Almost all (93%) of the 112 isolates were resistant to tetracycline, and a similar number (91%) were resistant to sulfonamides. The rates of resistance to ampicillin, neomycin, kanamycin, chloramphenicol, and trimethoprim ranged from 21 to 38%, whereas only 14% of the isolates were resistant to gentamicin (Table 2). None of the isolates tested was resistant to cefotaxime or ceftiofur. Some isolates demonstrated a zone of inhibition at the limit (the zone between resistance and susceptibility) for aminoglycosides, tetracycline, and sulfonamides. To facilitate our analysis, these isolates were considered resistant in this study.

TABLE 2.

Trends in resistance of ETEC O149:K91 isolates with time, as determined by the disk diffusion method

ATMb No. (%) of resistant ETEC O149:K91 isolatesa
1978-1984 (n = 25) 1985-1989 (n = 24) 1990-1994 (n = 22) 1995-2000 (n = 41) Total (n = 112)
AMP 8 (32) 2 (8) 8 (36) 25 (61) 43 (38)
CTX 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
XLN 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
GEN 1 (4) 2 (8) 1 (4) 12 (29) 16 (14)
NEO 10 (40) 5 (21) 4 (18) 20 (49) 39 (35)
KAN 10 (40) 6 (25) 8 (36) 19 (46) 43 (38)
TET 22 (88) 22 (92) 21 (95) 39 (95) 104 (93)
CHL 4 (16) 1 (4) 2 (9) 17 (41) 24 (21)
TMP 1 (4) 2 (8) 2 (9) 25 (61) 30 (27)
SUL 22 (88) 24 (100) 22 (100) 34 (83) 102 (91)
a

Phenotypic resistance was overestimated because only isolates showing initial resistance to one antimicrobial were further analyzed.

b

ATM, antimicrobials; AMP, ampicillin; CTX, cefotaxime; XLN, ceftiofur; GEN, gentamicin; NEO, neomycin; KAN, kanamycin; TET, tetracycline; CHL, chloramphenicol; TMP, trimethoprim; SUL, sulfonamides.

As shown in Table 2, the percentage of isolates with multiresistance to certain antimicrobials increased over time. Between 1978 and 1984, the percentage of isolates resistant to neomycin, kanamycin, tetracycline, and sulfonamides was already quite high. The rates of resistance to ampicillin, gentamicin, chloramphenicol, and trimethoprim showed the greatest increases in the last period (1995 to 2000). The proportions of strains resistant to at least three antimicrobials and isolated between 1978 and 1984, 1985 and 1989, 1990 and 1994, and 1995 and 2000 were 44, 31, 68, and 83%, respectively (data not shown).

Distributions of resistance genes among O149:K91 ETEC isolates.

The choice of the resistance genes to be studied was based on their relative importance, as observed in resistant E. coli isolates (5, 6, 13, 20, 21, 27, 35). Therefore, 28 genes coding for resistance to antimicrobials in six families (beta-lactams, aminoglycosides, tetracycline, phenicols, trimethoprim, and sulfonamides) were chosen to determine their distributions among O149:K91 ETEC isolates from pigs with diarrhea (Table 1).

(i) Beta-lactams.

The DNA hybridization probes blaTEM and blaSHV detect all known variants within the corresponding blaTEM and blaSHV gene families on colony hybridization. The blaOXA-7 probe detects blaOXA variants such as blaOXA-10 to blaOXA-14, blaOXA-16 to blaOXA-19, blaOXA-28, blaOXA-31, blaOXA-35 (80 to 96% similarity), and blaPSE-2 (96.3% similarity). To further discriminate variants among the blaOXA-7 hybridization probe-positive isolates, a PCR amplification was undertaken with blaOXA-7-specific primers. All 112 isolates studied possessed at least one of the resistance genes for which tests were conducted.

Eighty-six percent of the ampicillin-resistant isolates and all blaSHV-positive isolates were blaTEM positive. The blaOXA-1 gene was found in only 25% of the ampicillin-resistant strains isolated during the third period (1990 to 1994). None of the isolates tested were positive for hybridization with the blaCTX-M-3, blaPSE-4, or blaOXA-7 probe. One of the 69 isolates susceptible to beta-lactams hybridized with blaTEM, and four isolates resistant to ampicillin did not possess any of the beta-lactam resistance genes for which tests were conducted.

(ii) Aminoglycosides.

Of the five aminoglycoside resistance genes for which tests were conducted, only aph(3′)-Ia, aph(3′)-IIa, and aac(3)-IV were found among the resistant isolates (Table 3). The aph(3′)-Ia and aph(3′)-IIa genes, encode a kanamycin and a neomycin resistance phenotype, and these genes were found, respectively, in 87 and 15% of the neomycin-resistant isolates, and in 79 and 19% of the kanamycin-resistant isolates. The relative importance of aph(3′)-Ia and aph(3′)-IIa varied throughout the studied periods (1978 to 2000). Two isolates harboring the aph(3′)-Ia gene were susceptible to kanamycin and neomycin. Only one gentamicin resistance gene, aac(3)-IV, was found among the isolates. Seventy-five percent of the gentamicin-resistant isolates and two gentamicin-susceptible isolates had this gene.

TABLE 3.

Distribution of antimicrobial resistance genes detected in ETEC O149:K91 isolates by isolation period

Antimicrobial to which resistance was detected Antimicrobial resistance probe No. (%)a of positive isolates by isolation period
1978-1984 1985-1989 1990-1994 1995-2000 Total
Ampicillin blaTEM 8 (100) 1 (50) 3 (38) 25 (100) 37 (86)
blaSHV 3 (38) 0 (0) 1 (12) 5 (20) 9 (21)
blaOXA-1 0 (0) 0 (0) 2 (25) 0 (0) 2 (5)
blaOXA-7, blaPSE, blaCTX-M-3 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Gentamicin aac(3)-IV 0 (0) 0 (0) 1 (100) 11 (92) 12 (75)
ant(2")-Ia, aac(3)-IIa 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Neomycin aph(3′)-Ia 9 (90) 4 (80) 4 (100) 17 (85) 34 (87)
aph(3′)-IIa 1 (10) 1 (20) 2 (50) 2 (10) 6 (15)
ant(2")-Ia 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Kanamycin aph(3′)-Ia 9 (90) 4 (67) 4 (50) 17 (89) 34 (79)
aph(3′)-IIa 1 (10) 2 (33) 3 (38) 2 (10) 8 (19)
ant(2")-Ia 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Tetracycline tet(A) 1 (4) 1 (4) 3 (14) 21 (54) 26 (25)
tet(B) 21 (95) 23 (100) 19 (90) 20 (51) 83 (80)
tet(C) 1 (4) 1 (4) 3 (14) 21 (54) 26 (25)
tet(D), tet(E), tet(Y) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Chloramphenicol catI 4 (100) 1 (100) 2 (100) 12 (70) 19 (79)
catII, catIII, floR 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Trimethoprim dhfrI 0 (0) 2 (100) 0 (0) 4 (16) 6 (20)
dhfrV 0 (0) 0 (0) 0 (0) 14 (56) 14 (47)
dhfrXIII 0 (0) 0 (0) 2 (100) 7 (28) 9 (30)
dhfrVII, dhfrIX 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Sulfonamides sulI 18 (82) 20 (83) 21 (95) 22 (65) 81 (79)
sulII 8 (36) 7 (29) 3 (14) 19 (56) 37 (36)
a

Percentage of probe-positive isolates among resistant ETEC isolates by period.

(iii) Tetracycline.

Of the six tetracycline resistance genes targeted, only the tet(A), tet(B), and tet(C) genes were detected. The tet(B) gene was found in 80% of the tetracycline-resistant isolates and was by far the gene found the most frequently during the first three periods. Only 25% tetracycline-resistant isolates were positive for hybridization with the tet(A) and tet(C) probes over the whole study period. These two genes, which were less prevalent in the first periods (<15%), appeared even slightly more frequently (54%) than tet(B) (51%) between 1995 and 2000 (Table 3). An association between the tet(A) and the tet(C) genes was observed in all tet(A)-positive isolates, and only 5% of the tet-positive isolates possessed all three tetracycline resistance genes. No link between these genes and phenotype was observed in four isolates: 2 of the 8 isolates susceptible to tetracycline were tet(B) positive, and 2 of the 104 tetracycline-resistant isolates were negative for the six tet genes for which tests were conducted.

(iv) Phenicols.

Only the chloramphenicol resistance genes catI and floR were detected among the isolates tested. The catI gene was found in 79% of the chloramphenicol-resistant isolates. The floR gene was not detected in chloramphenicol-resistant isolates. Three chloramphenicol-susceptible isolates were positive for hybridization with the catI probe, and one strain isolated in 1989 was floR positive but chloramphenicol susceptible. Four of the 24 chloramphenicol-resistant isolates did not hybridize with the cat genes for which tests were conducted.

(v) Trimethoprim.

In our study, the trimethoprim resistance phenotype was found to be associated with the presence of three genes, dhfrI, dhfrV, and dhfrXIII. These genes were not detected in strains isolated from 1978 to 1984. The dhfrI gene was detected in strains isolated in the second period (1985 to 1989), whereas the dhfrXIII gene appeared in the third period (1990 to 1994). All three trimethoprim resistance genes were found among the strains isolated in the last period, with a predominance of dhfrV. Among the trimethoprim-resistant isolates, three were negative for the genes for which tests were conducted, whereas one susceptible isolate was found to be dhfrXIII positive.

(vi) Sulfonamides.

Seventy-nine percent of the sulfonamide-resistant isolates possessed the sulI gene, whereas 36% possessed sulII (Table 3). Seventeen percent of these resistant isolates possessed both sulI and sulII. The percentage of the isolates positive for sulI did not vary significantly during any of the periods. However, the percentage of sulII-positive isolates increased significantly to 56% in the last period. No correlation between the presence of sulfonamide resistance genes and phenotype was observed for six isolates. Four of the 10 sulfonamide-susceptible isolates were sulI positive, whereas 2 of the 102 sulfonamide-resistant isolates were found to be sulI and sulII negative.

Identification of integrons.

Of the 112 isolates, a fragment from the class 1 integron 3′ conserved region was amplified from 67 (60%) isolates by PCR (Table 4). Among these positive isolates, 84% were also positive for hybridization with a sulI probe by colony hybridization (data not shown). Among the 67 class 1 integron-positive isolates, four distinct amplicons of 1, 1.3, 1.6, and 1.8 kb were obtained by amplification of the VR by using the primers Fint1 and Rint1. More specifically, a 1.3-kb VR fragment was amplified from more than half of the isolates (55%), followed by amplification of a 1-kb fragment from 29% of the isolates. The remaining 16% of the isolates produced fragments larger than 1.3 kb. The percentage of isolates from which VR fragments larger than 1.6 and 1.8 kb were amplified increased over time. Before 1990, none of the class 1 integron-positive isolates had a VR fragment larger than 1.3 kb. However, a larger VR fragment appeared in one (6%) such isolate in the period from 1990 to 1994, and the frequency of isolates with a larger VR fragment increased to 50% in the latest period (1995 to 2000).

TABLE 4.

Distribution of class 1 integron among the ETEC O149:K91 isolates

Isolation period Total no. of isolates No. of integron class 1-positive isolates % of integron class 1-positive isolates by VR length
1.0 kb 1.3 kb 1.6 kb 1.8 kb
1978-1984 25 14 21 79 0 0
1985-1989 24 14 29 72 0 0
1990-1994 22 19 26 68 0 6
1995-2000 41 20 35 15 35 15
    Total 112 67 29 55 10 6

Two representative VR fragments of each length were sequenced. Both VR fragments of the same length contained the same gene cassettes with more than 95% similarity. The 1-kb VR fragment contained the ant(3")-Ia (aadA1) gene cassette (GenBank accession no. X12870) encoding streptomycin and spectinomycin resistance. The most frequently observed VR amplified fragments (i.e., fragments of 1.3 kb) contained, in addition to the ant(3")-Ia gene cassette found in the 1-kb fragment, an ORF named orfD (GenBank accession nos. M86913 and AF140629, respectively). The 1.6-kb VR fragments contained two gene cassettes, dhfrIb, encoding resistance to trimethoprim, and ant(3")-If (aadA6), encoding resistance to streptomycin and spectinomycin (GenBank accession nos. AF393510 and AF140629, respectively). Finally, the 1.8-kb VR fragments possessed two gene cassettes, dhfrXII and ant(3")-If, which confer resistance to trimethoprim and resistance to streptomycin and spectinomycin, respectively, and one ORF named orfF (GenBank accession nos. Z21672 and AF284063, respectively).

Association between resistance genes.

In order to determine whether possible associations exist between the resistance genes found among our isolates and whether the coappearance of some resistance genes could be confirmed statistically, an analysis of association was done by using Pearson's chi-square exact test. Significant associations (P < 0.05) with respect to the occurrence of individual resistance genes among the whole collection of ETEC isolates were detected (Table 5). Some positive associations were obvious, for example, the association of the blaTEM and blaSHV genes as well the association of the tet(A) and tet(C) genes. The blaTEM gene was associated with the aph(3′)-Ia, aac(3)-IV, dhfrV, and catI genes and also, although less strongly, with the sulII gene (Table 5). The aac(3)-IV gene showed a positive association with the blaTEM and blaSHV genes and also with the aph(3′)-Ia, dhfrV, and dhfrXII genes. The aph(3′)-IIa gene was positively associated with the tet(A) and tet(C) genes but was negatively associated with the tet(B) gene. In contrast, the sulI gene was positively associated with the tet(B) gene but was negatively associated with the tet(A) and tet(C) genes. Although the class 1 integron was found together with the sulI gene in 68% of the sulI-positive isolates, no statistically significant association was observed between the presence of the class 1 integron and sulI. This absence of a correlation is probably due to the presence of sulI in integron-negative isolates.

TABLE 5.

Association between various antimicrobial resistance genes and class 1 integron among ETEC O149:K91 isolates

Resistance gene Significance of association of antimicrobial resistance gene and class 1 integrona
blaTEM blaSHV aph(3′)-Ia aph(3′)-IIa aac(3)-IV dhrfI dhrfV dhfrXIII sulI sulII tet(A) tet(B) tet(C) catI
blaSHV +++
aph(3′)-Ia +++ ++
aph(3′)-IIa − − −
aac(3′)-IV +++ + ++ −
dhfrI − − − − −
dhfrV ++ ++ − − +++ −
dhfrXIII − − − − + − −
sulI − − − − − − − −
sulII + − − − − − − ++ −
tet(A) − − − + − − + − (++) −
tet(B) − − − (+) − − − − +++ − (+++)
tet(C) − − − + − − + − (++) − +++ (+++)
catI +++ − − − + − ++ − − − − − −
Class 1 integron − − − − − − − − − − − − − −
a

Only the results for antimicrobial resistance genes that exhibited an association with another gene at a P level of <0.05 are shown. Significance level of association (as assessed by the chi-square exact test): −, P > 0.05; +, 0.05 ≥ P ≥ 0.01; ++, 0.01 ≥ P ≥ 0.001; +++, P ≤ 0.001. Parentheses indicate negative associations.

The association analysis was subsequently performed with two groups of the collection of isolates, with group 1 representing those strains isolated between 1978 and 1989 and group 2 representing those strains isolated between 1990 and 2000 (data not shown). New positive associations were observed for strains isolated from 1990 to 2000, such as blaTEM with blaSHV; sulI with tet(A), tet(B), tet(C), and the class 1 integron; and finally, catI with the class 1 integron. For strains isolated from 1990 to 2000, some positive associations appeared to be more closely linked than the associations observed for the whole collection, for example, blaTEM with aph(3′)-Ia and aac(3)-IV and dhfrXIII with sulII.

DISCUSSION

ETEC is the most common bacterial etiologic agent of diarrhea in neonatal and postweaning pigs. Although treatment of enteric E. coli infection in swine commonly includes the use of antimicrobials (2, 10), relatively few studies have been directed toward the characterization of the genotypic resistance profiles of E. coli strains isolated from animals. One study characterized the tetracycline and sulfonamide resistance gene profiles of E. coli strains isolated from animals and humans (17), while a second one (27) characterized the aminoglycoside resistance gene profiles of porcine and bovine E. coli isolates. In the present study, we characterized the gene profiles of ETEC O149:K91 strains isolated from pigs between 1978 and 2000 for detection of acquired resistance to 10 different antimicrobial agents.

In this study, phenotypic resistance was overestimated because only isolates showing initial resistance to one antimicrobial were further analyzed. Nevertheless, it remains that the phenotypic resistance observations reported here reflect the general trend observed with E. coli strains isolated from pigs (3, 19, 31). Although we did not test for resistance to all the antimicrobials which could inhibit the growth of E. coli (other aminoglycosides, quinolones or fluoroquinolones, colistin), most of the resistant isolates were resistant to more than one antimicrobial, especially during the last period (1995 to 2000). No resistance to cephalosporins (ceftiofur and cefotaxime) was observed.

Other groups (17, 31) have also noted in pig isolates the resistance to tetracycline and sulfonamide antimicrobials observed in most of our ETEC isolates. It is not surprising that the level of resistance of the isolates to these antimicrobials was so high, as these antimicrobials have been and are still being used as growth promoters in Canada and the United States, for disease prevention, and as therapy in swine production (12). Among the tetracycline-resistant isolates, the tet(B) gene was largely predominant until 1994, when two other closely associated tetracycline resistance genes, tet(A) and tet(C), became dominant during the last study period (1995 to 2000). Another study with pigs from three herds with different histories of antimicrobial exposure produced similar results, in that tet(B) was predominant in two of the herds exposed to antimicrobials, and when they were present, tet(A) and tet(C) were also found together (18). In contrast, a recent study by Lanz et al. (17) showed that the tet(A) gene alone is the most prevalent tet gene among E. coli isolates from pigs with diarrhea or enterotoxemia. The modes of action as well as the specificities of certain antimicrobial enzymes could exert positive selection pressure and contribute to the emergence of new genes over time. For example, class A, B, and C tetracycline resistance determinants are efflux pumps with different specificities. Most of the efflux proteins confer resistance to tetracycline but not to the minocyline or glycylcycline antimicrobial group. In contrast, the tet(B) gene encodes an efflux protein which confers resistance to tetracycline, doxycycline, and minocycline but not glycylcycline (24). These specificities correlate with the emergence of the diverse distribution of different tetracycline resistance genes over time. It is not known if such a selective effect exists between the commonly used tetracyclines in swine production, i.e., oxytetracycline and chlortetracycline. Similarly, the sulI gene was more predominant than sulII in strains isolated during the three first periods, whereas the sulII gene appeared as frequently as sulI in the last period (1995 to 2000). Lanz et al. (17) also observed the predominance of sulI among pig isolates. The sulI and sulII genes encode dihydropteroate synthase enzymes with different sensitivities (Ki values), even if the two enzymes show the same low Km values (0.6 μM) for p-aminobenzoic acid, which is implicated in bacterial folic acid biosynthesis. The enzyme encoded by sulII discerns the normal p-aminobenzoic acid substrate from the inhibitor, the sulfonamides (29).

Despite a ban on the use of chloramphenicol in food animals in Canada since 1980 (9), an increase in the rate of chloramphenicol resistance among ETEC isolates was observed. Other investigators have also observed the persistence or an increase in the rate of chloramphenicol resistance among E. coli isolates from swine (3, 17, 31) and other animal species (34). Resistance to chloramphenicol was closely associated with the presence of the catI gene. In a study done by Bischoff et al. (3), only 4 of 48 chloramphenicol-resistant isolates harbored the catII gene; a relatively unknown gene, cmlA, was responsible for the resistance of the other isolates. Finally, we detected the floR gene in only one isolate. Other studies have reported the presence of floR in a large number of E. coli strains from chickens and cattle (7, 16, 35).

Interestingly, 35% of the isolates were resistant to neomycin and 38% were resistant to kanamycin, even though kanamycin is not used in the Canadian swine industry. It is likely the result of the cross-resistance caused by most of the aminoglycoside resistance genes (34). Our study showed that certain antimicrobial resistance genes were more prevalent than others and that this incidence among the ETEC isolates changed over time. The blaTEM genes were widely distributed, whereas the blaOXA genes appeared infrequently. Among the genes in our ETEC isolates for which tests were conducted, only the aminoglycoside resistance genes revealed limited diversity, with the most prevalent genes being aph(3′)-Ia and aph(3′)-IIa. These genes, which are also responsible for cross-resistance to different aminoglycosides (neomycin and kanamycin), did not vary in frequency over the duration of our study. In contrast, a Danish publication detected the aminoglycoside resistance genes at various frequencies, with ant(2")-Ia and aac(3)-IIa being the most prevalent among pig isolates (27).

One clear observation arising from our study is that the number and diversity of genes driving the phenotypic resistance are dynamic. During the 23-year period, some genes or associations of genes appeared, whereas other genes became more rare (Table 5). The association of the blaSHV gene with blaTEM could be explained by the fact that the blaSHV gene might have been acquired in isolates harboring blaTEM, resulting in an increase in the rate of resistance to beta-lactams (4). We observed that the tet(A) and tet(C) genes were always found together. During the three first periods, tet(B) was the most prevalent tetracycline resistance gene. An incompatibility of the plasmids carrying tetracycline resistance determinants could explain the existence of the negative associations between tet(A)-tet(C) and tet(B) (15).

Resistance genes are associated with mobile DNA such as plasmids, transposons, and integrons, which facilitate resistance gene distribution (14, 30). Most of the isolates (62%) possessed a class 1 integron. Because integrons are characterized by their integration of many different gene cassettes between insertion sites in the VR, site-specific insertion represents another mechanism driving the evolution of the plasmids and transposons of gram-negative bacteria. Most class 1 integrons in the E. coli isolates in our collection contained VRs of 1.3 and 1 kb. The VRs of integrons found in Shiga toxin-producing E. coli isolates were of similar sizes (36). Interestingly, an increase in the VR length was observed in E. coli strains isolated during the last period, a phenomenon also observed by Schmitz et al. (28). They showed that the VRs of the class 1 integrons in human E. coli strains isolated in 1993 ranged from 0.65 to 1.8 kb and that those in human E. coli strains isolated in 1999 ranged from 0.75 to 3 kb, suggesting an accumulation of gene cassettes inserted in the class 1 integron among the ETEC isolates due to selection by antimicrobials. In this study, most of the isolates which possessed VRs of the same length appeared to have acquired the same gene cassettes in their integrons. However, the genes responsible for resistance to beta-lactams, tetracycline, and chloramphenicol were not associated with class 1 integrons.

Multiple cassette insertions and more than 40 distinct cassettes have been identified among integrons (25). VRs of four different sizes were detected among the class 1 integrons of the isolates in the present study (Table 4). Representatives of these VRs were sequenced. As in other studies, our study shows that the different gene cassettes of the integron VRs included genes encoding aminoglycoside and/or trimethoprim resistance, which are the most frequently described antimicrobial resistance gene cassettes (1, 23, 26).

In the last period (1995 to 2000), we observed an increase in the number of isolates with multiple resistance genes as well as the appearance of resistance genes such as aac(3)-IV, dhfrV, and sulII. These observed increases in the numbers of genes for resistance to the different antimicrobials are presumably due to the increased selection pressure resulting from changed management styles, for example, the early medicated weaning of piglets introduced in the early 1990s. The direct use of antimicrobials can drive the coselection of resistance genes. For example, the use of injectable oxytetracycline in cattle receiving chlortetracycline in their feed was associated with an increase in the incidence of resistance to chloramphenicol and sulfisoxazole (22). In our study, the association of aac(3)-IV, catI, and dhfrV, which encode resistance to gentamicin, chloramphenicol, and trimethoprim, respectively, was observed; and the incidence of these genes increased with similar distributions over time. This suggests that the increased use of gentamicin or sulfamethoxazole-trimethoprim in pig production could have coselected for resistance to chloramphenicol, thus explaining the increase in chloramphenicol-resistant isolates, even though this antimicrobial agent has not been used in swine production since 1980.

In conclusion, our genotypic resistance analysis of ETEC isolates shows that the genes behind phenotypic resistance are not static but, rather, are in a state of flux driven by various selection forces such as the use of specific antimicrobials. Often, more than one gene was associated with a given phenotypic resistance. A different distribution of resistance genes was observed over time, with an increase in multigene resistance correlating with the observed phenotypic multiresistance among ETEC O149:K91 strains. The difference in the results of this study from those of studies in other countries suggests that relative resistance gene frequencies not only vary within a population over time but also vary between populations of different geographical origins. This study reinforces the necessity of using genotypic resistance analyses in future epidemiological studies.

Acknowledgments

We are very grateful to Guy Beauchamp for statistical analysis and Kim Messier for phenotypic resistance characterization of the isolates. We appreciate the technical assistance provided by the members of the Groupe de Recherche sur les Maladies du Porc.

This work was supported by the Natural Sciences and Engineering Research Council of Canada and is part of a research work unit of the Canadian Research Network on Bacterial Pathogens of Swine (grant 225155). This work was also supported by the Fédération des Producteurs de Porcs du Québec.

REFERENCES

  • 1.Bass, L., C. A. Liebert, M. D. Lee, A. O. Summers, D. G. White, S. G. Thayer, and J. J. Maurer. 1999. Incidence and characterization of integrons, genetic elements mediating multiple-drug resistance, in avian Escherichia coli. Antimicrob. Agents Chemother. 43:2925-2929. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bertchinger, H. U., and J. M. Fairbrother. 1999. Escherichia coli infections, p. 431-468. In B. E. Straw, S. D'Allaire, W. L. Mengeling, and D. J. Taylor (ed.), Diseases of swine, 8th ed. Iowa State University Press, Ames.
  • 3.Bischoff, K. M., D. G. White, P. F. McDermott, S. Zhao, S. Gaines, J. J. Maurer, and D. J. Nisbet. 2002. Characterization of chloramphenicol resistance in beta-hemolytic Escherichia coli associated with diarrhea in neonatal swine. J. Clin. Microbiol. 40:389-394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bradford, P. A., C. Urban, A. Jaiswal, N. Mariano, B. A. Rasmussen, S. J. Projan, J. J. Rahal, and K. Bush. 1995. SHV-7, a novel cefotaxime-hydrolyzing beta-lactamase, identified in Escherichia coli isolates from hospitalized nursing home patients. Antimicrob. Agents Chemother. 39:899-905. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bush, K., G. A. Jacoby, and A. A. Medeiros. 1995. A functional classification scheme for β-lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother. 39:1211-1233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Chopra, I., and M. Roberts. 2001. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 65:232-260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cloeckaert, A., S. Baucheron, G. Flaujac, S. Schwarz, C. Kehrenberg, J. L. Martel, and E. Chaslus-Dancla. 2000. Plasmid-mediated florfenicol resistance encoded by the floR gene in Escherichia coli isolated from cattle. Antimicrob. Agents Chemother. 44:2858-2860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Daigle, F., J. Harel, J. M. Fairbrother, and P. Lebel. 1994. Expression and detection of pap-, sfa-, and afa-encoded fimbrial adhesin systems among uropathogenic Escherichia coli. Can. J. Microbiol. 40:286-291. [DOI] [PubMed] [Google Scholar]
  • 9.Gilmore, A. 1986. Chloramphenicol and the politics of health. Can. Med. Assoc. J. 134:423, 426-428, 433-435. [PMC free article] [PubMed] [Google Scholar]
  • 10.Hampson, D. J. 1994. Postweaning Escherichia coli diarrhoea in pigs, p. 171-191. In C. L. Gyles (ed.), Escherichia coli in domestic animals and humans. CAB International, Guelph, Ontario, Canada.
  • 11.Harel, J., H. Lapointe, A. Fallara, L. A. Lortie, M. Bigras-Poulin, S. Lariviere, and J. M. Fairbrother. 1991. Detection of genes for fimbrial antigens and enterotoxins associated with Escherichia coli serogroups isolated from pigs with diarrhea. J. Clin. Microbiol. 29:745-752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Health Canada. 2002. Uses of antimicrobial drugs in food animals, p. 53-67. Use of antimicrobials in food animals in Canada: impact on resistance and human health. Health Products and Food Branch, Health Canada, Ottawa, Ontario, Canada.
  • 13.Huovinen, P., L. Sundstrom, G. Swedberg, and O. Skold. 1995. Trimethoprim and sulfonamide resistance. Antimicrob. Agents Chemother. 39:279-289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Jacoby, G. A. 1994. Extrachromosomal resistance in gram-negative organisms: the evolution of beta-lactamase. Trends Microbiol. 2:357-360. [DOI] [PubMed] [Google Scholar]
  • 15.Jones, C. S., D. J. Osborne, and J. Stanley. 1992. Enterobacterial tetracycline resistance in relation to plasmid incompatibility. Mol. Cell. Probes 6:313-317. [DOI] [PubMed] [Google Scholar]
  • 16.Keyes, K., C. Hudson, J. J. Maurer, S. Thayer, D. G. White, and M. D. Lee. 2000. Detection of florfenicol resistance genes in Escherichia coli isolated from sick chickens. Antimicrob. Agents Chemother. 44:421-424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lanz, R., P. Kuhnert, and P. Boerlin. 2003. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. Vet. Microbiol. 91:73-84. [DOI] [PubMed] [Google Scholar]
  • 18.Lee, C., B. E. Langlois, and K. A. Dawson. 1993. Detection of tetracycline resistance determinants in pig isolates from three herds with different histories of antimicrobial agent exposure. Appl. Environ. Microbiol. 59:1467-1472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Mathew, A. G., A. M. Saxton, W. G. Upchurch, and S. E. Chattin. 1999. Multiple antibiotic resistance patterns of Escherichia coli isolates from swine farms. Appl. Environ. Microbiol. 65:2770-2772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Miller, G. H., F. J. Sabatelli, R. S. Hare, Y. Glupczynski, P. Mackey, D. Shlaes, K. Shimizu, K. J. Shaw, et al. 1997. The most frequent aminoglycoside resistance mechanisms—changes with time and geographic area: a reflection of aminoglycoside usage patterns? Clin. Infect. Dis. 24(Suppl. 1):S46-S62. [DOI] [PubMed] [Google Scholar]
  • 21.Murray, I. A., and W. V. Shaw. 1997. O-Acetyltransferases for chloramphenicol and other natural products. Antimicrob. Agents Chemother. 41:1-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.O'Connor, A. M., C. Poppe, and S. A. McEwen. 2002. Changes in the prevalence of resistant Escherichia coli in cattle receiving subcutaneously injectable oxytetracycline in addition to in-feed chlortetracycline compared with cattle receiving only in-feed chlortetracycline. Can. J. Vet. Res. 66:145-150. [PMC free article] [PubMed] [Google Scholar]
  • 23.Peters, E. D., M. A. Leverstein-van Hall, A. T. Box, J. Verhoef, and A. C. Fluit. 2001. Novel gene cassettes and integrons. Antimicrob. Agents Chemother. 45:2961-2964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Petersen, P. J., N. V. Jacobus, W. J. Weiss, P. E. Sum, and R. T. Testa. 1999. In vitro and in vivo antibacterial activities of a novel glycylcycline, the 9-t-butylglycylamido derivative of minocycline (GAR-936). Antimicrob. Agents Chemother. 43:738-744. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Recchia, G. D., and R. M. Hall. 1997. Origins of the mobile gene cassettes found in integrons. Trends Microbiol. 5:389-394. [DOI] [PubMed] [Google Scholar]
  • 26.Roy, P. H. 1997. Dissémination de la résistance aux antibiotiques: le génie génétique à l'oeuvre chez les bactéries. Med. Sci. 13:927-933. [Google Scholar]
  • 27.Sandvang, D., and F. M. Aarestrup. 2000. Characterization of aminoglycoside resistance genes and class 1 integrons in porcine and bovine gentamicin-resistant Escherichia coli. Microb. Drug Resist. 6:19-27. [DOI] [PubMed] [Google Scholar]
  • 28.Schmitz, F. J., D. Hafner, R. Geisel, P. Follmann, C. Kirschke, J. Verhoef, K. Kohrer, and A. C. Fluit. 2001. Increased prevalence of class I integrons in Escherichia coli, Klebsiella species, and Enterobacter species isolates over a 7-year period in a German university hospital. J. Clin. Microbiol. 39:3724-3726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Skold, O. 2001. Resistance to trimethoprim and sulfonamides. Vet. Res. 32:261-273. [DOI] [PubMed] [Google Scholar]
  • 30.Tenover, F. C., and J. K. Rasheed. 1998. Genetic methods for detecting antimicrobial and antiviral resistance genes, p. 1578-1592. In P. R. Murray, E. J. Baron, M. A. Pfaller, F. C. Tenover, and R. H. Yolken (ed.), Manual of clinical microbiology, 7th ed., Washington, D.C.
  • 31.Teshager, T., I. A. Herrero, M. C. Porrero, J. Garde, M. A. Moreno, and L. Dominguez. 2000. Surveillance of antimicrobial resistance in Escherichia coli strains isolated from pigs at Spanish slaughterhouses. Int. J. Antimicrob. Agents 15:137-142. [DOI] [PubMed] [Google Scholar]
  • 32.Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Watts, J. L., M. M. Chengappa, J. R. Cole, J. M. Cooper, T. J. Inzana, M. R. Plaunt, T. R. Shryock, C. Thornsberry, R. D. Walker, and C. Wu. 1999. Performance standards for antimicrobial disk susceptibility tests for bacteria isolated from animals; approved standard document M31-A, vol. 19. National Committee for Clinical Laboratory Standards, Wayne, Pa.
  • 34.Werckenthin, C., S. Seidl, J. Riedl, E. Kiossis, G. Wolf, R. Stolla, and O. R. Kaaden. 2002. Escherichia coli isolates from young calves in Bavaria: in vitro susceptibilities to 14 anti-microbial agents. J. Vet. Med. B Infect. Dis. Vet. Public Health 49:61-65. [DOI] [PubMed] [Google Scholar]
  • 35.White, D. G., C. Hudson, J. J. Maurer, S. Ayers, S. Zhao, M. D. Lee, L. Bolton, T. Foley, and J. Sherwood. 2000. Characterization of chloramphenicol and florfenicol resistance in Escherichia coli associated with bovine diarrhea. J. Clin. Microbiol. 38:4593-4598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Zhao, S., D. G. White, B. Ge, S. Ayers, S. Friedman, L. English, D. Wagner, S. Gaines, and J. Meng. 2001. Identification and characterization of integron-mediated antibiotic resistance among Shiga toxin-producing Escherichia coli isolates. Appl. Environ. Microbiol. 67:1558-1564. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES