T Cell Repertoire Development in XSCID Dogs Following Non-conditioned Allogeneic Bone Marrow Transplantation

Abstract

Dogs with X-linked severe combined immunodeficiency (XSCID) can be successfully treated by bone marrow transplants (BMT) resulting in full immunologic reconstitution and engraftment of both donor B and T cells without the need for pre-transplant conditioning. In this study, we evaluated the T cell diversity in XSCID dogs 4 months to 10 1/2 years following BMT. At 4 months post transplantation, when the number of CD45RA⁺ (naïve) T cells had peaked and plateaued, the T cells in the transplanted dogs showed the same complex, diverse repertoire as those of normal young adult dogs. A decline in T cell diversity became evident approximately 3 1/2 years post transplant, but the proportion of Vβ families showing a polyclonal Gaussian spectratype still predominated up to 7 1/2 years post transplant. In two dogs evaluated at 7 1/2 and 10 1/2 years post transplant, >75% of the Vβ families consisted of a skewed or oligoclonal spectratype that was associated with a CD4/CD8 ratio of <0.5. The decline in the complexity of T cell diversity in the transplanted XSCID dogs is similar to that reported for XSCID patients following BMT. However, in contrast to transplanted XSCID boys who show a significant decline in their T cell diversity by 10 to 12 years following BMT, transplanted XSCID dogs maintain a polyclonal, diverse T cell repertoire through mid-life.

INTRODUCTION

Severe combined immunodeficiency (SCID) is a heterogenous group of diseases characterized by the inability to mount humoral and cell-mediated immune responses and is invariably fatal within the first two years of life (1,2). X-linked severe combined immunodeficiency (XSCID) is the most common form of the disease representing approximately 50% of all human SCID (2,3). XSCID is caused by mutations in the common gamma (γc) subunit of the receptors for IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21 (reviewed in 4,5). Thus, the XSCID phenotype is the complex result of multiple cytokine defects. The shared usage of the γc by receptors for growth factors that are critical for normal B, NK and T cell development and function explains the profound immunologic abnormalities and clinical severity of the disease.

Since the first successful HLA-identical bone marrow transplant (BMT) in a boy with XSCID in 1968 (6), BMT has become the treatment of choice for all forms of SCID (3,7-10). SCID patients receiving a histocompatible (HLA-identical) BMT have greater than 90% long-term survival rates (3,8,9). However, the majority of patients do not have a histocompatible donor. Haploidentical BMT with T cell depletion to prevent fatal graft-versus-host disease (GVHD) has become the standard therapy for SCID patients who lack a histocompatible donor (3,7-13). Although T cell depletion makes BMT possible for virtually all SCID patients, long-term immune reconstitution and survival is less favorable than after histocompatible BMT, ranging from 60 to 70% (8,9). The most common immunologic problem in human XSCID patients following BMT is poor humoral immune reconstitution. As a result, many patients need to be maintained indefinitely on prophylactic immune globulin (IVIG) therapy (7-9,14,15).

Two recent studies have evaluated thymic function (thymopoiesis) and T cell diversity in SCID patients for up to 18 years after bone marrow transplantation without any pre-transplant conditioning (16,17). The majority were either XSCID or Jak3 deficient patients. Most had received T cell depleted, haploidentical transplants. These studies showed that within 6 to 12 months post transplant there is a robust regeneration of naïve (CD45RA⁺) peripheral T cells with a highly diverse, polyclonal T cell repertoire that develops through active thymopoiesis as measured by T cell receptor excision circle (TREC) analysis. However, between 10 to 12 years post transplant there was little evidence of active thymopoiesis as demonstrated by extremely low levels of naïve peripheral T cells and almost undetectable TREC levels. These changes are accompanied by significant skewing of the T cell repertoire.

Our laboratory has identified and characterized an X-linked severe combined immunodeficiency due to distinct γc mutations in basset hound and cardigan Welsh corgi dogs that has a clinical and immunologic phenotype virtually identical to human XSCID (18-22). We have shown that XSCID dogs can be successfully transplanted with unfractionated bone marrow or highly purified bone marrow CD34⁺ cells from histocompatible normal donors resulting in full immunologic reconstitution and engraftment of both donor B and T cells without the need for pre-transplant conditioning (23-25). In this study, we describe the T cell diversity in XSCID dogs 4 months to 10 1/2 years following nonconditioned, histocompatible bone marrow transplantation.

MATERIALS AND METHODS

Dogs

The XSCID dogs used in this study were derived from a breeding colony of XSCID dogs with γc mutations consisting of either a four bp deletion in exon 1 (basset mutation, R dogs) or single nucleotide insertion in exon 4 (corgi mutation, X dogs) (18,19,26). Affected dogs were diagnosed shortly after birth by the absence of peripheral T cells as determined by flow cytometry and confirmed by a specific PCR based mutation detection assay for each mutation using DNA isolated from whole blood (20,23,26). DLA-identical donors for transplantation were determined by PCR assay for highly polymorphic MHC class I and class II microsatellite marker polymorphisms (27).

Bone marrow preparation

Bone marrow cells were collected from the donors following euthanasia by removing a segment of the femur, flushing the marrow into a sterile petri dish containing HBSS without calcium and magnesium (Mediatech, Fisher Scientific, Philadelphia, PA), and mincing into a single cell suspension (23,24). The resulting suspension was filtered through a sterile 70-μm cell strainer (Becton Dickinson, Franklin Lakes, NJ). and washed twice with HBSS. Following filtration, the cells were centrifuged and resuspended in ammonium chloride lysing buffer (Sigma Chemical, St. Louis, MO) to remove RBC. After a 5 min incubation on ice, the cells were washed twice in HBSS and the final pellet resuspended in sterile saline.

Isolation of bone marrow CD34⁺ cells

The resulting bone marrow cell suspension was resuspended at a final concentration of 1× 10⁸ cells/ml in a PBS solution containing 2 mmol/L EDTA, 0.1% BSA, and anti-canine CD34 antibody 1H6 (28) at 40 μg/ml. Cells were resuspended and then labeled with the secondary anti-mouse IgG MACS magnetic microbeads according to the manufacturer’s protocol (Miltenyi, Auburn, CA). Labeled cells were selected on varioMACS columns as recommended by the manufacturer. Aliquots of positively selected cells were analyzed by flow cytometry to determine the purity of the eluted cells.

Bone marrow transplantation

XSCID dogs were bone marrow transplanted with cells from DLA-identical, normal littermate donors between one and two weeks of age without any pre-transplant conditioning. Untreated nucleated bone marrow cells, containing <1% mature T cells, were administered intravenously at a dose of 1.0 to 1.5 × 10⁸ nucleated cells/kg. Dogs transplanted with CD34⁺ bone marrow cells, purity >95%, received doses of 5 to 35 × 10⁶ CD34⁺ cells/kg. The transplanted dogs were reared in a conventional environment and maintained on prophylactic antibiotics for the first two to three months following transplantation. None of the dogs received intravenous gamma globulin because of its lack of availability for dogs.

Flow cytometry

Peripheral blood mononuclear cells (PBMC) were isolated from heparinized whole blood by centrifugation over a discontinuous density gradient of Hypaque-Ficoll and stained for flow cytometric analysis as previously described (21,23). Analysis gates were adjusted to 1% positive staining with isotype controls. For each sample, 10,000 cells were analyzed using a Becton Dickinson FACSCalibur (Becton Dickinson, San Jose, CA). The murine mAb used in this study were CA17.3G9, canine CD3; CA13.1E4, canine CD4; CA9.JD3, canine CD8α; and CA4.1D3, canine CD45RA (29,30). FITC conjugated F(ab’)₂ goat anti-dog IgG (heavy and light chain specific) was purchased from Cappel (Durham, NC). FITC- and PE-labeled secondary antibodies were purchased from Fisher Scientific (Pittsburgh, PA).

Proliferation assays

The response of peripheral blood lymphocytes to in vitro mitogenic stimulation with PHA-P (5 ug/ml; Sigma, St. Louis, MO) was performed as previously described using incorporation of tritiated thymidine (21,23). The results are expressed as counts per minute (CPM).

Assessment of antigen-specific IgG antibody response

Between 4 and 6 months post transplantation dogs were immunized intramuscularly with 0.5 ml tetanus toxoid (Lederle, Pearl River, NY). Animals were re-immunized with tetanus toxoid 2 and 4 weeks after the initial immunization. IgG-specific tetanus toxoid–specific antibody was determined using an enzyme linked immunosorbent assay (ELISA) (25). The results are expressed as percent of response of normal dogs.

TCR Vβ CDR3-size spectratyping

We have recently cloned and sequenced 43 different canine TCRβ VDJ sequences and confirmed their specificity by sequence homology analysis with known TCRβ VDJ region sequences from other species (manuscript in preparation). 23 distinct TCR Vβ segments were identified that comprised 18 different families (>80% homology at the nucleotide level). The TCR Vβ families were arbitrarily assigned numbers from BV1 to BV18, beginning with families that contained the greatest number of sequences, and numbered consecutively. Unique members of the same family were designated by assigning an additional consecutive number, e.g. BV3.1, BV3.2, BV3.3.

PCR primers were selected using the DNAstar suite of sequence analysis tools. Forward primers located in the Vβ region were selected to prime at regions of dissimiliarity between closely related Vβ’s. When possible PCR amplification products were sequenced to verify the appropriate specificity of the V region primer. RNA was isolated from canine peripheral blood utilizing the Qiamp RNA mini blood isolation kit (Qiagen, Valencia, CA). First strand cDNA was produced (50 μl) using 400U Superscript II or alternatively Superscript III reverse transcriptase (Invitrogen) and oligo(dT) primers. For PCR reactions (25 μl total volume), 1 μl of the cDNA reaction was added to wells of a 96 well PCR plate. Master mix containing Platinum Taq (1.25U) (Invitrogen, Gaithersburg, MD), Mg⁺⁺ buffer (15 mM final) and dNTP’s (400μm each final) was added to each well using a multichannel pipettor. Subsequently 1 μl of premixed Vβ specific forward (Invitrogen) and IRD700 labeled TCR reverse primers (MWG biotech) were added to the appropriate wells using a multichannel pipettor. The primers used in this study are shown in Table 1. Plates were covered with PCR plate sealers and reactions were run on a thermocycler using the program 94°C 45s, 55°C 30s, 72°C 60s for a total of 35 cycles. 4 μl of acrylamide gel loading buffer (0.05% bromphenol blue, 20mM EDTA in formamide) was added to each well and samples were heated to 94°C for 5 minutes. Amplification products were subsequently loaded (0.8 μl) onto a 6% 25 cm acrylamide (Longranger, Cambrex) sequencing gel and run on a Gene Reader 4200 DNA analyzer (LiCor, Lincoln, NE). Results of the sequence run were converted into histogram plots utilizing the NIH image gel peak analysis feature (31).

Table 1.

Primer list.

Primer	Sequence (5′-3′)	Size (bp)
BV1	GATTTTTAGCCTTCTGTCC	156
BV2	CCAGGGTCCCCGGTTTCTCA	224
BV3.1	ACTGCCTCCGGTCGCTTCTCAC	169
BV3.2	ACTGCCTTCTGGTCGCTTCTCAC	168
BV3.3	ACTCTGCCTTGTATCTCTGTGCTA	89
BV4	AGGGCCCGGAGTTTCTGGT	224
BV6.1	CAACAATAAGGAACTCAT	213
BV6.2	TCTACTTTAATCAGGGACTCAATC	200
BV7	GCTGCTGCTCTACTACTATGAT	211
BV9	GGCTGCTCTACTGGTCCTATAATA	214
BV10	AGCCCCGAGAAAGGACACAGTTAT	277
BV12	CAGCGGCCTCTACTTCTTGTGGTG	89
BV13	ATGGGCCGAGGCTGATCTATTATT	221
BV14	TGCAGAAGCCACCTACGAAAGT	190
BV15	GCCCCGGGACGAGGAGTTGTATC	188
BV16	TTTGGGCTACAGCTGATCTACTAC	160
BV17	AGTCTACCAGCCTCTCACAG	107
BV18	GTCTCCGCACGATTCTCA	183
BC	TCTCTGCTTCCGATGGTTCAA

For comparison of the TCR Vβ repertoire between dogs, we have classified the spectratype profiles into three categories: polyclonal Gaussian, polyclonal skewed or oligoclonal ¹⁷. Polyclonal Gaussian profiles have at least 6 peaks that have a Gaussian distribution. Polyclonal skewed profiles have at least 6 peaks but with a shift of peak distribution off center. Lastly, oligoclonal profiles have 4 or less peaks with one predominant peak. A representative example of each of these profiles is illustrated in Fig. 1.

Figure 1. Classification of TCR Vβ spectratypes.

Polyclonal Gaussian distribution (A), polyclonal skewed distribution (B), and oligoclonal distribution (C).

RESULTS

Bone marrow transplantation

A total of ten bone marrow transplanted XSCID dogs were evaluated for their T cell diversity at varying times post transplant. Table 2 describes the type of transplant, whole bone marrow or purified bone marrow CD34⁺ cells, the dogs received and the time post transplant at which the initial evaluation of their T cell repertoire was performed. The oldest three dogs in this table (R743, X58 and R468) were also evaluated three years after the initial evaluation.

Table 2.

Type of and age post BMT of initial T cell repertoire evaluation.

Dog	Type of BMT	Age Post BMT*
R1501	WBM	4 months
R1503	WBM	4 months
X212	WBM	4 months
R1475	CD34 (5 × 106/kg)	6 months
R1263	CD34 (20 × 106/kg)	1.5 years
R1163	WBM	2 years
R868	CD34 (35 × 106/kg)	3.5 years
R743	CD34 (10 × 106/kg)	4.5 years
X58	WBM	5.5 years
R468	WBM	7.5 years

^* Age post BMT at which initial TCR Vβ analysis was performed.

Immune reconstitution

Prior to treatment, all XSCID dogs had the typical XSCID phenotype characterized by T cell lymphopenia with <0.5% of the peripheral blood lymphocytes being CD3⁺ as determined by flow cytometry. Figure 2 illustrates the kinetics of immune reconstitution in the XSCID dogs transplanted dogs with either unfractionated bone marrow or purified bone marrow CD34⁺ cells during the first six months following transplantation. The absolute lymphocyte counts (Fig. 2A) and proportion of peripheral T cells (Fig. 2B) had normalized by two months post transplantation in both groups of dogs. At two months post transplantation, when the proportion of peripheral T cells were within normal range, over 90% of the peripheral T cells in both groups expressed the CD45RA⁺ (naive) phenotype (Fig. 2C) suggesting that they developed through a thymic-dependent pathway (16,32-36). During the initial T cell regeneration in both groups of dogs the majority of the T cells express a CD4 phenotype as evidenced by the high CD4/CD8 ratio as compared to age-matched controls with the CD4/CD8 ratio decreasing to normal levels by six months post transplant (Fig. 2D). The ability of peripheral T cells to proliferate in response to the non-specific T cell mitogen PHA was evaluated as a measurement of T cell function. T cell function in both groups appeared normal by two months post transplant (Fig. 2E). All the transplanted dogs developed normal levels of IgG specific antibody following vaccination at six to eight months post transplant Fig. 2F).

Figure 2. Immunologic reconstitution in XSCID dogs following transplantation with whole bone marrow or CD34⁺ bone marrow cells.

Absolute lymphocyte counts (A), proportion of peripheral T cells (B), proportion of peripheral CD45RA⁺ (naïve) T cells (C), CD4/CD8 ratio (D), proliferative response following stimulation with PHA (E), and IgG speficic antibody response following immunization with tetanus toxoid (F).

Table 3 illustrates the immunologic phenotype of the transplanted dogs at the time their T cell repertoire was evaluated. All dogs had normal numbers of peripheral T cells at the time of evaluation. The CD4/CD8 ratio remained normal (>1.5) through 5 1/2 years post transplant whereas dogs evaluated after 5 1/2 years had a CD4/CD8 ratio ranging from 0.3 to 0.4. This in contrast to normal dogs that maintain a normal CD4/CD8 ratio averaging 1.5 up through 9 years of age that is similar to the average CD4/CD8 ratio of 1.5 in normal humans through 75 years of age (37-40). The proportion of peripheral CD45RA⁺ (naïve) T cells showed the typical age-related decrease from >85% through the first two years post transplant to 70% at 5 1/2 years post transplant, however the proportion of peripheral CD45RA⁺ T cells increased at the time of inverted CD4/CD8 ratios.

Table 3.

Immunologic phenotype of the transplanted dogs at the time of TCR Vβ analysis.

Dog	Post Transplant*	Lymphocytes	CD3†	CD4/CD8	CD45RA+ T Cells‡
R1501	4 months	7610	72.6	3.8	97.1
R1503	4 months	6910	81.2	4.2	98.7
X212	4 months	6080	77.5	3.6	96.4
R1475	6 months	5230	80.6	4.4	92.9
R1263	1.5 years	4800	81.4	2.1	88.5
R1163	2 years	2840	77.2	1.7	86.7
R868	3.5 years	3980	79.1	1.5	80.6
R743	4.5 years	3210	78.5	1.8	71.2
	7.5 years	1850	94.9	0.4	91.1
X58	5.5 years	3360	88.6	1.4	70.2
	8.5 years	3000	96.8	0.3	92.7
R468	7.5 years	2650	90.2	0.7	86.8
	10.5 years	2220	94.0	0.3	96.7
Normal Dogs	7 - 9 years old	2625 +/- 812**	82.1 +/- 5.3	1.5 +/- 0.2	73.4 +/- 3.1

^* Time post transplant at which TCR Vβ analysis was performed.

^† Prroportion of CD3⁺ T cells in the lymphocyte gate.

^‡ Proportion of CD3⁺ T cells that are CD45RA⁺.

^** Mean +/- SD

TCR Vβ diversity following bone marrow transplantation

T cell diversity was evaluated by TCR Vβ CDR3-size spectratyping, a method that measures the size heterogeneity of the TCR hypervariable CDR3 region, in ten XSCID dogs at varying times following bone marrow transplantation ranging from 4 months through 10 1/2 years post transplant. Normal individuals possess complex and diverse spectratypes that are characterized by a Gaussian distribution of multiple bands representing the different lengths of the respective CDR V-D-J regions. XSCID dogs were not evaluated prior to transplant since, at that time, there were <0.5% peripheral T cells. T cell diversity was also evaluated in normal dogs ranging from 2 to 7 years of age. Fig. 3 illustrates the individual spectratypes for each of the bone marrow transplanted XSCID dogs at their initial evaluation and a representative two year old and seven year old normal dog. Figure 4 illustrates the proportion of spectratypes demonstrating a polyclonal Gaussian, polyclonal skewed or oligoclonal profile in individual normal dogs of various ages and in transplanted XSCID dogs at various time points following BMT

Figure 3. TCR Vβ spectratypes of normal dogs and XSCID dogs following bone marrow transplantation.

The normal dogs are designated with an N and the bone marrow transplanted dogs designated with B. The numbers following the N represent age of the dog in years and the numbers following the B represent the age in years following transplant.

Figure 4. TCR Vβ spectratyping in normal dogs and transplanted XSCID dogs.

Each time point represents the summary results from an individual dog. Results are expressed as percentage of total Vβ families representing a polyclonal Gaussian (PG), polyclonal skewed (PS), or oligoclonal (O) phenotype. N-2, N-4, N-7 = normal dogs at 2, 4 and 7 years of age.

TCR Vβ diversity in normal dogs remains polyclonal through at least six years of age with >70% of the spectratypes exhibiting a polyclonal Gaussian profile. By four months post BMT, when normal numbers of CD45RA⁺ T cells and normal T cell function are present, the transplanted dogs show a normal, diverse T cell repertoire with >89% of the spectratypes exhibiting a polyclonal Gaussian profile. Between 2 and 3 1/2 years post transplant TCR Vβ diversity showed signs of decreasing as evidenced by a decrease in the proportion of polyclonal Gaussian profiles and the appearance of oligoclonal profiles, such that at 7 1/2 years post transplant 56% of the profiles were polyclonal Gaussian and 28% oligoclonal.

We had the opportunity to evaluate the TCR Vβ diversity in the three older transplanted dogs three years following the initial evaluation --- 7 1/2, 8 1/2 and 10 1/2 years post BMT. Fig. 5 shows the individual spectratypes of the three dogs at the initial evaluation and three years later, while Fig. 6 illustrates the proportion of spectratypes demonstrating a polyclonal Gaussian, polyclonal skewed or oligoclonal profile in these dogs. At the time of the second evaluation, all three dogs had CD4/CD8 ratios ranging from 0.3 to 0.4. Substantial changes in the TCR Vβ diversity were observed in two of the dogs between the initial and second evaluation. For example, the proportion of polyclonal Gaussian spectratypes decreased from 56% to 33% in dog R743 between 4 1/2 and 7 1/2 years post transplant while the proportion of polyclonal skewed spectratypes increased from 28% to 56%, and the proportion of polyclonal Gaussian spectratypes decreased from 56% to 33% in dog R468 between 7 1/2 and 10 1/2 years post transplant and the proportion of polyclonal skewed spectratypes increased from 17% to 50%. In the third dog, X58, the decrease in the percentage of polyclonal Gaussian TCR Vβ families was smaller between 5 1/2 and 8 1/2 years post transplant.

Figure 5. TCR Vβ spectratypes of three XSCID dogs three years following initial evaluation.

Dog R743 was evaluated at 4.5 years and 7.5 years post transplant. Dog X58 was evaluated at 5.5 years and 8.5 years post transplant. Dog R468 was evaluated at 7.5 years and 10.5 years post transplant.

Figure 6. TCR Vβ spectratyping in three transplanted XSCID dogs at initial testing and three years later.

Results are expressed as percentage of total Vβ families representing a polyclonal Gaussian (PG), polyclonal skewed (PS), or oligoclonal (O) phenotype.

DISCUSSION

The kinetics of T cell reconstitution was similar in the XSCID dogs transplanted with histocompatible whole bone marrow cells or highly purified histocompatible CD34⁺ bone marrow cells, essentially a T cell depleted transplant, and is similar to that observed in human T cell-depleted histocompatible and haploidentical transplants, or purified CD34⁺ transplants (7,16,34,41). The delay in T cell reconstitution in the XSCID dogs transplanted with histocompatible whole bone marrow cells is in contrast to the rapid T cell engraftment in human XSCID patients following transplantation of whole bone marrow cells from a histocompatible donor due to peripheral expansion of mature T cells in the graft. Although active T cell depletion was not performed in our studies, the method used to harvest the bone marrow for the whole bone marrow transplants results in a final preparation containing <1% mature T cells, compared to the 13 to 25% mature T cells reported in aspirated human adult bone marrow preparations (42-44). Thus, our canine transplants using whole bone marrow more closely resemble human T cell-depleted transplants than human transplants using whole bone marrow and any T cell reconstitution depends upon active thymopoiesis.

There are similarities and differences between the results of this study in transplanted XSCID dogs and boys (16,17). In both the XSCID dogs and human XSCID patients, normal T cell diversity was evident when the number of CD45RA⁺ T cells had normalized. Both showed a decrease in the complexity of their T cell repertoire with age that appears to occur more rapidly than in normal individuals. At the time transplanted XSCID dogs and boys show a predominance of skewed or oligoclonal T cell repertoires, there was a predominance of CD8⁺ peripheral T cells resulting in a CD4/CD8 ratio of <1.0. The predominance of skewed or oligoclonal T cell spectratypes observed in the older XSCID boys was attributed to oligoclonal expansion within the predominant CD8⁺ T cell population. T cell diversity within the CD4⁺ and CD8⁺ T cell populations was not evaluated in the transplanted XSCID dogs, however it is likely that a similar phenomenon is responsible for the observed results in the transplanted XSCID dogs. Although it is well documented that oligoclonal expansion occurs in CD8⁺ T cells in elderly normal humans (45-47), the overall T cell diversity remains high since the CD4/CD8 ratio remains normal and the CD4⁺ T cell population maintains a diverse repertoire (48).

In the human XSCID patients, the expanded CD8⁺ T cells expressed a memory (CD45R0⁺) phenotype that resulted in a ratio of CD45RA⁺ (naïve)/CD45R0⁺ (memory) T cells of approximately 0.5. The transplanted XSCID dogs showed an increase in the proportion of CD45RA⁺ T cells to >90% at the time CD8⁺ T cells became predominant. Although not directly examined in this study, we have previously shown that in immune reconstituted XSCID dogs with CD4/CD8 ratios of <0.5, approximately 50% of CD4⁺ T cells express a CD45RA⁺ phenotype whereas >80% of the CD8⁺ T cells express a CD45RA⁺ phenotype (Kennedy et al., manuscript submitted). A possible explanation for this apparent discrepancy is that a subset of memory/activated CD8⁺ T cells have been shown to express a CD8⁺CD45RA⁺ phenotype (49-50). Hamann et al. (49) have shown these cells are induced by antigen, and evolve through extensive rounds of division that results in oligoclonality of their TCR Vβ repertoire. Thus, it is likely that the CD8⁺CD45RA⁺ T cells in the transplanted XSCID dogs may represent memory CD8⁺ T cells.

Although the transplanted XSCID dogs showed an age-related decline in their T cell diversity similar to that observed in the transplanted human XSCID patients, this decrease appeared to be delayed in the dog. Significant skewing of the T cell repertoire occurred between 10 to 12 years post transplant in the human XSCID patients with the majority of Vβ families exhibiting a skewed phenotype. Predominance of skewed Vβ phenotypes was not observed in the transplanted XSCID dogs until approximately 7 1/2 years following transplantation, the equivalent to a 45 year old human based upon the comparison of biologic aging between dogs and humans (51).

The transplants described in this study are similar to those performed in human XSCID patients transplanted in the neonatal period (<28 days of age) (52). Human XSCID patients transplanted in the neonatal period show an increased success rate, more rapid increase in the regeneration of the proportion of naïve peripheral T cells and higher numbers of naïve peripheral T cells, and more rapid increase and higher numbers of TRECs following transplantation than those XSCID patients transplanted past the neonatal period. One could propose that the delay in the decline of T cell diversity observed in the XSCID dogs might be related to the fact that they were transplanted as neonates. Although the T cell repertoire was not examined in the human neonatal XSCID transplant study, transplantation in the neonatal period did not improve the long-term T cell reconstitution since at 10 years post transplant the patients transplanted in the neonatal period showed the same decline in the number of CD45RA⁺ T cells and TREC levels as that seen in patients transplanted after the neonatal period.Since T cell diversity has been shown to be directly correlated with TREC levels in XSCID patients following bone marrow transplantation (17), it is likely that skewing of the T cell repertoire occurs at a similar time in neonatally transplanted patients as those transplanted after the neonatal period.

An alternative, and more likely, explanation is the dose of hematopoietic stem cells (HSC) used in the dog transplants. Although the dose of whole bone marrow used in this study was comparable to that used in human histocompatible transplants, the actual dose of HSC, as determined by the number of CD34⁺ cells, was significantly greater because of the age of the donor used in the dog studies. CD34 is expressed on a subpopulation of hematopoietic cells that contain both stem cells, presumably pluripotent stem cells, and early committed progenitors that are capable of multilineage engraftment in humans, mice, nonhuman primates, and, more recently, dogs (25,28,53-58). It is clear from a large body of clinical and experimental data that a population of cells within the CD34⁺ population are both pluripotent and capable of self-renewal. Although CD34 expression is currently used as a surrogate marker for human and canine HSC, it has been proposed that the T cell reconstitution observed in nonconditioned or nonmyeloabated human XSCID and Jak3 SCID patients is due to T cell progenitors with little, if any, engraftment of HSCs (59). This model is based upon the observation that although >90% of the peripheral T cells in successfully transplanted nonconditioned or nonmyeloablated XSCID and Jak3 SCID patients are donor-derived following BMT, <10% of the patients possess donor-derived B cells or myeloid cells (14,59). This model predicts that there would be a gradual decline in newly formed T cells after bone marrow transplantation in these patients which is supported by the fact that TREC levels in these patients decline to very low levels by 10 to 12 years post transplant (16,59).

There may be qualitative differences in the numbers of infused HSC or committed lymphoid progenitors in the present experiment. All the donors in our study were neonatal puppies, whereas, the majority of human donors are older siblings or adults. Aspirates of human adult bone marrow contain approximately 1 to 2% CD34⁺ cells, whereas the proportion of CD34⁺ cells obtained by flushing fetal bone marrow is significantly higher with up to 20% CD34⁺ cells (54,60-62). Similar age-related differences exist in the proportion of CD34⁺ cells in the dog. Canine adult bone marrow contains approximately 2% CD34⁺ cells (28), whereas, the proportion of bone marrow CD34⁺ cells in neonatal canine bone marrow ranges between 8 to 14% (63).Therefore, the use of neonatal donors in our canine whole bone marrow transplants resulted in the transplantation of between 4 to 7-fold more CD34⁺ cells and likely HSC than used in the similar human transplants. The dose of purified CD34⁺ bone marrow cells was similar to the dose of CD34⁺ cells contained in the whole bone marrow grafts. We have previously reported that transplantation of nonconditioned XSCID dogs with whole bone marrow or purified CD34⁺ cells does not result in donor myeloid chimerism, but, in contrast to human XSCID patients, >90% of successfully transplanted XSCID dogs demonstrate up to 20% donor B cell chimerism (23,25). The transplantation of significantly higher numbers of CD34⁺ bone marrow cells may result in the engraftment of a more immature lymphoid progenitor that could result in a more sustained T cell regeneration. This hypothesis can be tested by transplanting XSCID dogs with similar doses of CD34⁺ bone marrow cells as routinely used in transplantation of XSCID boys.

In conclusion, XSCID dogs develop a normal T cell repertoire following nonablative bone marrow transplantation similar to that observed in XSCID boys following nonablative BMT. However, in contrast to transplanted XSCID boys who show a significant decline in their T cell diversity by 10 to 12 years following BMT, transplanted XSCID dogs maintain a polyclonal, diverse T cell repertoire through mid-life.