Abstract
Enterobacter cloacae is an emerging clinical pathogen that may be responsible for nosocomial infections. Management of these infections is often difficult, owing to the high frequency of strains that are resistant to disinfectants and antimicrobial agents in the clinical setting. Multidrug efflux pumps, especially those belonging to the resistance-nodulation-division family, play a major role as a mechanism of antimicrobial resistance in gram-negative pathogens. In the present study, we cloned and sequenced the genes encoding an AcrAcB-TolC-like efflux pump from an E. cloacae clinical isolate (isolate EcDC64) showing a broad antibiotic resistance profile. Sequence analysis showed that the acrR, acrA, acrB, and tolC genes encode proteins that display 79.8%, 84%, 88%, and 82% amino acid identities with the respective homologues of Enterobacter aerogenes and are arranged in a similar pattern. Deletion of the acrA gene to yield an AcrA-deficient EcDC64 mutant (EcΔacrA) showed the involvement of AcrAB-TolC in multidrug resistance in E. cloacae. However, experiments with an efflux pump inhibitor suggested that additional efflux systems also play a role in antibiotic resistance. Investigation of several unrelated isolates of E. cloacae by PCR analysis revealed that the AcrAB system is apparently ubiquitous in this species.
Multidrug efflux pumps, especially those belonging to the resistance-nodulation-division family, play a major role in establishing the “intrinsic or acquired” resistance of gram-negative bacteria to a wide range of toxic compounds, including antibiotics (20).
A well-studied example is the AcrAB-TolC multidrug resistance (MDR) tripartite pump system of Escherichia coli, which confers resistance to a wide variety of lipophilic and amphiphilic compounds, including dyes, detergents, and antimicrobial agents such as ethidium bromide, crystal violet, sodium dodecyl sulfate, bile acids, tetracycline, chloramphenicol, fluoroquinolones, β-lactams, erythromycin, and fusidic acid (17, 18). The presence of similar systems has been reported for other members of Enterobacteriaceae (2, 9, 11, 12, 14, 15, 16, 21, 28).
The species of Enterobacter that most commonly cause nosocomial infections are E. cloacae and E. aerogenes (24). The existence of an acrB-like gene (11) has previously been identified in E. cloacae, although none of the components of the efflux pump have been cloned.
The objectives of the present study were (i) to characterize the genes encoding the AcrAB-TolC-like efflux pump of E. cloacae and (ii) to determine the involvement of this efflux pump in MDR in E. cloacae. The clinical strain used in the study was an MDR strain of E. cloacae (EcDC64) which overexpressed the AcrAB system and also overexpressed the chromosomal ampC gene and exhibited a drastic reduction of ompC gene expression.
(These results were presented in part at the 45th Interscience Conference on Antimicrobial Agents and Chemotherapy [2a].)
MATERIALS AND METHODS
Bacterial strains and growth media.
The bacterial strains used in the study are listed in Table 1. Enterobacter cloacae clinical isolate EcDC64 was isolated from a patient admitted to the intensive care unit of the Juan Canalejo Hospital (La Coruña, NW Spain). The bacterial isolate was identified by a MicroScan Walkaway (Dade Behring, Barcelona, Spain), and the identification was confirmed by API 20E (bioMérieux, Marcy l'Etoile, France). Escherichia coli TG1 strain was used for cloning procedures. All strains used in the study were maintained at −80°C in 15% (vol/vol) glycerol for cryoprotection until use. The strains were grown on MacConkey agar plates (Becton, Dickinson and Company, NJ), in Luria-Bertani (LB) broth, or on LB agar in the presence of 25 μg of kanamycin/ml or 20 μg of chloramphenicol/ml when required.
TABLE 1.
Bacterial strains and plasmids used in the present study
| Strain or plasmid | Features (resistance markera) | Source or reference |
|---|---|---|
| Strains | ||
| EcDC64 | Multiresistant E. cloacae clinical strain isolated from a patient admitted to our hospital | This study |
| EcΔacrA | EcDC64 with acrA gene knockout | This study |
| EcΔacrA(pAP-2) | EcΔAcrA transformed with pAP-2 | This study |
| EcΔacrA(pACYC184) | EcΔAcrA transformed with pACYC184 | This study |
| EcDC64(pAP-3) | EcDC64 transformed with pAP-3 | This study |
| EcDC64(pBGS18) | EcDC64 transformed with pBGS18 | This study |
| E. cloacae Jc 194 | Carbapenem-susceptible strain used as reference strain in RT-PCR experiments | This study |
| Plasmids | ||
| pBGS18 | Cloning vector (kanamycin) | 26 |
| pACYC184 | Cloning vector (chloramphenicol and tetracycline) | 3, 22 |
| pKOBEG | Cloning vector (chloramphenicol) | 4 |
| pAP-1 (pBGS18-ampD) | ampD gene from E. coli cloned into pBGS18 (kanamycin) | This study |
| pAP-2 (pACYC184-acrA) | acrA gene from EcDC64 isolate cloned into pACYC184 (chloramphenicol) | This study |
| pAP-3 (pBGS18-acrR) | acrR gene from E. aerogenes cloned into pBGS18 (kanamycin) | This study |
Resistance markers for plasmids are shown in parentheses.
Susceptibility testing.
Antibiotic susceptibility was determined by the following three different methods, depending on the antimicrobial availability.
The MICs of the following antibiotics were determined by Etest (AB Biodisk, Solna, Sweden) following the manufacturer's criteria: ampicillin, penicillin, amoxicillin-clavulanic acid, piperacillin, cephalothin, cefoxitin, cefuroxime, ceftazidime, aztreonam, cefotaxime, imipenem, meropenem, oxacillin, erythromycin, clindamycin, tetracycline, chloramphenicol, tobramycin, gentamicin, amikacin, ciprofloxacin, tigecycline, linezolid, and trimethoprim-sulfamethoxazole.
Susceptibility to the following antibiotics were determined by the standard disk diffusion method (Becton, Dickinson and Company, NJ) on Mueller-Hinton agar: telithromycin, fusidic acid, novobiocin, nalidixic acid, rifampin, and norfloxacin.
The broth microdilution method (19) was used for detergents and dyes, sodium dodecyl sulfate, sodium cholate, sodium deoxycholate, acriflavine (Sigma-Aldrich, St. Louis, MO), ethidium bromide, Triton X-100 (AppliChem GmbH, Darmstadt, Germany), and crystal violet (Merck, Darmstadt, Germany). The inoculum of E. cloacae cultures consisted of 5 × 105 CFU/ml, and the plates were incubated for 16 to 20 h at 37°C. As the end point, the lowest concentration of the compound that completely inhibited growth was recorded as the MIC.
The MICs of all antimicrobial agents, but not of the detergents and dyes (see Tables 4 and 5), were also determined with the efflux pump inhibitor Phe-Arg-β-naphthylamide (PAβN; Sigma-Aldrich, St. Louis, MO) at a final concentration of 20 μg/ml.
TABLE 4.
Antibiotic susceptibility profiles (MICs) for the indicated bacterial isolates
| Antibiotica | MIC (μg/ml) for:
|
|||||||
|---|---|---|---|---|---|---|---|---|
| EcDC64 | EcDC64 + PAβNb | EcΔacrA | EcΔacrA + PAβNb | EcΔacrA(pAP-2) | EcΔacrA(pACYC184) | EcDC64(pAP-3) | EcDC64(pBGS18) | |
| AMP | >256 | >256 | >256 | >256 | >256 | >256 | >256 | >256 |
| PEN | >256 | >256 | >256 | >256 | >256 | >256 | >256 | >256 |
| AMC | >256 | >256 | >256 | >256 | >256 | >256 | >256 | >256 |
| PIP | >256 | 192 | 192 | 6 | >256 | >256 | 96 | >256 |
| CEF | >256 | >256 | >256 | >256 | >256 | >256 | >256 | >256 |
| FOX | >256 | >256 | >256 | >256 | >256 | >256 | >256 | >256 |
| CXM | >256 | >256 | >256 | 48 | >256 | >256 | >256 | >256 |
| CAZ | >256 | >256 | >256 | 16 | >256 | >256 | >256 | >256 |
| CTX | >256 | >256 | >256 | 8 | >256 | >256 | >256 | >256 |
| IPM | >32 | 32 | 24 | 6 | >32 | >32 | 24 | >32 |
| MEM | >32 | 32 | 24 | 1 | >32 | >32 | 24 | >32 |
| ATM | >256 | 64 | 64 | 2 | >256 | 128 | 64 | >256 |
| OXA | >256 | 48 | 96 | 4 | >256 | >256 | >256 | >256 |
| ERY | >256 | 1 | 12 | 0.094 | 128 | 16 | 48 | >256 |
| CLI | >256 | 6 | 2 | 1 | >256 | 4 | 32 | >256 |
| TET | >256 | 64 | 64 | 1.5 | >256 | 64 | 192 | >256 |
| CHL | 8 | 0.25 | 0.5 | 0.047 | >256 | >256 | 1 | 8 |
| TOB | 1.5 | 0.5 | 0.125 | 0.047 | 1.5 | 0.25 | 0.38 | 1 |
| GEN | 1.5 | 0.5 | 0.125 | 0.094 | 1 | 0.125 | 0.25 | 1 |
| AMK | 2 | 1.5 | 0.5 | 0.125 | 2 | 0.5 | 1 | 2 |
| CIP | 0.047 | 0.006 | 0.003 | <0.002 | 0.094 | 0.004 | 0.003 | 0.032 |
| TGC | 0.75 | 0.125 | 0.125 | 0.064 | 0.75 | 0.5 | 0.19 | 0.38 |
| LZD | >256 | 4 | 8 | 0.5 | >256 | 4 | >256 | >256 |
| SXT | 0.125 | 0.094 | 0.012 | 0.032 | 0.75 | 0.016 | 0.064 | 0.094 |
Abbreviations for antibiotics: AMP, ampicillin; PEN, penicillin; AMC, amoxicillin-clavulanic acid; PIP, piperacillin; CEF, cephalothin; FOX, cefoxitin; CXM, cefuroxime; CAZ, ceftazidime; CTX, cefotaxime; ATM, aztreonam; IPM, imipenem; MEM, meropenem; OXA, oxacillin; ERY, erythromycin; CLI, clindamycin; TET, tetracycline; CHL, chloramphenicol; TOB, tobramycin; GEN, gentamicin; AMK, amikacin; CIP, ciprofloxacin; TGC, tigecycline; LZD, linezolid; SXT, trimethoprim-sulfamethoxazole.
MICs were determined with PAβN at 20 μg/ml.
TABLE 5.
Antibiotic susceptibility profiles, expressed as diameters of the inhibition zones (in mm) determined by the standard disk diffusion method, for the indicated bacterial isolates
| Antibiotica | Susceptibility profile (diameter of inhibition zone [in mm]) for:
|
|||||||
|---|---|---|---|---|---|---|---|---|
| EcDC64 | EcDC64 + PAβNb | EcΔacrA | EcΔacrA + PAβNb | EcΔacrA(pAP-2) | EcΔacrA(pACYC184) | EcDC64(pAP-3) | EcDC64(pBGS18) | |
| TEL | 9 | 32 | 19 | 34 | 13 | 18 | 12 | 10 |
| FUS | 0 | >40 | 0 | 26 | 0 | 0 | 0 | 0 |
| NOV | 0 | 20 | 16 | 22 | 0 | 14 | 0 | 0 |
| NAL | 24 | 27 | 33 | 40 | 12 | 30 | 29 | 21 |
| RIF | 0 | 26 | 13 | 28 | 0 | 8 | 10 | 10 |
| NOR | 26 | 40 | 40 | 42 | 24 | 38 | 35 | 27 |
Abbreviations for antibiotics: TEL, telithromycin; FUS, fusidic acid; NOV, novobiocin; NAL, nalidixic acid; RIF, rifampin; NOR, norfloxacin.
Concentration of PAβN, 20 μg/ml.
AmpC overexpression.
To demonstrate the involvement of AmpC expression in the β-lactam resistance of the EcDC64 isolate, β-lactam MICs were also determined in the presence of 100 μg/ml of cloxacillin. A plasmid construct named pAP-1 (Table 1), which consisted of the ampD gene from E. coli cloned into the pBGS18 plasmid, was also used. EcDC64 was electroporated with pAP-1, transformants were selected in 25 μg/ml of kanamycin, and the β-lactam MICs were determined and compared to those of EcDC64 carrying the empty vector.
PCR amplification and sequencing of acrR, acrA, acrB, and tolC efflux pump genes.
Genomic DNA from EcDC64 was extracted from overnight cultures at 37°C by use of the MasterPure genomic DNA purification kit (EPICENTRE Biotechnologies, Madison, WI). The oligonucleotides used to clone efflux pump genes are listed in Table 2. Oligonucleotides were designed on the basis of the previously reported nucleotide sequence of the E. aerogenes AcrAB-TolC (21) (accession numbers AJ306389 and AJ306390) and the recently released Enterobacter sp. strain 638 complete genome (accession number CP000653). PCR was performed with the extracted genomic DNA in 50 μl of a mixture containing 50 ng of DNA template, 300 nM of each primer, 200 μM of each deoxynucleoside triphosphate, 1.5 mM MgCl2, 5 μl of the polymerase buffer, and 2.6 U of Expand high-fidelity enzyme (Roche Diagnostics GmbH; Mannheim, Germany). After an initial denaturation step of 2 min at 94°C, amplification was performed over 25 cycles consisting of 15 s at 94°C, 30 s at the hybridization temperature (60°C, 55°C, 48°C, and 45°C for acrA, acrB, tolC, and acrR genes, respectively), and 1 min at 72°C for elongation, followed by a final extension step of 7 min at 72°C. The PCR product was purified by a HighPure PCR product purification kit (Roche Diagnostics GmbH; Mannheim, Germany) and then cloned into the pCR2.1-TOPO TA cloning vector according to the manufacturer's instructions (Invitrogen Corporation, CA). Sequencing was carried out with a Taq DyeDeoxiTerminator cycle sequencing kit in an automatic DNA sequencer (377 ABI-Prism; Perkin-Elmer). Each product was sequenced on both strands.
TABLE 2.
Oligonucleotides used in the present study
| Function | Primer | Gene | Procedure | Sequence (5′→3′)b |
|---|---|---|---|---|
| Cloning | acrA-F | acrA | Cloning | aagatatcATGAACAAAAACAGAGGGTTAACG |
| acrA-R | acrA | Cloning | aaaagcttTTAAGACTTGGTTTGTTCAGACTG | |
| acrB-F | acrB | Cloning | ATGCCTAATTTCTTTATCGATCGC | |
| acrB-Ra | acrB | Cloning | RTGRTGRTCNACNGGRTGRTT | |
| tolC-F | tolC | Cloning | ATGCAAATGAAGAAA | |
| tolC-R | tolC | Cloning | TTAATGACGGAACGGATT | |
| acrR-F | acrR from E. aerogenes | Cloning | aaggatccATGGCACGAAAAACCAAACAACAGG | |
| acrR-R | acrR from E. aerogenes | Cloning | aagaattcTCAGGCCATGACCTCAGAGC | |
| pctx-F | promoter CTX-M-14 | Cloning | aaaggatccCCATCAATAAAATTGAG | |
| pctx-R | promoter CTX-M-14 | Cloning | aagatatcCTCAAACTCCCAATACG | |
| acrAKm-F | acrA | Knockout | GGCGTCGTGACGCTCAAATCCGAACCTCTCCAGATGACAACAGAACTACCGGGCCGCACCAAAGCCACGTTGTGTCTCAA | |
| acrAKm-R | acrA | Knockout | TGAAGCTACTTCCTGAGCCTTGACCTGCGCGCCAGGACGAACTTTTTGCAAACCAGTAATGCGCTGAGGTCTGCCTCGTG | |
| Expression studies (RT-PCR) | rpoB-Fa | rpoB | RT-PCR | CAGCCGCGAYCAGGTTGACTACA |
| rpoB-R | rpoB | RT-PCR | GACGCACCGCAGGATACCACCTG | |
| ompC-F | ompC | RT-PCR | AGGTTAACGATCAACTGACCGG | |
| ompC-R | ompC | RT-PCR | AAATTTCAGACCGGCGAACGCC | |
| ompF-F | ompF | RT-PCR | AGTGGGAATATAACTTCCAGGG | |
| ompF-R | ompF | RT-PCR | TGCGTCACCGAATTTCAGGCC | |
| acrART-F | acrA | RT-PCR | GATTATGATTCTGCCTTGGCCG | |
| acrART-R | acrA | RT-PCR | CAATGCGACCGCTGATAGGGG | |
| Operon assembly | aefA-Fc | aefA from E. cloacae | Amplification of the acrR-acrA intergenic region | GTACATCGCGTTCTGCACGCG |
| acrA2-Rc | acrA from E. cloacae | Amplification of the acrR-acrA intergenic region | TGCCTTGACATCACCGCCTTC | |
| acrA3-Fd | acrA from E. cloacae | Amplification of the acrAB intergenic region | CGACAAACAACAAGCGTCGGC | |
| acrB2-Rd | acrB from E. cloacae | Amplification of the acrAB intergenic region | ATGATGATTATGGCGATCACCC |
Oligonucleotide degenerated where R is A or G; N is A, C, G, or T; and Y is C or T.
Lowercase and italic nucleotides indicate restriction sites for cloning.
Oligonucleotides used for amplification, cloning, and sequencing of the acrR gene and the acrR-acrA intergenic region of the operon from E. cloacae EcDC64. F, forward; R, reverse.
Oligonucleotides used for amplification, cloning, and sequencing of the acrAB intergenic region of the operon from E. cloacae EcDC64. F, forward; R, reverse.
Disposition of each of the gene of the operon (acrR, acrA, and acrB) was achieved by individual PCR products overlapping each other through the use of the indicated oligonucleotides (Table 2) (data not shown).
Nucleotide and amino acid sequence analysis was carried out by use of the following programs: ExPASy Proteomics Tools (http://www.ch.embnet.org/software/LALIGN_form.html) and BLAST (http://www.ncbi.nlm.nih.gov/BLAST/).
Construction of the acrA gene mutant.
Disruption of the acrA gene in EcDC64 was performed by the method described by Datsenko and Wanner (6) with some modifications. The Red helper plasmid pKOBEG (gift from J. M. Ghigo) (4) (Table 1) is a low-copy-number plasmid that contains a gene for chloramphenicol resistance, a temperature-sensitive origin of replication, and the Red system, which includes three genes that express an exonuclease and the β and γ functions of phage λ. Plasmid pKOBEG (Table 1) was introduced into EcDC64 by heat shock, and transformants were selected on LB agar with chloramphenicol (20 μg/ml) after incubation for 24 h at 30°C. One transformant carrying the Red helper plasmid was made electrocompetent. A selectable kanamycin resistance gene was amplified by PCR from genomic DNA obtained from E. coli MC4100 (a gift from J. M. Ghigo) by use of primers that included 5′ extensions with homology for the acrA locus, i.e., acrAKm-F(forward) and acrAKm-R (reverse) in Table 2. The PCR product was used to disrupt the acrA gene of EcDC64(pKOBEG) by electroporation. Electroporation (25 μF, 200 Ω, 2.5 kV) of the EcDC64 electrocompetent strain was carried out according to the manufacturer's instructions (Bio-Rad Laboratories, Madrid, Spain) with 50 μl of cells and 1 μg of purified and dialyzed (0.025-μm nitrocellulose filters; Millipore, Billerica, MA) PCR product. Shocked cells were added to 1 ml of LB broth, incubated for 1 h at 30°C, spread onto LB agar with kanamycin (25 μg/ml), and then incubated at 30°C for 24 h. The EcΔacrA::Km mutant strain was then grown on LB agar with kanamycin (25 μg/ml) at 43°C for 24 h and incubated overnight on LB agar with kanamycin (25 μg/ml) and LB agar with chloramphenicol (20 μg/ml) at 30°C to test for the loss of the helper plasmid.
To confirm the acrA deletion, a PCR assay with oligonucleotides (Table 2) that hybridize in the acrA gene was done. As expected, a band of 1,450 nucleotides (nt) was obtained by PCR, owing to the replacement of the acrA gene (1,194 nt) with the kanamycin resistance gene (1,450 nt).
Construction of pAP-2 and pAP-3 vectors.
For pAP-2 construction (Table 1), two oligonucleotide primers (Table 2) were designed from the acrA sequence of E. aerogenes to amplify, by PCR, the acrA gene from EcDC64. The amplified DNA was purified, digested with EcoRV and HindIII, and then ligated (rapid DNA ligation kit; Roche Diagnostics GmbH, Mannheim, Germany) into a similarly digested expression pACYC184 vector under the control of the CTX-M-14 gene promoter. The CTX-M-14 gene promoter was first amplified with the pctx oligonucleotides (Table 2), designed from position 1502 to position 1740 of the sequence with EMBL database accession no. AF252622 from an E. coli clinical isolate harboring the blaCTX-M-14 gene, and then cloned into the pACYC184 vector. The accuracy of the construct was checked by restriction analysis. The recombinant plasmid (pAP-2) was then introduced into the EcΔAcrA competent cells for complementation studies.
For pAP-3 construction (Table 1), the full acrR gene was amplified with specific oligonucleotides acrR-F and acrR-R (Table 2). The amplified fragment of 650 bp was then digested with BamHI/EcoRI and ligated to the pBGS18 plasmid (26) under the control of the above-mentioned CTX-M-14 gene promoter. The accuracy of the construct was checked by restriction analysis. The recombinant plasmid (pAP-3) was then introduced into the EcDC64 competent cells for antimicrobial susceptibility studies.
Real-time RT-PCR.
Real-time reverse transcription-PCR (RT-PCR) was carried out to determine the expression levels of the ompC and ompF porin genes as well as of the tripartite efflux component, acrA. In all cases, the expression levels were normalized to the rpoB housekeeping gene coding for the RNA polymerase beta subunit. Primers designed from sequences with accession numbers AJ316540, AJ316539, EF627524, and AJ854260 from the ompF, ompC, acrA, and rpoB genes, respectively, were used. Total RNA was isolated with TRIzol reagent (Invitrogen Corporation, CA) according to the manufacturer's instructions and treated with RNase-free DNase I (Invitrogen Corporation, CA). The concentration of RNA was determined spectrophotometrically. RNA (1 μg) was reverse transcribed into single-stranded cDNA by use of a Transcriptor first-strand cDNA synthesis kit (Roche Diagnostics GmbH, Mannheim, Germany), according to the manufacturer's instructions. The cDNAs were quantified by real-time PCR amplification with specific primers (Table 2) by use of a Light Cycler 480 SYBR green I master kit and a Light Cycler 480 instrument (both from Roche Diagnostics GmbH, Mannheim, Germany) with an initial incubation of 95°C for 10 min followed by 45 cycles of 10 s at 95°C, 20 s at 60°C, and 10 s at 72°C. The expression levels were standardized relative to the transcription levels of rpoB (a housekeeping gene) for each isolate.
Detection of the acrA gene in several E. cloacae isolates.
To determine whether the AcrAB-TolC efflux pump is widespread among clinical isolates of E. cloacae, a PCR assay was carried out to detect the acrA gene in different E. cloacae isolates. Six genotypically different E. cloacae isolates (repetitive extragenic palindromic-PCR tested), which showed different antibiotic susceptibility patterns and which had been collected in the hospital during the previous 5 years, were used. The reactions were carried out with a 50-μl volume of a reaction mixture containing 1.5 mM of MgCl2, 200 μM of each deoxynucleoside triphosphate, 300 nM of each primer, 50 ng of chromosomal DNA, 5 μl of the polymerase buffer, and 2.5 U of Taq polymerase. The primers of the acrA-coding region, acrA-F and acrA-R (Table 2), were used. Amplification reactions were submitted to the following program: initial denaturation (10 min at 94°C) followed by 30 cycles of denaturation (2 min at 94°C), annealing (1 min at 45°C), and extension (1 min at 72°C), with a single extension cycle of 10 min at 72°C.
Nucleotide sequence accession numbers.
The nucleotide sequence data in the study will appear in the EMBL/GenBank/DDBJ nucleotide sequence database. The accession numbers are as follows: EF627524 for the acrR, acrA, and acrB genes and AM287288 for the tolC gene.
RESULTS AND DISCUSSION
Cloning, sequencing, and analysis of the AcrAB-TolC efflux pump genes of E. cloacae EcDC64.
Enterobacter cloacae EcDC64 was a clinical isolate which showed an antibiotic multiresistance profile (see Table 4).
The acrR, acrA, acrB, and tolC genes from EcDC64 were amplified by high-fidelity PCR, cloned into the pCR2.1-TOPO TA cloning vector, and sequenced. Sequence analysis showed that genes acrR, acrA, acrB, and tolC from E. cloacae, which were 654, 1,194, 3,147, and 1,485 bp long, encoded proteins of 218, 397, 1,048, and 494 amino acids, respectively. AcrR, AcrA, AcrB, and TolC proteins from EcDC64 displayed 79.8%, 84%, 88%, and 82% amino acid identities with the respective homologues of E. aerogenes (21) and showed similar levels of similarity with the homologues of other Enterobacteriaceae.
It should be noted that PCR experiments carried out with oligonucleotides designed on the acrR gene of E. aerogenes and hybridization studies with the full acrR gene of E. aerogenes as the probe failed to amplify the acrR gene. We therefore decided to amplify a region upstream of the putative location of the acrR gene on the genome map of E. aerogenes. For this purpose, we designed a forward oligonucleotide based on a consensus region of the aefA gene, which in turn was designed on the basis of that of E. aerogenes and the recently released genome of Enterobacter spp. (accession no. CP000653). Amplification experiments with the aefA-F and acrA2-R primers (Table 2) yielded an amplicon of ca. 1,600 bp containing the entire acrR gene from E. cloacae and the partial coding region of aefA. The acrR gene of E. cloacae showed 73.9% nucleotide identity with that of E. aerogenes (21), notably lower than that observed for the acrA and acrB genes, which might account for the negative results obtained with the initial approach.
Assembling the sequence of the entire locus revealed an organization similar to that described for E. aerogenes (21), with the 22-bp acrA-acrB intergenic sequence (amplified with primers acrA3 and acrB2 [Table 2]) identical to that of E. aerogenes. The acrR and acrA genes are also transcribed divergently, and in the upstream acrA region, a 141-bp acrR-acrA intergenic sequence showed the same acrA and acrR promoter boxes previously found in E. aerogenes (GenBank accession no. AJ306389). Indeed, by RT-PCR, high levels of acrR and acrA gene expression were detected for EcDC64 compared to what was found for E. cloacae JC 194 (data not shown).
Construction of the EcΔacrA strain.
To investigate the role of the AcrAB-TolC efflux pump in drug resistance, an acrA knockout of EcDC64 was constructed (EcΔacrA) by replacing part of the acrA gene with a kanamycin resistance cassette. The knockout of acrA was confirmed by PCR mapping as described in Materials and Methods (data not shown). RT-PCR results confirmed that no acrA expression was detectable in EcΔacrA (Table 3). When the EcΔacrA strain was transformed with pAP-2, RT-PCR analysis showed that the acrA expression was restored by complementation (Table 3).
TABLE 3.
RT-PCR analysis of ompC, ompF, and acrA gene expression
| Gene | Strain | Relative expressiona |
|---|---|---|
| ompF | E. cloacae JC 194 | 1 |
| EcDC64 | 0.2032 | |
| EcΔacrA | 0.1931 | |
| ompC | E. cloacae JC 194 | 1 |
| EcDC64 | 0.00235 | |
| EcΔacrA | 0.00252 | |
| acrA | E. cloacae JC 194 | 1 |
| EcDC64 | 490 | |
| EcΔacrA | 0.002 | |
| EcΔacrA(pAP-2) | >1,000 | |
| EcDC64(pAP-3) | 300 |
Relative expression is calculated as 2−ΔCT, where −ΔCT is the ratio of the crossing point target value to the crossing point reference value. The target is the indicated bacterial isolate, whereas the reference is in all cases E. cloacae JC 194.
Involvement of the AcrAB-TolC efflux pump in MDR.
Susceptibility testing was carried out with EcDC64 (with and without PAβN), EcΔacrA (with and without PAβN), EcΔacrA(pAP-2), EcΔacrA(pACYC184), EcDC64(pAP-3), and EcDC64(pBGS18) (Tables 4, 5, and 6).
TABLE 6.
MICs of detergents and dyes for bacterial isolates
| Compound | MIC (μg/ml) for:
|
|||||
|---|---|---|---|---|---|---|
| EcDC64 | EcΔacrA | EcΔacrA(pAP-2) | EcΔacrA(pACYC184) | EcDC64(pAP-3) | EcDC64(pBGS18) | |
| Sodium dodecyl sulfate | 8,192 | 256 | 4,096 | 128 | 1,024 | 8,192 |
| Sodium deoxycholate | 8,192 | 256 | 4,096 | 256 | 512 | 8,192 |
| Sodium cholate | >16,384 | 2,048 | >16,384 | 2,048 | 4,096 | >16,384 |
| Triton X-100 | >16,384 | >16,384 | >16,384 | >16,384 | >16,384 | >16,384 |
| Acriflavine | 128 | 16 | 64 | 16 | 32 | 128 |
| Crystal violet | 4,096 | 512 | 1,024 | 256 | 1,024 | 4,096 |
| Ethidium bromide | 2,048 | 128 | 1,024 | 64 | 256 | 2,048 |
The efflux pump inhibitor PAβN affected the MICs of and susceptibilities to several antibiotics tested, revealing the presence of active drug efflux in EcDC64.
Analysis of the EcΔacrA mutant revealed an antibiotic susceptibility profile similar to that of EcDC64 in the presence of PAβN, with some exceptions (Tables 4 and 5). The data suggest that other efflux systems in addition to AcrAB-TolC operate in E. cloacae EcDC64. In this regard, the clearest result was that obtained with fusidic acid (Table 5). It appears that the AcrAB-TolC efflux system in E. cloacae does not pump out fusidic acid, unlike what is seen for other species of Enterobacteriaceae (19, 27).
Concerning the various antibiotics, β-lactam MICs were almost unaffected in EcΔacrA, with some exceptions (Table 4). The MICs of erythromycin and clindamycin were dramatically reduced in the knockout acrA mutant, as were those of tetracycline, chloramphenicol, and linezolid, while there were modest decreases in the MICs of aminoglycosides, ciprofloxacin, tigecycline, and trimethoprim-sulfamethoxazole. Susceptibility to telithromycin, novobiocin, nalidixic acid, norfloxacin, and rifampin was also increased in EcΔacrA. Antibiotic resistance was almost fully restored when the AcrA polypeptide was overexpressed in EcΔacrA (Tables 4 and 5).
On the other hand, the antimicrobial susceptibility of EcΔacrA further increased (in some cases dramatically) in the presence of PAβN, which points to the role of additional efflux systems.
Analysis of the antibiotic susceptibility pattern and MICs of EcDC64(pAP-3) revealed low MICs and large inhibition zones with most antimicrobial agents and other compounds studied compared to those for EcDC64 (Tables 4,5, and 6). However, the effect was lower than that obtained with EcΔacrA, a fact which may be associated with the higher levels of expression of the acrA gene in EcDC64(pAP-3) than in EcΔacrA (Table 3). These results could be explained regarding the role of AcrR as a specific secondary modulator to fine-tune the level of acrAB transcription (13).
Analysis of detergents and dyes revealed lower MICs of most of them for the acrA knockout mutant than for its isogenic parental strain. The MICs of detergents and dyes indicated that the AcrAB-TolC efflux system is efficient at removing these products, with the exception of Triton X-100 (Table 6).
acrA detection in several E. cloacae isolates.
The acrA gene was detected by PCR in six genetically unrelated E. cloacae isolates used in the study (data not shown). This strongly suggests that the AcrAB-TolC efflux pump is resident in the species.
Other antibiotic resistance mechanisms in E. cloacae EcDC64.
To analyze the involvement of efflux pumps in MDR in EcDC64, the intrinsic background of antibiotic resistance mechanisms that may act synergistically with efflux pumps must also be taken into account. EcDC64 showed a broad spectrum of antibiotic resistance, with high-level resistance to β-lactams (including imipenem and meropenem). It has previously been reported that the interplay between AmpC expression and the reduction of porin expression may have an important role in β-lactam (including carbapenem) resistance in E. cloacae (10). We therefore aimed to determine if this was also true for the EcDC64 clinical isolate.
MICs for EcDC64 and for EcDC64 transformed with the ampD gene from E. coli were determined as well as for EcDC64 in the presence of cloxacillin. In both cases, there was a dramatic reduction in some β-lactam MICs (amoxicillin-clavulanic acid, most of the cephalosporins, and carbapenems), and indeed the MICs of imipenem and meropenem decreased from >32 to 2 and from >32 to 0.75 μg/ml, respectively. We also aimed to determine whether or not a reduction of the expression of ompC and ompF genes occurred in EcDC64. Real-time RT-PCR enabled comparison of the levels of expression of ompC and ompF genes in the EcDC64 strain and in the carbapenem-susceptible E. cloacae JC 194. Overall, the results showed that the level of expression of ompC was extremely low and that the level of expression of ompF was also lower than that seen for strain JC 194 (Table 3). Altogether, the above results confirmed that AmpC overexpression and decreased porin expression were also present as resistance mechanisms in EcDC64.
Concluding remarks.
The involvement of efflux mediated by the AcrAB-TolC system in the decreased susceptibility to several antibiotics of EcDC64 was demonstrated by different approaches. First, the MICs in the presence of the efflux pump inhibitor PAβN (20 μg/ml) significantly increased the susceptibility with respect to that of the wild-type strain. Second, knockout of the acrA gene increased susceptibility to many of the same compounds, although there were some differences which suggested the role of additional efflux systems. Third, transformation of EcDC64 with the acrR gene from E. aerogenes also reduced the MICs of most of the same antibiotics.
The role of the efflux pump in β-lactam resistance has not been clearly elucidated because the host strain used in the present study bears a class C β-lactamase in its chromosome, overexpression of which affects most β-lactams. However, there was a decrease in piperacillin, aztreonam, oxacillin, and carbapenem MICs when either the EcDC64 strain with PAβN or MICs in the EcΔacrA strain were analyzed.
The role of AcrAB-TolC-type efflux pumps in macrolide and quinolone resistance has previously been described for some species of Enterobacteriaceae as a major mechanism of resistance (1, 9, 11, 15, 16, 19, 21). A macrolide-specific ABC-type transporter was recently reported for E. coli (8). This efflux system may also operate in the clinical isolate under study, which would explain the difference between the MIC of erythromycin for EcDC64 with PAβN and that for EcΔacrA (from >256 to 1 and 12 μg/ml, respectively).
It is noteworthy that this mechanism may at least partly explain the “intrinsic” resistance of Enterobacter to some antibiotics used to treat gram-positive infections, such as oxacillin, linezolid, clindamycin, fusidic acid, novobiocin, and rifampin, although another efflux pump is probably involved in resistance to fusidic acid. In this regard, it has been demonstrated that the intracellular concentration of linezolid in strains of E. coli, E. aerogenes, and Citrobacter freundii is comparatively low due to the efficient efflux of the drug by the resistance-nodulation-division-type efflux pump (25).
Unlike the AcrAB-TolC efflux pump from E. aerogenes (5), which does not appear to pump out telithromycin, the clinical isolate EcDC64 increased the inhibition zone for this antibiotic (from 9 to 19 mm) when the acrA gene was deleted. As with E. aerogenes, a more dramatic effect was observed when MICs of EcDC64 were determined in the presence of an efflux pump inhibitor (PAβN) (Table 5).
As for the clinical isolate under study, the AcrAB efflux pumps in Proteus mirabilis and Klebsiella pneumoniae have been associated with decreased susceptibility to tigecycline (23, 28), although in the present case the increase in susceptibility in the acrA knockout isolate was lower (the knockout strain MIC was sixfold lower than that for the parental strain). It is interesting that Keeney et al. (7) have recently reported the involvement of AcrAB of E. cloacae in decreased susceptibility to tigecycline, although the values reported (16- to 32-fold reductions) are higher than those we have described here. These differences may be related to the level of AcrAB-TolC gene expression in the strains under study.
Acknowledgments
Margarita Poza is a receipt of an Isidro Parga Pondal research contract, Alejandro Beceiro of a scholarship from SEIMC, and María del Mar Tomás of a postMIR research contract from the Instituto de Salud Carlos III. The study was partly financed by the Consellería de Innovación, Industria y Comercio, Xunta de Galicia (PGIDIT04BTF916028PR), Fondo de Investigaciones Sanitarias (PI040514 and PI061368), and also supported by Ministerio de Sanidad y Consumo, ISCIII, Spanish Network for the Research in Infectious Diseases (REIPI RD06/0008).
We thank I. Rego for technical assistance in RT-PCR experiments.
Footnotes
Published ahead of print on 16 July 2007.
REFERENCES
- 1.Baucheron, S., S. Tyler, D. Boyd, M. R. Mulvey, E. Chaslus-Dancla, and A. Cloeckaert. 2004. AcrAB-TolC directs efflux-mediated multidrug resistance in Salmonella enterica serovar Typhimurium DT104. Antimicrob. Agents Chemother. 48:3729-3735. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Berlanga, M., J. L. Vazquez, J. Hernandez-Borrell, M. T. Montero, and M. Vinas. 2000. Evidence of an efflux pump in Serratia marcescens. Microb. Drug Resist. 6:111-117. [DOI] [PubMed] [Google Scholar]
- 2a.Canle, D., M. Cartelle, C. Latasa, I. Lasa, R. Villanueva, and G. Bou. 2005. Abstr. 45th Intersci. Conf. Antimicrob. Agents Chemother., abstr. C1-1035.
- 3.Chang, A. C. Y., and S. N. Cohen. 1978. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacteriol. 134:1141-1156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Chaveroche, M. K., J. M. Ghigo, and C. d'Enfert. 2000. A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans. Nucleic Acids Res. 28:e97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Chollet, R., J. Chevalier, A. Bryskier, and J. M. Pages. 2004. The AcrAB-TolC is involved in macrolide resistance but not in telithromycin efflux in Enterobacter aerogenes and Escherichia coli. Antimicrob. Agents Chemother. 48:3621-3624. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Keeney, D., A. Ruzin, and P. A. Bradford. 2007. RamA, a transcriptional regulator, and AcrAB, an RND-type efflux pump, are associated with decreased susceptibility to tigecycline in Enterobacter cloacae. Microb. Drug Resist. 13:1-6. [DOI] [PubMed] [Google Scholar]
- 8.Kobayashi, N., K. Nishino, and A. Yamaguchi. 2001. Novel macrolide-specific ABC-type efflux transporter in Escherichia coli. J. Bacteriol. 183:5639-5644. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kumar, A., and E. A. Worobec. 2002. Fluoroquinolone resistance of Serratia marcescens: involvement of a proton gradient-dependent efflux pump. J. Antimicrob. Chemother. 50:593-596. [DOI] [PubMed] [Google Scholar]
- 10.Lee, E. H., E. Collatz, J. Trias, and L. Gutmann. 1992. Diffusion of beta-lactam antibiotics into proteoliposomes reconstituted with outer membranes of isogenic imipenem-susceptible and -resistant strains of Enterobacter cloacae. J. Gen. Microbiol. 138:2347-2351. [DOI] [PubMed] [Google Scholar]
- 11.Linde, H. J., F. Notka, C. Irtenkauf, J. Decker, J. Wild, H. H. Niller, P. Heisig, and N. Lehn. 2002. Increase in MICs of ciprofloxacin in vivo in two closely related clinical isolates of Enterobacter cloacae. J. Antimicrob. Chemother. 49:625-630. [DOI] [PubMed] [Google Scholar]
- 12.Linde, H. J., F. Notka, M. Metz, B. Kochanowski, P. Heisig, and N. Lehn. 2000. In vivo increase in resistance to ciprofloxacin in Escherichia coli associated with deletion of the C-terminal part of MarR. Antimicrob. Agents Chemother. 44:1865-1868. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Ma, D., M. Alberti, C. Lynch, H. Nikaido, and J. E. Hearst. 1996. The local repressor AcrR plays a modulating role in the regulation of acrAB genes of Escherichia coli by global stress signals. Mol. Microbiol. 19:101-112. [DOI] [PubMed] [Google Scholar]
- 14.Mallea, M., J. Chevalier, C. Bornet, A. Eyraud, A. Davin-Regli, C. Bollet, and J. M. Pages. 1998. Porin alteration and active efflux: two in vivo drug resistance strategies used by Enterobacter aerogenes. Microbiology 144:3003-3009. [DOI] [PubMed] [Google Scholar]
- 15.Mazzariol, A., J. Zuliani, G. Cornaglia, G. M. Rossolini, and R. Fontana. 2002. AcrAB efflux system: expression and contribution to fluoroquinolone resistance in Klebsiella spp. Antimicrob. Agents Chemother. 46:3984-3986. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Mazzariol, A., Y. Tokue, T. M. Kanegawa, G. Cornaglia, and H. Nikaido. 2000. High-level fluoroquinolone-resistant clinical isolates of Escherichia coli overproduce multidrug efflux protein AcrA. Antimicrob. Agents Chemother. 44:3441-3443. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Nikaido, H. 1998. Antibiotic resistance caused by gram-negative multidrug efflux pumps. Clin. Infect. Dis. 27:32-41. [DOI] [PubMed] [Google Scholar]
- 18.Nikaido, H., and H. I. Zgurskaya. 1999. Antibiotic efflux mechanisms. Curr. Opin. Infect. Dis. 12:529-536. [DOI] [PubMed] [Google Scholar]
- 19.Nikaido, H., M. Basina, V. Nguyen, and E. Y. Rosenberg. 1998. Multidrug efflux pump AcrAB of Salmonella typhimurium excretes only those β-lactam antibiotics containing lipophilic side chains. J. Bacteriol. 180:4686-4692. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Poole, K. 2004. Efflux-mediated multiresistance in Gram-negative bacteria. Clin. Microbiol. Infect. 10:12-26. [DOI] [PubMed] [Google Scholar]
- 21.Pradel, E., and J. M. Pages. 2002. The AcrAB-TolC efflux pump contributes to multidrug resistance in the nosocomial pathogen Enterobacter aerogenes. Antimicrob. Agents Chemother. 46:2640-2643. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Rose, R. E. 1988. The nucleotide sequence of pACYC184. Nucleic Acids Res. 16:355. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Ruzin, A., M. A. Visalli, D. Keeney, and P. A. Bradford. 2005. Influence of transcriptional activator RamA on expression of multidrug efflux pump AcrAB and tigecycline susceptibility in Klebsiella pneumoniae. Antimicrob. Agents Chemother. 49:1017-1022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Sanders, W. E., and C. C. Sanders. 1997. Enterobacter spp.: pathogens poised to flourish at the turn of the century. Clin. Microbiol. Rev. 10:220-241. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Schumacher, A., R. Trittler, J. A. Bohnert, K. Kummerer, J. M. Pages, and W. V. Kern. 2007. Intracellular accumulation of linezolid in Escherichia coli, Citrobacter freundii and Enterobacter aerogenes: role of enhanced efflux pump activity and inactivation. J. Antimicrob. Chemother. 59:1261-1264. [DOI] [PubMed] [Google Scholar]
- 26.Spratt, B., P. J. Hedge, T. S. Heesen, A. Edelman, and J. K. Broome-Smith. 1986. Kanamycin-resistant vectors that are analogues of plasmids pUC8, pUC9, pEMBL8, and pEMBL9. Gene 41:337-342. [DOI] [PubMed] [Google Scholar]
- 27.Sulavik, M. C., C. Houseweart, C. Cramer, N. Jiwani, N. Murgolo, J. Greene, B. DiDomenico, K. J. Shaw, G. H. Miller, R. Hare, and G. Shimer. 2001. Antibiotic susceptibility profiles of Escherichia coli strains lacking multidrug efflux pump genes. Antimicrob. Agents Chemother. 45:1126-1136. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Visalli, M. A., E. Murphy, S. J. Projan, and P. A. Bradford. 2003. AcrAB multidrug efflux pump is associated with reduced levels of susceptibility to tigecycline (GAR-936) in Proteus mirabilis. Antimicrob. Agents Chemother. 47:665-669. [DOI] [PMC free article] [PubMed] [Google Scholar]