Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2007 Oct 29.
Published in final edited form as: Gene Expr Patterns. 2007 Jan 13;7(5):596–605. doi: 10.1016/j.modgep.2007.01.002

Cloning of zebrafish nkx6.2 and a comprehensive analysis of the conserved transcriptional response to Hedgehog/Gli signaling in the zebrafish neural tube

Burcu Guner 1, Rolf O Karlstrom 1
PMCID: PMC2043473  NIHMSID: NIHMS28863  PMID: 17307034

Abstract

Sonic Hedgehog (Shh) signaling helps pattern the vertebrate neural tube, in part by regulating the dorsal/ventral expression of a number of homeodomain containing transcription factors. These Hh responsive genes have been divided into two classes, with Class II genes being activated by Hh signaling and Class I genes being repressed by Hh signaling. While the transcriptional response to varying Hh levels is well defined in chick and mouse, it is only partially described in zebrafish, despite the fact that zebrafish has emerged as a powerful genetic system for the study of neural patterning. To better characterize the Hh response in the zebrafish neural tube, we cloned the zebrafish Class II Hh target genes nkx2.9 and nkx6.2. We then analyzed the expression of a number of Class I and Class II Hh responsive genes in wild type, Hh mutant, and Hh over-expressing zebrafish embryos. We show that expression of Class I and Class II genes is highly conserved in the vertebrate neural tube. Further, ventral-most Class II gene expression was completely lost in all Hh pathway mutants analyzed, indicating high levels of Hh signaling are blocked in all of these mutants. In contrast, more dorsally expressed genes were variably affected in different Hh pathway mutants, indicating mid-levels of Hh signaling are differentially affected. This comprehensive expression study provides an important tool for the characterization of Hh signaling in zebrafish and provides a sensitive assay for determining the degree to which newly identified zebrafish mutants affect Hh signaling.

Keywords: dbx1a, dbx2, hlx1, hlxb9, irx1a, irx3a, irx5, nkx2.2a, nkx2.9, nkx6.1, nkx6.2, pax3, pax6a, pax7, chameleon, detour, slow muscle omitted, you-too, cyclopamine, floorplate, motor neurons

1. Results and Discussion

Secreted proteins of the Hedgehog (Hh) family are well known for their role in patterning the vertebrate and invertebrate embryo (Ingham and McMahon, 2001). During development, Hh functions in a concentration dependent manner to influence cell differentiation (Ericson et al., 1997a). Hh can also act as a survival factor (Miao et al., 1997) or a mitogen (Dahmane et al., 2001) to help shape the embryo. The morphogen activity of Hh has been well studied in the neural tube of chick and mouse (Ericson et al., 1995; Wijgerde et al., 2002), where Hh secreted from the notochord induces floorplate and ventral neural fates based on the concentration of Hh seen by a neural progenitor cell (Echelard et al., 1993). Cells respond to Hh through a complicated signaling system that includes the membrane proteins Patched and Smoothened. Signaling is relayed to the nucleus via zinc-finger containing transcription factors of the Gli family that either activate or repress the transcription of Hh-responsive genes. These Gli transcription factors form a gradient of Gli activator function in the neural tube that reflects the Hh concentration gradient (Lei et al., 2004; Stamataki et al., 2005).

Neural progenitor cells within the spinal cord respond to the concentration of Hh/Gli activity by expressing different combinations of homeodomain containing transcription factors (Ericson et al., 1997). A majority of these Hh responsive transcription factors belong to the nkx and pax families, which guide cell differentiation and patterning in a number of embryonic tissues (reviewed in Lang et al., 2006; Stanfel et al., 2005). Within the neural tube, these Hh-regulated transcription factors have been divided into two classes based on the transcriptional response elicited by Hh (Briscoe et al., 2000). Class II genes (including nkx2.2, nkx2.9, nkx6.1, and nkx6.2) are transcriptionally activated by Hh while Class I genes (including pax6, pax7, irx3, dbx1, and dbx2) are transcriptionally repressed by Hh. The combinatorial expression of Class I and II genes defines five domains of neural differentiation in the ventral half of the spinal cord, with the ventral-most domain producing V3 interneurons and motor neurons (MN), and more dorsal domains producing V0-V2 interneurons (Briscoe et al., 2000; Ericson et al., 1997a; Pierani et al., 1999).

In the mid 1990s, large-scale genetic screens identified a number of zebrafish mutations that subsequently have been shown to affect different components of the Hh signaling cascade (Brand et al, 1996, Karlstrom et al, 1996). The first of these mutants to be cloned was clairvoyantly named sonic-you (syu) and encodes Sonic Hedgehog (Shh) itself (Schauerte et al., 1998). Zebrafish detour(dtr) encodes Gli1, with dtr alleles blocking Gli1 mediated Hh signaling (Karlstrom et al., 2003). Zebrafish youtoo(yot) encodes dominant repressor forms of Gli2 (Gli2DR) that block both Gli1 and Gli2 mediated Hh signaling (Karlstrom et al., 2003). Slow-muscle omitted (smu) encodes Smoothened, and smu(smo) mutants appear to completely lack Hh activity (Chen et al., 2001; Varga et al., 2001). The zebrafish mutant chameleon (con) encodes Dispatched 1 (disp1), a membrane protein that is needed for Hh secretion and processing (Nakano et al., 2004). More recently identified mutants include iguana (igu), which encodes a novel protein in the Hh pathway called dZip (Sekimizu et al., 2004; Wolff et al., 2004), and you(you), which encodes the secreted EGF repeat containing protein Scube2 that regulates long range Hh signaling (Kawakami et al., 2005; Woods and Talbot, 2005).

While a number of Hh responsive genes have been characterized in zebrafish, there has been no systematic analysis of Class I and Class II gene expression in the zebrafish spinal cord. We therefore cloned zebrafish homologs of the Class II genes nkx2.9 and nkx6.2 and analyzed the expression pattern of a large number of Class I and II genes in wild type embryos. We found that the transcriptional response to Hh signals in the CNS is largely conserved between mammals and teleosts. We then examined expression in the Hh pathway mutants smu(smo), con(disp1), yot(gli2DR), and dtr(gli1). The expression of ventrally expressed Class II genes was uniformly absent from these mutants, indicating that all of these mutations eliminate the highest levels of Hh activator function. In contrast, the expression of Class II genes nkx6.1, nkx6.2, olig2 and the Class I genes dbx1a(hlx1), dbx2, irx3a, pax7, pax3, and pax6a were differentially affected, indicating that mid- and low-level Hh responses are disrupted to varying degrees in these Hh/Gli signaling mutants. Together, this collection of markers provides a means to thoroughly analyze the Hh response at all levels in the zebrafish spinal cord and allows for a more sensitive comparison of Hh signaling across vertebrate species.

1.1. Cloning of zebrafish nkx2.9 and nkx6.2

Several Hh responsive transcription factors identified in other species have also been identified in zebrafish. These include homeobox containing Class I genes of the dbx (called hlx1 in zebrafish) (Seo et al., 1999), iroquois ( irx genes) (Tan et al., 1999; Wang et al., 2001), and pax families (Krauss et al., 1991; Seo et al., 1998). Class II genes include homeobox containing nkx family members (Barth and Wilson, 1995; Cheesman et al., 2004) and olig2 which encodes a bHLH transcription factor (Park et al., 2002). To allow for a more detailed analysis of the Hh transcriptional response in zebrafish, we cloned zebrafish homologues of two additional Class II genes of the nkx homeodomain transcription factor family. We designed PCR primers using zebrafish genomic sequences (www.sanger.ac.uk) similar to puffer fish (Fugu rubripes) nkx2.9 (Santagati et al., 2001) and mouse nkx6.2 (Komuro et al., 1993) and amplified these two nkx genes from zebrafish first strand cDNA. Sequence comparisons indicate that zebrafish nkx2.9 (Accession # DQ924560) and nkx6.2 (Accession # DQ924561) are most closely related to Fugu nkx2.9 and mouse nkx6.2, respectively (Fig. 1). nkx2.9 was subsequently identified in a microarray screen as a Hh responsive gene (Xu et al., 2006), but its expression during zebrafish embryogenesis was not documented. Assignment of homology was further verified by analysis of gene expression (see Fig. 2).

Figure 1. Phylogenetic analysis of zebrafish Nkx2.9 and Nkx6.2.

Figure 1

Open in a new tab

Un-rooted cladogram showing the relatedness of the protein sequences encoded by the newly cloned zebrafish nkx genes. Zebrafish Nkx2.9 is most closely related to Fugu and mouse Nkx2.9, while Nkx6.2 is most closely related to mouse Nkx6.2. Sequences for zebrafish nkx2.9 and nkx6.2 can be found in Genbank (accession numbers DQ924560 and DQ924561, respectively). Da; Danio rerio, Fu; Fugu rubripes, Mu; Mus musculus.

Figure 2. Class II Hh regulated genes in zebrafish: nkx2.9 and nkx6.2 expression and regulation by Hh.

Figure 2

Open in a new tab

(A, B) Lateral views of 36 hpf embryos, eyes removed, dot marks optic recess. (A) nkx2.9 is expressed in the ventral hindbrain, ventral midbrain and diencephalon in a pattern nearly identical to that of nkx2.2a (see Karlstrom et al., 2003). No nkx2.9 expression was seen outside the nervous system up to 36 hpf. Inset shows expression of nkx2.9 in the CNS at the tailbud stage (10 hpf). (B) nkx6.2 is expressed in the ventral hindbrain and ventral midbrain, but is not expressed in the forebrain. In the hindbrain, nkx6.2 is expressed dorsally, presumably in cranial motor neurons (arrows). Upper inset shows nkx6.2 expression in the ventral CNS at tailbud stage (10 hpf). (B') Side view of somites 4−7 in the trunk showing nkx6.2 expression in the developing pancreas at 36 hpf. (C-H) Spinal cord cross-sections of 24 hpf embryos. (C) nkx2.9 is expressed in lateral floor plate cells, but not in the medial floor plate (*), similar to nkx2.2a (F). nkx2.9 expression is dorsally expanded in shh mRNA-injected embryos. The expression of nkx2.9 is lost in smu(smo), con(disp1), yot(gli2DR), and dtr(gli1) mutants. (D) nkx6.2 is expressed in the ventral half of the CNS. In shh mRNA-injected embryos nkx6.2 expression is expanded dorsally. nkx6.2 expression is completely absent in smu(smo) mutants. In con(disp1) mutants, nkx6.2 expression is absent dorsally but remains in the medial and lateral floor plate (arrowhead). In yot(gli2DR) and dtr(gli1) mutants, nkx6.2 expression is absent from the floor plate (arrowheads), but expression remains more dorsally. (E) nkx6.1 is expressed in lateral floor plate cells, in motor neuron precursors and in most ventral interneuron progenitors. nkx6.1 expression is dorsally expanded in shh mRNA-injected embryos and is absent in cyclopamine treated embryos. The expression of nkx6.1 is not affected in yot(gli2DR), and dtr(gli1) mutant embryos. (F) nkx2.2a is expressed in the ventral-most cells of the CNS, including the lateral floor plate but not the medial floor plate (*). (G)hlxb9 is expressed in developing motor neurons just dorsal to the floor plate. hlxb9 expression is undetectable in con(disp1) (inset) and smu(smo) mutants and highly reduced in yot(gli2DR), anddtr(gli1) mutants (data not shown). (H) olig2 is expressed in both motor neuron and interneuron precursor cells. The expression of olig2 is dorsally expanded in shh mRNA-injected embryos and absent in cyclopamine treated embryos. olig2 expression appears unaffected in yot(gli2DR), and dtr(gli1) mutants. di; diencephalon, fb; forebrain, hb; hindbrain, mb; midbrain, nc; notochord, s; somite, t; telencephalon. * marks the medial floor plate cells. Double ended arrows in each panel show dorsal and ventral extent of gene expression. Scale bars: (A,B), 50 μm, (C-H)15 μm in large panels, 24 μm in smaller panels.

1.2. The expression of Hh responsive Class II genes is highly conserved across vertebrates

The newly cloned zebrafish nkx2.9 gene is expressed in the shh-expressing domain of the ventral CNS (Fig. 2) in a pattern similar to chick and mouse nkx2.9 (Briscoe et al., 2000; Pabst et al., 2003). In the brain, nkx2.9 is expressed in the dorsal/anterior diencephalon, mid-diencephalon border, tegmentum, and ventral hindbrain (Fig. 2A). This expression is nearly identical to that of the well characterized class II gene nkx2.2a (Barth and Wilson, 1995), except that nxk2.9 is not expressed in the adenohypophysis (Fig. 2A, see Karlstrom et al., 2003). nkx2.9 is expressed in the ventral CNS as early as the tailbud stage (10 hpf) (Fig. 2A inset). Similar to nkx2.9, nkx6.2 expression begins in the ventral CNS at the tailbud stage (10 hpf), but expression does not extend into the developing forebrain (Fig. 2B). nkx6.2 expression terminates at the forebrain/midbrain border, clearly seen at 36hpf (Fig. 2B). The expression of zebrafish nkx6.2 is most similar to the expression of nkx6.2 in amniotes, including expression in the pancreas (Fig. 3B', Henseleit et al., 2005; Vallstedt et al., 2001).

Figure 3. Class I gene expression in zebrafish and regulation by Hh.

Figure 3

Open in a new tab

(A) pax3 is expressed in the dorsal-most cells of the spinal cord, including the roof plate. (B) pax3 expression is absent or restricted dorsally in shh mRNA injected embryos. (C) In smu(smo) mutants, spinal cord pax3 expression appears normal. (D-F) The expression of pax3 is unaffected in the neural tubes of con(disp1) (D), yot(gli2DR) (E), and dtr(gli1) (F) mutants. (G) pax7 is expressed in the dorsal spinal cord, but not in the roof plate. (H) pax7 expression is reduced or absent in shh mRNA-injected embryos. (I-L) The expression of pax7 is unaltered in smu(smo) (I), con(disp1) (J), yot(gli2DR) (K), and dtr(gli1) (L) mutant embryos. (M) pax6a is expressed throughout the spinal cord with the exception of the most ventral (arrow) and most dorsal cells. (N) pax6a is reduced in shh mRNA-injected embryos. (O-R) pax6a expression is ventrally expanded in smu(smo) (O), con(disp1) (P), yot(gli2DR) (Q), and dtr(gli1) (R) mutants (arrows). (S) dbx1a(hlx1) is expressed in a band of cells in the middle of the D/V axis of the spinal cord. (T) dbx1a(hlx1) expression is reduced or absent after shh mRNA injection (arrow). (U-X) dbx1a(hlx1) expression is ventrally expanded in smu(smo) (U), and con(disp1) (V) mutants but is not altered in yot(gli2DR) (W), and dtr(gli1) (X) mutants. (Y) dbx2 is expressed in the mid-dorsal cells of the spinal cord. (Y) The expression of dbx2 is reduced an restricted to the dorsal most cells of the spinal cord in shh mRNA-injected embryos and dbx2 expression is expanded ventrally in cyclopamine treated embryos. dbx2 expression appears unaffected in yot(gli2DR) and dtr(gli1) mutants. (Z) irx3a is expressed in lateral and mid-dorsal cells. In shh mRNA-injected embryos, medial expression of irx3a is repressed while lateral irx3a expression remains unaffected. In cyclopamine treated embryos irx3a is expressed throughout the neural tube with the exception of the medial floor plate. The expression of irx3a appears unaffected in yot(gli2DR) and dtr(gli1) mutant embryos. All panels show spinal cord cross sections of 24 hpf embryos. Double-ended arrows show dorsal and ventral extent of gene expression. In general, labeling intensity appeared similar in wild type and mutant embryos. Scale bar: 15μm (33μm in Y, Z mutant panels).

Within the spinal cord, zebrafish nkx2.9 is expressed in a single row of cells corresponding to the Hh dependent lateral floor plate cells (Schauerte et al., 1998) on either side of the midline (Fig. 2C). In mouse, nkx2.9 is initially expressed in the floorplate and later is expressed in the ventral-most interneuron progenitors (p3) (Pabst et al., 1998), while in zebrafish nkx2.9 expression seems to be restricted to lateral floor plate cells, at least up to 24 hpf (Fig. 2C, compare to nkx2.2a expression in Fig. 2F). In contrast, zebrafish nkx6.2 expression encompasses the ventral half of the spinal cord, including the floor plate (Fig. 2D, Fig. 4A). This expression is similar to that in amniotes, where the nkx6.2 expression domain includes p1-p3 progenitor cells, but does not include the floor plate (Vallstedt et al., 2001). In amniotes, the closely related gene nkx6.1 is expressed in a slightly smaller ventral domain that does not include p1 progenitors (Briscoe et al., 1999). Zebrafish nkx6.1 (Cheesman et al., 2004) is similarly expressed in all but the dorsal-most row of the nkx6.2 expressing cells (Fig. 2E, see schematic in Fig. 4). Zebrafish nkx2.2a is expressed in lateral floor plate cells, and in the next cells dorsally, the V3 interneuron progenitors (p3) that arise ventral to motor neuron progenitors (pMN) (Barth and Wilson, 1995; Placzek and Briscoe, 2005).In amniotes, olig2 is expressed in pMNs, oligodendrocyte precursors, as well as in motor neurons (Fu et al., 2002; Novitch et al., 2001). Zebrafish olig2 is similarly expressed in MN and V3 progenitors (pMN, p3) (Fig. 2H, Park et al, 2002). Finally, motor neurons themselves express a number of genes including hlxb9 (Arber et al., 1999; Flanagan-Steet et al., 2005; Tanabe et al., 1998; Wendik et al., 2004), and islet genes (e.g. Hutchinson and Eisen, 2006). Zebrafish hlxb9, and islet1/2 are expressed within the nkx6.1 and nkx6.2 expression domains, consistent with the differentiation of motor neurons in this region (Cheesman et al., 2004)(Fig. 2D,E, and G).

Figure 4. Schematic of Class I, and Class II gene expression in the zebrafish spinal cord.

Figure 4

Open in a new tab

(A) Schematic spinal cord cross section showing the overlapping expression domains of Hh responsive Class I (green bars) and Class II (red bars) genes. Progenitor cell positions are based on published data from mouse and chick, in which the expression domains of olig2, nkx6.1, nkx6.2, and pax6a overlap in p3 progenitor cells, and the expression domains of nkx6.1, nkx6.2, hlxb9, olig2, irx3a, and pax6a overlap in motor neuron (MN) precursors. The expression domains of irx3a, pax6a, nkx6.1, nkx6.2, and alx(Chx10) overlap in a few of the p2 progenitor cells (Kimura et al., 2006). The green triangle represents the level of Hh signaling, from high ventrally to low dorsally. (B) In smu(smo) mutant and cyclopamine treated embryos, most ventral Class II gene expression is lost and the expression of Class I genes expands ventrally (arrow extensions on red bars). The loss of Hh signaling is indicated by the absence of the green triangle. (C) In con(disp1) mutant embryos, Class II gene expression is lost with the exception of nkx6.2, which remains only in the most ventral cells. The expression domains of the Class I genes dbx1a(hlx1) and pax6a expand ventrally, similar to the situation in smu(smo) mutants. The smaller triangle indicates reduced Hh signaling activity that extends only to cells adjacent to the Shh expressing floorplate. (D) In yot(gli2DR) and dtr(gli1) mutant embryos, expression of ventral-most Class II genes (nkx2.2a, nkx2.9) is absent, while the expression of nkx6.2 is only absent ventrally. Expression of olig2 and nkx6.1 remains unaffected, while the expression of hlxb9 is highly reduced. The expression of dorsally expressed Class I genes appears unchanged, while ventral pax6a expression expands into the ventral-most cells of the spinal cord. The thinner triangle indicates a general reduction in Hh signaling levels throughout the ventral neural tube. Expression patterns shown are based on data in this paper, references mentioned above, as well as data contained in (Ekker et al., 1995) for shh, (Odenthal and Nusslein-Volhard, 1998) for axial(fkd1)/hnf3((foxa2) and fkd4, and (Talbot et al., 1995) for floating head (flh). ** nkx6.1 expression is reduced in the ventral-most cells in smu(smo) mutants, but completely absent in cyclopamine treated embryos.

To characterize zebrafish Class II gene regulation by Hh signaling, the expression patterns of these genes were analyzed in embryos with elevated Shh levels, as well as in smu(smo), con(disp1), yot(gli2DR), and dtr(gli1) mutants. Expression of nkx2.9 was dramatically expanded in embryos with ectopic Hh signaling, consistent with its classification as Hh induced Class II gene (Fig. 2C, Xu et al., 2006). The expression of the nkx2.9 was absent in all of the Hh pathway mutants examined (Fig. 2C) suggesting high levels of Hh signaling are required for transcriptional activation of this gene.

Expression of the newly cloned zebrafish nkx6.2 gene was expanded in shh mRNA injected embryos and reduced in Hh pathway mutants (Fig. 2D), consistent with it being a Class II Hh regulated gene. In contrast to the ventral-most Class II genes, (e.g. nkx2.2a, and nkx2.9) expression of nkx6.2 was affected differentially in different Hh pathway mutants. nkx6.2 expression was completely absent in smu(smo) mutants (Fig. 2D), showing that nkx6.2 expression absolutely requires Hh signaling. In con(disp1) mutants, dorsal nkx6.2 expression is absent, while low levels of expression remain in the ventral-most CNS (Fig. 2D arrowhead). nkx6.2 expression was more mildly disrupted in dtr(gli1) and yot(gli2DR) mutants, with expression absent in the floor plate, but remaining in more dorsal cells similar to the unaffected dorsal expression domain of nkx6.2 in Gli2 knockout mice (Lei et al., 2004). This remaining nkx6.2 expression suggests that some Hh signaling is intact, consistent with the ability of motor neurons to differentiate in these mutants (Chandrasekhar et al., 1999; Vanderlaan et al., 2005) and suggesting redundancy in Gli activator function. Surprisingly, the expression of nkx6.2 in dtr(gli1) and yot(gli2DR) was complementary to that seen in con(disp1) mutants, with expression remaining dorsally, but being absent ventrally (Fig. 2D). Like nkx6.2, expression of nkx6.1 was expanded in the presence of ectopic Shh and absent following cyclopamine induced loss of Hh activity (Fig. 2E, Cheesman et al., 2004). Nkx6.1 expression is similarly lost in mouse Smo mutants (Wijgerde et al., 2002). However, unlike nkx6.2, nkx6.1 expression was largely unaffected in dtr(gli1) and yot(gli2) mutants (Fig. 2E), suggesting differential regulation of these two genes by Hh signaling.

To better correlate changes in nkx gene expression with changes in neural precursor fates, we next examined the expression of the motor neuron markers hlxb9 and olig2 in embryos with altered Hh signaling. olig2 expression was expanded upon Hh overexpression and both hlxb9 and olig2 were absent in smu(smo) mutants or cyclopamine treated embryos (Fig. 2H, data not shown, Park et al. 2002). This confirms that zebrafish motor neurons require Hh signaling to differentiate (Park et al., 2002) and is consistent with the loss of motor neurons and MNR2/Hb9 expression in mouse Smo−/− mutants (Wijgerde et al., 2002). Motor neurons do differentiate in con(disp1) (Nakano et al., 2004), dtr(gli1) (Chandrasekhar et al., 1999), and yot(gli2) (Vanderlaan et al., 2005) mutants. Consistently, hlxb9 expression was highly reduced but present in dtr(gli1) and yot(gli2DR) mutant embryos (data not shown). Surprisingly, hlxb9 expression was undetectable in con(disp1) mutants (Fig. 2G). The expression of hlxb9 and olig2 in Hh mutants dtr(gli1) and yot(gli2) at earlier stages (16−17hpf) was identical to that seen at 24hpf (data not shown).

This analysis of Class II gene expression in Hh pathway mutants supports the idea that smu(smo) mutants represent a complete loss of Hh signaling (Barresi et al., 2000; Lewis et al., 1999; Stickney et al., 2000), while dtr(gli1) and yot(gli2DR) mutants affect a subset of Hh signaling functions. In con(disp1) mutants, the expression of nkx6.2 only in cells adjacent to the floor plate is consistent with a loss of Shh secretion and diffusion (Nakano et al., 2004). These data illustrate how these markers allow a more detailed and systematic analysis of the differences in Hh signal disruption in different Hh pathway mutants.

1.3. The Class I gene transcriptional response to Hh diverges slightly among vertebrate species

The Class I genes of the pax family encode paired box homeodomain proteins, some of which are expressed in different dorsal/ventral domains of the developing spinal cord (Briscoe et al., 2000; Ericson et al., 1997a). In teleosts and amniotes, pax3 is the most dorsally expressed gene, encompassing the dorsal third of the CNS (Fig. 3A, Liem et al., 1995; Mansouri et al., 2001; Seo et al., 1998). pax7 is also expressed dorsally in the spinal cord, but is excluded from the most dorsal cells and the roof plate (Fig. 3G, Briscoe et al., 1999; Ericson et al., 1997a; Seo et al., 1998). pax6a is the most broadly expressed of these pax genes in the neural tube with expression throughout most of the dorsal/ventral axis, with the exception of the floor plate and the roof plate (Fig. 3M, Karlstrom et al., 2003; Krauss et al., 1991). Ventrally, the pax6a expression domain includes V0-V2 interneuron and motor neuron progenitors (p0-p2, pMN) (Briscoe et al., 2000).

The Class I genes dbx1a and dbx2 are expressed in horizontal bands in the middle of the neural tube (Fig. 3S,Y, Fjose et al., 1994). In amniotes, dbx1 is expressed in V0 interneuron progenitors (Pierani et al., 1999; Sander et al., 2000), while dbx2 is in these cells as well as V1 interneuron progenitors (Pierani et al., 1999; Sander et al., 2000). Finally, class I Hh responsive genes of the iroquois family are expressed in broad domains in the dorsal CNS (Lewis et al., 2005; Park et al., 2004). Medially, irx3a (Fig. 3Z) and irx5a (data not shown) are expressed in the dorsal half of the neural tube, while laterally they are expressed along the entire D/V axis (Fig. 3Z, Bosse et al., 2000; Bosse et al., 1997; Tan et al., 1999; Wang et al., 2001).

pax3 expression has been shown to be regulated by Hh in neural explants (Liem et al., 1995), and in zebrafish somites (Feng et al., 2006). To better characterize pax3 regulation by Hh in the spinal cord, we examined expression in zebrafish Hh gain- and loss-of function scenarios. Consistent with pax3 being a Class I Hh-regulated gene, over-expression of shh led to reduced pax3 expression that was confined to the dorsal-most cells in the neural tube (Fig. 3B). While pax3 expression was ventrally expanded in the midbrain of smu(smo) embryos (data not shown), spinal cord expression of pax3 appeared unaltered in smu(smo) (Fig. 3C), con(disp1) (Fig. 3D), yot(gli2DR) (Fig. 3E), and dtr(gli1) (Fig. 3F) mutant embryos.

pax7 expression is known to be negatively regulated by Hh signaling in amniotes (Ericson et al., 1997a), but this regulation has not been examined in the teleost neural tube. As in amniotes, zebrafish pax7 expression was reduced when Hh signaling was upregulated (Fig. 3H). However, a difference in Hh regulation across vertebrates was revealed by our analysis of pax7 expression in the zebrafish Hh pathway mutants. Unlike the situation in mouse (Wijgerde et al., 2002), and similar to zebrafish pax3 (Fig. 3C-F), the expression of zebrafish pax7 was not expanded upon loss of Hh signaling (Fig. 3I-L). This may point to Hh-independent repression of pax3 and pax7 in zebrafish embryos that could arise from other signaling molecules, or from Hh independent Gli function.

The expression of pax6a was ventrally expanded in the spinal cords of smu(smo), con(disp1) (Nakano et al., 2004), yot(gli2DR), and dtr(gli1) mutant embryos and was reduced in the presence of ectopic Hh signaling (Fig. 3N-R), as expected from a loss of Hh function. This result is consistent with the expansion of pax6a previously shown in the brain in yot(gli2DR) and dtr(gli1) mutant embryos (Karlstrom et al., 1999; Karlstrom et al., 2003) and matches the response of pax6a to the loss of Hh signaling in mammals (Caspary et al., 2002; Wijgerde et al., 2002).

The expression of dbx1a and dbx2 in the middle of the neural tube (Fig. 3S,Y, Lu et al., 1992; Pierani et al., 1999; Seo et al., 1999; Shoji et al., 1996) suggests these genes may provide a sensitive assay for subtle defects in mid- to low-levels of Hh signaling, but this regulation has not been shown in teleosts. Consistent with repression by Hh signaling, expression of both dbx1a and dbx2 was reduced and shifted dorsally upon ectopic Shh induction (Fig. 3T, Y), with dbx2 expression showing a more extreme dorsal shift (Fig. 3T, Y). In smu(smo) mutants, or with cyclopamine treatments that eliminate Hh signaling, dbx1a and dbx2 expression were expanded ventrally (Fig. 3U,Y), similar to mouse Smo mutants (Wijgerde et al., 2002). In con(disp1) mutant embryos the band of dbx1a expression was also expanded ventrally (Fig. 3V), showing that defects in Hh secretion affect the ability of Hh to repress expression of this gene. In contrast, dbx1a and dbx2 expression appeared unaffected in yot(gli2DR) anddtr(gli1) mutants (Fig. 3W-Y), suggesting that another Gli protein, possibly Gli3, might contribute to patterning in the intermediate regions of the spinal cord. Indeed, the expression of dbx1a was expanded dorsally in Gli3 mutant mice, indicating a regulatory role for Gli3 in the intermediate-dorsal spinal cord (Persson et al., 2002).

Finally, all three cloned members of the zebrafish irx gene family show regional regulation by Hh that is consistent with their classification as Class I genes. Medial irx3a (Fig. 3Z, Lewis et al., 2005; Park et al., 2004) and irx5a (data not shown) expression shifted dorsally with ectopic Hh signaling and ventrally with cyclopamine induced loss of Hh signaling, consistent with the ventral expansion of irx3a expression in mouse smo−/− mutants (Wijgerde et al., 2002). irx3a expression appeared unaffected in dtr(gli1) and yot(gli2DR) mutants (Fig. 3Z). In summary, this careful analysis of class I gene expression provides a sensitive assay for subtle defects in Hh signaling, and points to slight differences in the Hh response across vertebrates.

1.4. Summary of the Hh transcriptional response in zebrafish

Figure 4 shows a summary of Hh responsive gene expression in the zebrafish spinal cord. As in mammals, Class I and Class II gene expression divides the zebrafish neural tube into distinct domains, each with unique combinations of homeodomain transcription factor gene expression that contribute to the differentiation of distinct neuronal cell types (Fig. 4A). In general, increasing Shh signaling ventralizes the spinal cord, while the loss of Gli mediated Hh signaling leads to dorsalization of these expression domains in the spinal cord (Caspary et al., 2002; Huang et al., 2002; Wijgerde et al., 2002). The loss of Hh signaling in smu(smo) mutants or cyclopamine treated embryos eliminated the activation of Class II gene (nkx2.2a, nkx2.9, olig2, nkx6.1, and nkx6.2) expression and eliminated ventral repression of Class I gene (pax6a, dbx1a(hlx1), dbx2, and irx3a) expression (Fig. 4B). In con(disp) mutants, expression of the Class II gene nkx6.2 was maintained in lateral floorplate cells that are adjacent to the Shh expressing medial floorplate (Fig. 4C). However, these ventral cells do not express other lateral floorplate or ventral precursor markers (Fig. 2, Nakano et al., 2004). This suggests that in con(disp1) mutants, cells in direct contact with the floorplate receive diminished Hh signals that are capable of activating only nkx6.2 expression, while more dorsal cells receive little or no Hh signaling (Fig. 4C). This is consistent with a loss of Shh secretion and diffusion due to a loss of disp-1 function. Finally, the absence of Gli1 function (dtr mutants) or the presence of Gli2 dominant repressor proteins (yot mutants) eliminated expression of the ventral-most Class II genes nkx2.2a and nkx2.9, and reduced ventral aspects of the broader nkx6.2 domain. The more ventral nkx6.1 and olig2 expression domains remained largely intact, while hlxb9 expression was reduced but not absent (Figs 2, 4D). Interestingly, loss of Hh/Gli function in dtr(gli1) and yot(gli2DR) mutants expanded pax6a expression ventrally, but had no effect on the expression of the dorsally expressed Class I genes (pax3, pax7, dbx1a(hlx1), anddbx2) or the dorso-laterally expressed irx3a (Figs. 3, 4D). Thus in the absence of either gli1 or gli2, Hh signals appear to be generally reduced, but Hh signaling still influences gene expression in mid regions of the spinal cord (Fig. 4D). This indicates that Gli1 activator function is absolutely required for the ventral-most spinal cord progenitor cells in zebrafish, but that redundancy may exist in Gli function in more dorsal regions. This is consistent with the observation that motor neuron fates are only partially affected in the spinal cord of dtr(gli1) and yot(gli2) mutants (Chandrasekhar et al., 1999; Vanderlaan et al., 2005).

2. Experimental Procedures

2.1. Fish lines and cyclopamine treatments

Wild type and mutant zebrafish embryos were collected and maintained at 28ºC as described in (Westerfield et al., 1993) and staged according to (Kimmel et al., 1995). Mutant lines used were slow-muscle-omitted (smub641 ) (Barresi et al., 2000), a loss of function Smoothened allele (Chen et al., 2001; Varga et al., 2001), detour (dtrts269), a loss of function Gli1 allele (Karlstrom et al., 2003), you-too (yotty17), which encodes a dominant repressor form of Gli2, (Karlstrom et al., 1999), and chameleon, (con15a), a loss of function dispatched1 allele (Nakano et al., 2004). Wild type embryos were also treated with 100µM cyclopamine (Toronto Chemicals) in 1ml of embryo medium (2M MgSO4, 2M KCl, 2M CaCl2, 0.5M NaH2PO4, 5M NaCl) from a stock of 10mM cyclopamine, starting at shield stage or tailbud stage. Embryos were incubated in a 12-well plate at 28ºC. Control embryos were treated with equal volumes of ethanol (cyclopamine carrier) as previously described (Sbrogna et al., 2003). 24hpf embryos were fixed overnight at 4 ºC with 4% paraformaldehyde.

2.2. cDNA cloning

Fragments of zebrafish nkx2.9 and nkx6.2 coding regions were PCR amplified from an oligo dT primed zebrafish first strand cDNA (Superscript II RT kit, Invitrogen). Primers used were: nkx2.9 forward (5′ ATGGCTATTTCAAACAAGTTCAGT), nkx2.9 reverse (5′ CGGTTTGCCATCTCGAACCAAA), nkx6.2 forward (5′-CATGACCGAGATGAAGACCTC), and nkx6.2 reverse (5′ TTGGCTCTCGGTCATTCCCAG). PCR products were gel purified and cloned into pCR II-TOPO and pCR 2.1 vectors respectively, using the TA cloning kit (Invitrogen).

2.3. Whole-mount in situ hybridization

Whole mount in situ hybridization was performed as described (Karlstrom et al., 1999) using digoxygenin or fluorescein labeled probes (Roche). The nkx2.9 probe was prepared by digesting pCR II-TOPO-nk2.9 with Xho I and transcribing with Sp6 RNA polymerase. The pCR 2.1-nkx6.2 was digested with SpeI and transcribed with T7. Other probes used were nkx2.2a (Barth and Wilson, 1995), hlxb9 (a generous gift from Larry Moss), pax6a (Krauss et al., 1991), pax7 (Seo et al., 1998), hlx1 (Fjose et al., 1994), pax3 (Seo et al., 1998), irx1a (Wang et al., 2001), irx3a (Tan et al., 1999), irx5 (Wang et al., 2001). In situ probes for olig2 (AF442964), dbx2 (NM_131179), and nkx6.1 (AY437556) were generated directly from PCR products that included a T7 RNA polymerase binding sequence at the 3' end. Primer sequences used were: nkx6.1 forward, 5'TCTGCGTTTGTTTTCACGT T and reverse 5'TAATACGACTCACTATAGGGTTTTTCATCGTCCGAGTTTG, olig2 forward, 5'ATCTTTTTCTGTCCGCCGTC and reverse 5'TAATACGACTCACTATAGGGTATAGTCGAGGG CTGAGGAA, dbx2 forward, 5'AACAGACAGCACACACAGAG and reverse 5'TAATACGACTC ACTATAGGGTAAAACCCAACAGTCCACCT. Embryos were fixed in 4% paraformaldehyde overnight after the color reaction. Whole mount embryos were cleared in 75% glycerol and examined using DIC optics on a Zeiss axioskop.

2.4. mRNA Injections

The shh/T7TS plasmid (Ekker et al., 1995) was linearized with BamHI and in vitro transcribed using T7 polymerase (mMessage mMachine-T7, Ambion kit). Wild type embryos were injected with ∼100 pg of shh RNA at the 1−2 cell stage. Injected embryos were incubated at 28°C until 24 hpf, fixed with 4% paraformaldehyde, and processed for in situ hybridization.

2.5. Sectioning

For cryosectioning, labeled embryos were rinsed with phosphate buffer (0.1 M PB) and placed in melted 1.2% low melting agarose (Sigma) (in 5% sucrose). Agar blocks were placed in 30% sucrose overnight at 4 °C, embedded in OCT compound (VWR Company), and 20 µm thick sections were cut using a Leica cryostat. Sections were collected on Superfrost slides (Fisher Scientific) and analyzed using DIC optics. Some embryos were hand-cut into 1-somite-thick sections using fire-sharpened tungsten wire tools. All sections shown represent the region of the spinal cord over the yolk plug (somites 7−9).

Acknowledgments

We thank Jeanne Thomas for technical assistance, Judy Bennett for fish care, and the members of the Karlstrom laboratory for useful discussion. Thanks to Larry Moss for hlxb9 probe, Hee-Chan Seo and Anders Fjose for hlx1, pax7 and pax3 probes and the rest of the zebrafish community for sharing in situ probes. Many thanks to Veronica Palma and Stephen H. Devoto for valuable discussion and comments on the manuscript. This work was supported in part by NINDS grant NS03994 and NICHD grant HD044929.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Arber S, Han B, Mendelsohn M, Smith M, Jessell TM, Sockanathan S. Requirement for the homeobox gene Hb9 in the consolidation of motor neuron identity. Neuron. 1999;23:659–74. doi: 10.1016/s0896-6273(01)80026-x. [DOI] [PubMed] [Google Scholar]
  2. Barresi MJ, Stickney HL, Devoto SH. The zebrafish slow-muscle-omitted gene product is required for Hedgehog signal transduction and the development of slow muscle identity. Development. 2000;127:2189–99. doi: 10.1242/dev.127.10.2189. [DOI] [PubMed] [Google Scholar]
  3. Barth KA, Wilson SW. Expression of zebrafish nk2.2 is influenced by sonic hedgehog vertebrate hedgehog-1 and demarcates a zone of neuronal differentiation in the embryonic forebrain. Development. 1995;121:1755–1768. doi: 10.1242/dev.121.6.1755. [DOI] [PubMed] [Google Scholar]
  4. Bosse A, Stoykova A, Nieselt-Struwe K, Chowdhury K, Copeland NG, Jenkins NA, Gruss P. Identification of a novel mouse Iroquois homeobox gene, Irx5, and chromosomal localisation of all members of the mouse Iroquois gene family. Dev Dyn. 2000;218:160–74. doi: 10.1002/(SICI)1097-0177(200005)218:1<160::AID-DVDY14>3.0.CO;2-2. [DOI] [PubMed] [Google Scholar]
  5. Bosse A, Zulch A, Becker MB, Torres M, Gomez-Skarmeta JL, Modolell J, Gruss P. Identification of the vertebrate Iroquois homeobox gene family with overlapping expression during early development of the nervous system. Mech Dev. 1997;69:169–81. doi: 10.1016/s0925-4773(97)00165-2. [DOI] [PubMed] [Google Scholar]
  6. Briscoe J, Pierani A, Jessell TM, Ericson J. A homeodomain protein code specifies progenitor cell identity and neuronal fate in the ventral neural tube. Cell. 2000;101:435–45. doi: 10.1016/s0092-8674(00)80853-3. [DOI] [PubMed] [Google Scholar]
  7. Briscoe J, Sussel L, Serup P, Hartigan-O'Connor D, Jessell TM, Rubenstein JL, Ericson J. Homeobox gene Nkx2.2 and specification of neuronal identity by graded Sonic hedgehog signalling. Nature. 1999;398:622–7. doi: 10.1038/19315. [DOI] [PubMed] [Google Scholar]
  8. Caspary T, Garcia-Garcia MJ, Huangfu D, Eggenschwiler JT, Wyler MR, Rakeman AS, Alcorn HL, Anderson KV. Mouse Dispatched homolog1 is required for long-range, but not juxtacrine, Hh signaling. Curr Biol. 2002;12:1628–32. doi: 10.1016/s0960-9822(02)01147-8. [DOI] [PubMed] [Google Scholar]
  9. Chandrasekhar A, Schauerte HE, Haffter P, Kuwada JY. The zebrafish detour gene is essential for cranial but not spinal motor neuron induction. Development. 1999;126:2727–37. doi: 10.1242/dev.126.12.2727. [DOI] [PubMed] [Google Scholar]
  10. Cheesman SE, Layden MJ, Von Ohlen T, Doe CQ, Eisen JS. Zebrafish and fly Nkx6 proteins have similar CNS expression patterns and regulate motoneuron formation. Development. 2004;131:5221–32. doi: 10.1242/dev.01397. [DOI] [PubMed] [Google Scholar]
  11. Chen W, Burgess S, Hopkins N. Analysis of the zebrafish smoothened mutant reveals conserved and divergent functions of hedgehog activity. Development. 2001;128:2385–2396. doi: 10.1242/dev.128.12.2385. [DOI] [PubMed] [Google Scholar]
  12. Dahmane N, Sanchez P, Gitton Y, Palma V, Sun T, Beyna M, Weiner H, Ruiz i Altaba A. The Sonic Hedgehog-Gli pathway regulates dorsal brain growth and tumorigenesis. Development. 2001;128:5201–12. doi: 10.1242/dev.128.24.5201. [DOI] [PubMed] [Google Scholar]
  13. Echelard Y, Epstein DJ, St-Jacques B, Shen L, Mohler J, McMahon JA, McMahon AP. Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell. 1993;75:1417–30. doi: 10.1016/0092-8674(93)90627-3. [DOI] [PubMed] [Google Scholar]
  14. Ekker SC, Ungar AR, Greenstein P, von Kessler DP, Porter JA, Moon RT, Beachy PA. Patterning activities of vertebrate hedgehog proteins in the developing eye and brain. Curr Biol. 1995;5:944–55. doi: 10.1016/s0960-9822(95)00185-0. [DOI] [PubMed] [Google Scholar]
  15. Ericson J, Briscoe J, Rashbass P, van Heyningen V, Jessell TM. Graded sonic hedgehog signaling and the specification of cell fate in the ventral neural tube. Cold Spring Harb Symp Quant Biol. 1997a;62:451–66. [PubMed] [Google Scholar]
  16. Ericson J, Muhr J, Placzek M, Lints T, Jessell TM, Edlund T. Sonic hedgehog induces the differentiation of ventral forebrain neurons: a common signal for ventral patterning within the neural tube. Cell. 1995;81:747–56. doi: 10.1016/0092-8674(95)90536-7. [DOI] [PubMed] [Google Scholar]
  17. Ericson J, Rashbass P, Schedl A, Brenner-Morton S, Kawakami A, van Heyningen V, Jessell TM, Briscoe J. Pax6 controls progenitor cell identity and neuronal fate in response to graded Shh signaling. Cell. 1997b;90:169–80. doi: 10.1016/s0092-8674(00)80323-2. [DOI] [PubMed] [Google Scholar]
  18. Feng X, Adiarte EG, Devoto SH. Hedgehog acts directly on the zebrafish dermomyotome to promote myogenic differentiation. Dev Biol. 2006;300:736–46. doi: 10.1016/j.ydbio.2006.08.056. [DOI] [PubMed] [Google Scholar]
  19. Fjose A, Izpisua-Belmonte JC, Fromental-Ramain C, Duboule D. Expression of the zebrafish gene hlx-1 in the prechordal plate and during CNS development. Development. 1994;120:71–81. doi: 10.1242/dev.120.1.71. [DOI] [PubMed] [Google Scholar]
  20. Flanagan-Steet H, Fox MA, Meyer D, Sanes JR. Neuromuscular synapses can form in vivo by incorporation of initially aneural postsynaptic specializations. Development. 2005;132:4471–81. doi: 10.1242/dev.02044. [DOI] [PubMed] [Google Scholar]
  21. Fu H, Qi Y, Tan M, Cai J, Takebayashi H, Nakafuku M, Richardson W, Qiu M. Dual origin of spinal oligodendrocyte progenitors and evidence for the cooperative role of Olig2 and Nkx2.2 in the control of oligodendrocyte differentiation. Development. 2002;129:681–93. doi: 10.1242/dev.129.3.681. [DOI] [PubMed] [Google Scholar]
  22. Henseleit KD, Nelson SB, Kuhlbrodt K, Hennings JC, Ericson J, Sander M. NKX6 transcription factor activity is required for alpha- and beta-cell development in the pancreas. Development. 2005;132:3139–49. doi: 10.1242/dev.01875. [DOI] [PubMed] [Google Scholar]
  23. Huang Y, Roelink H, McKnight GS. Protein kinase A deficiency causes axially localized neural tube defects in mice. J Biol Chem. 2002;277:19889–96. doi: 10.1074/jbc.M111412200. [DOI] [PubMed] [Google Scholar]
  24. Hutchinson SA, Eisen JS. Islet1 and Islet2 have equivalent abilities to promote motoneuron formation and to specify motoneuron subtype identity. Development. 2006;133:2137–47. doi: 10.1242/dev.02355. [DOI] [PubMed] [Google Scholar]
  25. Ingham PW, McMahon AP. Hedgehog signaling in animal development: paradigms and principles. Genes Dev. 2001;15:3059–87. doi: 10.1101/gad.938601. [DOI] [PubMed] [Google Scholar]
  26. Karlstrom RO, Talbot WS, Schier AF. Comparative synteny cloning of zebrafish you-too: mutations in the Hedgehog target gli2 affect ventral forebrain patterning. Genes Dev. 1999;13:388–93. doi: 10.1101/gad.13.4.388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Karlstrom RO, Tyurina OV, Kawakami A, Nishioka N, Talbot WS, Sasaki H, Schier AF. Genetic analysis of zebrafish gli1 and gli2 reveals divergent requirements for gli genes in vertebrate development. Development. 2003;130:1549–64. doi: 10.1242/dev.00364. [DOI] [PubMed] [Google Scholar]
  28. Kawakami A, Nojima Y, Toyoda A, Takahoko M, Satoh M, Tanaka H, Wada H, Masai I, Terasaki H, Sakaki Y, Takeda H, Okamoto H. The zebrafish-secreted matrix protein you/scube2 is implicated in long-range regulation of hedgehog signaling. Curr Biol. 2005;15:480–8. doi: 10.1016/j.cub.2005.02.018. [DOI] [PubMed] [Google Scholar]
  29. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages of Embryonic Development of the Zebrafish. 1995;203:253–310. doi: 10.1002/aja.1002030302. [DOI] [PubMed] [Google Scholar]
  30. Kimura Y, Okamura Y, Higashijima S. alx, a zebrafish homolog of Chx10, marks ipsilateral descending excitatory interneurons that participate in the regulation of spinal locomotor circuits. J Neurosci. 2006;26:5684–97. doi: 10.1523/JNEUROSCI.4993-05.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Komuro I, Schalling M, Jahn L, Bodmer R, Jenkins NA, Copeland NG, Izumo S. Gtx: a novel murine homeobox-containing gene, expressed specifically in glial cells of the brain and germ cells of testis, has a transcriptional repressor activity in vitro for a serum-inducible promoter. Embo J. 1993;12:1387–401. doi: 10.1002/j.1460-2075.1993.tb05783.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Krauss S, Johansen T, Korzh V, Moens U, Ericson JU, Fjose A. Zebrafish pax[zf-a]: a paired box-containing gene expressed in the neural tube. Embo J. 1991;10:3609–19. doi: 10.1002/j.1460-2075.1991.tb04927.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Lang D, Powell SK, Plummer RS, Young KP, Ruggeri BA. PAX genes: Roles in development, pathophysiology, and cancer. Biochem Pharmacol. 2006 doi: 10.1016/j.bcp.2006.06.024. [DOI] [PubMed] [Google Scholar]
  34. Lei Q, Zelman AK, Kuang E, Li S, Matise MP. Transduction of graded Hedgehog signaling by a combination of Gli2 and Gli3 activator functions in the developing spinal cord. Development. 2004;131:3593–604. doi: 10.1242/dev.01230. [DOI] [PubMed] [Google Scholar]
  35. Lewis KE, Bates J, Eisen JS. Regulation of iro3 expression in the zebrafish spinal cord. Dev Dyn. 2005;232:140–8. doi: 10.1002/dvdy.20215. [DOI] [PubMed] [Google Scholar]
  36. Lewis KE, Currie PD, Roy S, Schauerte H, Haffter P, Ingham PW. Control of muscle cell-type specification in the zebrafish embryo by Hedgehog signalling. Dev Biol. 1999;216:469–80. doi: 10.1006/dbio.1999.9519. [DOI] [PubMed] [Google Scholar]
  37. Liem KF, Jr., Tremml G, Roelink H, Jessell TM. Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Cell. 1995;82:969–79. doi: 10.1016/0092-8674(95)90276-7. [DOI] [PubMed] [Google Scholar]
  38. Lu S, Bogarad LD, Murtha MT, Ruddle FH. Expression pattern of a murine homeobox gene, Dbx, displays extreme spatial restriction in embryonic forebrain and spinal cord. Proc Natl Acad Sci U S A. 1992;89:8053–7. doi: 10.1073/pnas.89.17.8053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Mansouri A, Pla P, Larue L, Gruss P. Pax3 acts cell autonomously in the neural tube and somites by controlling cell surface properties. Development. 2001;128:1995–2005. doi: 10.1242/dev.128.11.1995. [DOI] [PubMed] [Google Scholar]
  40. Miao N, Wang M, Ott JA, D'Alessandro JS, Woolf TM, Bumcrot DA, Mahanthappa NK, Pang K. Sonic hedgehog promotes the survival of specific CNS neuron populations and protects these cells from toxic insult In vitro. J Neurosci. 1997;17:5891–9. doi: 10.1523/JNEUROSCI.17-15-05891.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Nakano Y, Kim HR, Kawakami A, Roy S, Schier AF, Ingham PW. Inactivation of dispatched 1 by the chameleon mutation disrupts Hedgehog signalling in the zebrafish embryo. Dev Biol. 2004;269:381–92. doi: 10.1016/j.ydbio.2004.01.022. [DOI] [PubMed] [Google Scholar]
  42. Novitch BG, Chen AI, Jessell TM. Coordinate regulation of motor neuron subtype identity and pan-neuronal properties by the bHLH repressor Olig2. Neuron. 2001;31:773–89. doi: 10.1016/s0896-6273(01)00407-x. [DOI] [PubMed] [Google Scholar]
  43. Odenthal J, Nusslein-Volhard C. fork head domain genes in zebrafish. Dev Genes Evol. 1998;208:245–58. doi: 10.1007/s004270050179. [DOI] [PubMed] [Google Scholar]
  44. Pabst O, Herbrand H, Arnold HH. Nkx2-9 is a novel homeobox transcription factor which demarcates ventral domains in the developing mouse CNS. Mech Dev. 1998;73:85–93. doi: 10.1016/s0925-4773(98)00035-5. [DOI] [PubMed] [Google Scholar]
  45. Pabst O, Rummelies J, Winter B, Arnold HH. Targeted disruption of the homeobox gene Nkx2.9 reveals a role in development of the spinal accessory nerve. Development. 2003;130:1193–202. doi: 10.1242/dev.00346. [DOI] [PubMed] [Google Scholar]
  46. Park HC, Mehta A, Richardson JS, Appel B. olig2 is required for zebrafish primary motor neuron and oligodendrocyte development. Dev Biol. 2002;248:356–68. doi: 10.1006/dbio.2002.0738. [DOI] [PubMed] [Google Scholar]
  47. Park HC, Shin J, Appel B. Spatial and temporal regulation of ventral spinal cord precursor specification by Hedgehog signaling. Development. 2004;131:5959–69. doi: 10.1242/dev.01456. [DOI] [PubMed] [Google Scholar]
  48. Persson M, Stamataki D, te Welscher P, Andersson E, Bose J, Ruther U, Ericson J, Briscoe J. Dorsal-ventral patterning of the spinal cord requires Gli3 transcriptional repressor activity. Genes Dev. 2002;16:2865–78. doi: 10.1101/gad.243402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Pierani A, Brenner-Morton S, Chiang C, Jessell TM. A sonic hedgehog-independent, retinoid-activated pathway of neurogenesis in the ventral spinal cord. Cell. 1999;97:903–15. doi: 10.1016/s0092-8674(00)80802-8. [DOI] [PubMed] [Google Scholar]
  50. Placzek M, Briscoe J. The floor plate: multiple cells, multiple signals. Nat Rev Neurosci. 2005;6:230–40. doi: 10.1038/nrn1628. [DOI] [PubMed] [Google Scholar]
  51. Sander M, Paydar S, Ericson J, Briscoe J, Berber E, German M, Jessell TM, Rubenstein JL. Ventral neural patterning by Nkx homeobox genes: Nkx6.1 controls somatic motor neuron and ventral interneuron fates. Genes Dev. 2000;14:2134–9. doi: 10.1101/gad.820400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Santagati F, Gerber JK, Blusch JH, Kokubu C, Peters H, Adamski J, Werner T, Balling R, Imai K. Comparative analysis of the genomic organization of Pax9 and its conserved physical association with Nkx2-9 in the human, mouse, and pufferfish genomes. Mamm Genome. 2001;12:232–7. doi: 10.1007/s003350010267. [DOI] [PubMed] [Google Scholar]
  53. Schauerte HE, van Eeden FJ, Fricke C, Odenthal J, Strahle U, Haffter P. Sonic hedgehog is not required for the induction of medial floor plate cells in the zebrafish. Development. 1998;125:2983–93. doi: 10.1242/dev.125.15.2983. [DOI] [PubMed] [Google Scholar]
  54. Sekimizu K, Nishioka N, Sasaki H, Takeda H, Karlstrom RO, Kawakami A. The zebrafish iguana locus encodes Dzip1, a novel zinc-finger protein required for proper regulation of Hedgehog signaling. Development. 2004;131:2521–32. doi: 10.1242/dev.01059. [DOI] [PubMed] [Google Scholar]
  55. Seo HC, Nilsen F, Fjose A. Three structurally and functionally conserved Hlx genes in zebrafish. Biochim Biophys Acta. 1999;1489:323–35. doi: 10.1016/s0167-4781(99)00187-6. [DOI] [PubMed] [Google Scholar]
  56. Seo HC, Saetre BO, Havik B, Ellingsen S, Fjose A. The zebrafish Pax3 and Pax7 homologues are highly conserved, encode multiple isoforms and show dynamic segment-like expression in the developing brain. Mech Dev. 1998;70:49–63. doi: 10.1016/s0925-4773(97)00175-5. [DOI] [PubMed] [Google Scholar]
  57. Shoji H, Ito T, Wakamatsu Y, Hayasaka N, Ohsaki K, Oyanagi M, Kominami R, Kondoh H, Takahashi N. Regionalized expression of the Dbx family homeobox genes in the embryonic CNS of the mouse. Mech Dev. 1996;56:25–39. doi: 10.1016/0925-4773(96)00509-6. [DOI] [PubMed] [Google Scholar]
  58. Stamataki D, Ulloa F, Tsoni SV, Mynett A, Briscoe J. A gradient of Gli activity mediates graded Sonic Hedgehog signaling in the neural tube. Genes Dev. 2005;19:626–41. doi: 10.1101/gad.325905. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Stanfel MN, Moses KA, Schwartz RJ, Zimmer WE. Regulation of organ development by the NKX-homeodomain factors: an NKX code. Cell Mol Biol (Noisy-le-grand) 2005;(Suppl 51):OL785–99. [PubMed] [Google Scholar]
  60. Stickney HL, Barresi MJ, Devoto SH. Somite development in zebrafish. Dev Dyn. 2000;219:287–303. doi: 10.1002/1097-0177(2000)9999:9999<::AID-DVDY1065>3.0.CO;2-A. [DOI] [PubMed] [Google Scholar]
  61. Talbot WS, Trevarrow B, Halpern ME, Melby AE, Farr G, Postlethwait JH, Jowett T, Kimmel CB, Kimelman D. A homeobox gene essential for zebrafish notochord development. Nature. 1995;378:150–7. doi: 10.1038/378150a0. [DOI] [PubMed] [Google Scholar]
  62. Tan JT, Korzh V, Gong Z. Expression of a zebrafish iroquois homeobox gene, Ziro3, in the midline axial structures and central nervous system. Mech Dev. 1999;87:165–8. doi: 10.1016/s0925-4773(99)00121-5. [DOI] [PubMed] [Google Scholar]
  63. Tanabe Y, William C, Jessell TM. Specification of motor neuron identity by the MNR2 homeodomain protein. Cell. 1998;95:67–80. doi: 10.1016/s0092-8674(00)81783-3. [DOI] [PubMed] [Google Scholar]
  64. Vallstedt A, Muhr J, Pattyn A, Pierani A, Mendelsohn M, Sander M, Jessell TM, Ericson J. Different levels of repressor activity assign redundant and specific roles to Nkx6 genes in motor neuron and interneuron specification. Neuron. 2001;31:743–55. doi: 10.1016/s0896-6273(01)00412-3. [DOI] [PubMed] [Google Scholar]
  65. Vanderlaan G, Tyurina OV, Karlstrom RO, Chandrasekhar A. Gli function is essential for motor neuron induction in zebrafish. Dev Biol. 2005;282:550–70. doi: 10.1016/j.ydbio.2005.04.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Varga ZM, Amores A, Lewis KE, Yan YL, Postlethwait JH, Eisen JS, Westerfield M. Zebrafish smoothened functions in ventral neural tube specification and axon tract formation. Development. 2001;128:3497–509. doi: 10.1242/dev.128.18.3497. [DOI] [PubMed] [Google Scholar]
  67. Wang X, Emelyanov A, Sleptsova-Friedrich I, Korzh V, Gong Z. Expression of two novel zebrafish iroquois homologues (ziro1 and ziro5) during early development of axial structures and central nervous system. Mech Dev. 2001;105:191–5. doi: 10.1016/s0925-4773(01)00400-2. [DOI] [PubMed] [Google Scholar]
  68. Wendik B, Maier E, Meyer D. Zebrafish mnx genes in endocrine and exocrine pancreas formation. Dev Biol. 2004;268:372–83. doi: 10.1016/j.ydbio.2003.12.026. [DOI] [PubMed] [Google Scholar]
  69. Wijgerde M, McMahon JA, Rule M, McMahon AP. A direct requirement for Hedgehog signaling for normal specification of all ventral progenitor domains in the presumptive mammalian spinal cord. Genes Dev. 2002;16:2849–64. doi: 10.1101/gad.1025702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Wolff C, Roy S, Lewis KE, Schauerte H, Joerg-Rauch G, Kirn A, Weiler C, Geisler R, Haffter P, Ingham PW. iguana encodes a novel zinc-finger protein with coiled-coil domains essential for Hedgehog signal transduction in the zebrafish embryo. Genes Dev. 2004;18:1565–76. doi: 10.1101/gad.296004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Woods IG, Talbot WS. The you Gene Encodes an EGF-CUB Protein Essential for Hedgehog Signaling in Zebrafish. PLoS Biol. 2005;3:e66. doi: 10.1371/journal.pbio.0030066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Xu J, Srinivas BP, Tay SY, Mak A, Yu X, Lee SG, Yang H, Govindarajan KR, Leong B, Bourque G, Mathavan S, Roy S. Genome-wide Expression Profiling in the Zebrafish Embryo Identifies Target Genes Regulated by Hedgehog Signaling During Vertebrate Development. Genetics. 2006 doi: 10.1534/genetics.106.061523. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES