Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2007 Jul 23;75(10):4710–4718. doi: 10.1128/IAI.00372-07

Lipase 8 Affects the Pathogenesis of Candida albicans▿

Attila Gácser 1,†,*, Frank Stehr 2,†, Cathrin Kröger 2, László Kredics 3, Wilhelm Schäfer 2, Joshua D Nosanchuk 1
PMCID: PMC2044512  PMID: 17646357

Abstract

The production of lipases can affect microbial fitness and virulence. We examined the role of the lipase 8 (LIP8) gene in the virulence of Candida albicans by constructing Δlip8 strains by the URA-blaster disruption method. Reverse transcription-PCR experiments demonstrated the absence of LIP8 expression in the homozygous knockout mutants. Reconstituted strains and overexpression mutants were generated by introducing a LIP8 open reading frame under control of a constitutive actin promoter. Knockout mutants produced more mycelium, particularly at higher temperatures and pH ≥7. Diminished LIP8 expression resulted in reduced growth in lipid-containing media. Mutants deficient in the LIP8 gene were significantly less virulent in a murine intravenous infection model. The results clearly indicate that Lip8p is an important virulence factor of C. albicans.


Lipases catalyze both the hydrolysis and synthesis of triacylglycerols (4). Many of these enzymes are characterized by stability at high temperatures and in organic solvents, high enantioselectivity, and resistance to proteolysis, which make them ideal candidates for diverse commercial applications. In addition to the industrial uses of lipases, there is an evolving literature on their role as important microbial virulence factors (3, 42). The putative roles of microbial extracellular lipases include digestion of lipids for nutrient acquisition, adhesion to host cells and host tissues, synergistic interactions with other enzymes, nonspecific hydrolysis due to additional phospholipolytic activities, initiation of inflammatory processes by affecting immune cells, and self-defense mediated by lysing competing microflora (37, 43). Extracellular lipases have been proposed to be potential virulence factors of bacterial pathogens, including Staphylococcus aureus (47), Staphylococcus epidermidis (24), Propionibacterium acnes (26), and Pseudomonas aeruginosa (18), as well as pathogenic fungi, such as Malassezia furfur (33), Hortaea werneckii (13), and Candida species (37, 43).

Candida albicans is recognized as the leading opportunistic pathogen involved in oral, vaginal, and systemic infections. It is the fourth most common cause of bloodstream infection in the United States and has a high attributable mortality rate (32). Besides yeast-to-hypha transition, adhesion factors, surface hydrophobicity, phenotypic switching, thigmotropism, and molecular mimicry (7), the secretion of hydrolytic enzymes like proteinases or lipases may also affect C. albicans virulence. Although the secretion of aspartic proteinases (Sap1p to Sap10p) has been shown to be a key virulence determinant of C. albicans (15, 27, 29, 38, 41, 45), limited information is available about the involvement of lipases in Candida infection.

Extracellular lipase activity of C. albicans was first described in 1965 (53), and the first lipase gene, LIP1, was identified in 1997 (11). Results of Southern blot analysis using LIP1 as a probe under low-stringency conditions suggested the existence of a larger lipase gene family. More recently, nine additional lipase genes, LIP2 to LIP10, with significant homologies to LIP1 were identified through cloning, sequencing, BLAST searches, and sequence alignments in the C. albicans genome databases (16). The open reading frames (ORFs) of all 10 lipase genes are between 1,281 and 1,416 bp long, and they encode highly similar proteins with up to 80% identical amino acid sequences. However, the individual lipase genes are differentially expressed and regulated (39, 42). The mature lipase isoenzymes consist of an average of 449 amino acids. On the basis of sequence homologies at the amino acid level, the lipase isoenzyme family was divided into three subgroups (37, 43).

The lipase-encoding genes LIP1 to LIP10 have been expressed in Saccharomyces cerevisiae, and lipolytic activities were detected only when LIP4, LIP6, LIP8, or LIP10 was expressed (35). The LIP4 gene, belonging to the second subgroup of lipase genes (43), was used for detailed characterization of a recombinant enzyme which behaved like a true lipase, displaying activity towards insoluble triglycerides (35). LIP5 and LIP8, situated on chromosome 7 of C. albicans, are two closely related, highly homologous genes also belonging to the second subgroup of the lipase gene family. Both were found to be expressed with constitutive or predominant transcript levels in in vivo experimental systems (39, 42). LIP8 was selected for the current study, as it has been shown to be the only lipase that is uniformly upregulated by 4 h after infection in a systemic murine infection (42). We constructed LIP8 knockout mutants, reconstituted strains, and overexpression (OE) mutants to further explore the role of lipases in C. albicans pathogenesis.

MATERIALS AND METHODS

Microorganisms and cloning vectors.

The C. albicans strains used or constructed during this study are listed in Table 1. Plasmids pCR-BluntII-TOPO (Invitrogen, Groningen, The Netherlands) and pGEM-T (Promega, Mannheim, Germany) were used as cloning vectors. Escherichia coli DH5α (Fermentas, St. Leon-Rot, Germany) was used for the propagation of plasmids and DNA manipulations (36).

TABLE 1.

C. albicans strains used and constructed in this study

C. albicans strain Genotype
SC5314a Wt
CAI-2b Δura3::imm434/URA3
CAI-4b Δura3::imm434/Δura3::imm434
LIP8 knockout mutants
    HeIbFOA Δura3::imm434/Δura3::imm434 LIP8/Δlip8::hisG-URA3-hisG
    HeI Δura3::imm434/Δura3::imm434 LIP8/Δlip8::hisG::URA3
    HeII Δura3::imm434/Δura3::imm434 LIP8/Δlip8::hisG::URA3
    KoIbFOA Δura3::imm434/Δura3::imm434 Δlip8::hisG/Δlip8::hisG-URA3-hisG
    KoI Δura3::imm434/Δura3::imm434 Δlip8::hisG/Δlip8::hisG::URA3
    KoII Δura3::imm434/Δura3::imm434 Δlip8::hisG/Δlip8::hisG::URA3
LIP8 reconstituted mutants
    ReI Δura3::imm434/Δura3::imm434 LIP8/Δlip8::hisG pCIp10-ACT-promoter-LIP8::URA3
    ReII Δura3::imm434/Δura3::imm434 Δlip8::hisG/Δlip8::hisG pCIp10-ACT-promoter-LIP8::URA3
LIP8 OE mutants
    OeI Δura3::imm434/Δura3::imm434 pCIp10-ACT-promoter-LIP8::URA3
    OeII Δura3::imm434/Δura3::imm434 pCIp10-ACT-promoter-LIP8::URA3
a

Data from reference 12.

b

Data from reference 10.

Construction of plasmids.

Disruption of both C. albicans LIP8 alleles was performed using the URA-blaster method (10). A 382-bp SalI-PstI fragment containing the 3′ region of the ORF (169 bp) and the 3′ untranscribed region (213 bp) of the LIP8 gene was amplified with primers LIP8-3′-SalI and LIP8-3′-PstI (Table 2) and cloned into the pMB7 vector (10) upstream of the hisG-URA3-hisG cassette, resulting in plasmid pB12. An 816-bp SacI-KpnI fragment homologous to the 5′ region of the LIP8 gene was amplified with primers LIP8-5′-SacI and LIP8-5′-KpnI (Table 2) and ligated into the downstream region of the hisG-URA3-hisG cassette of pB12, resulting in the final LIP8 knockout vector pB25. pB25 was digested with SacI and PstI and used in the transformation of C. albicans.

TABLE 2.

PCR primers used in this study

Primer Sequencea Annealing temp (°C) Product size (bp)
LIP8a AGAGTGATACAGACAAAAAATCAG 59 521
LIP8b AAGACCATTCAGCATCATGGTG
LIP8-3′-SalI GTCGACCAACATGATAAAAGATTAAGTAAC 56 382
LIP8-3′-PstI CTGCAGTACTAGACACTTACAATTTACA
LIP8-5′-KpnI GGTACCAATTCCGGATACTCATTAGC 55 816
LIP8-5′-SacI GAGCTCAGTTGTATTCATTTCTATCCAC
LIP8-Re-5′-KpnI GGTACCATGTTGTTTTTATTATTCTTATTAATTAC 60 1,803
LIP8-Re-3′-NcoI CCATGGATAGATAAGAAAATCCGGCTCAAC
LIP8-Re-3′-3-SacI GAGCTCATAGATAAGAAAATCCG
Actin-5′-KpnI GGTACCATGTCTTTAGAGCCTTCAGG 55 1,455
Actin-3′-KpnI GGTACCCATACCAGAACCGTTATCG
Actin-5′-3-SacI GAGCTCATGTCTTTAGAGCCTTCAGG 55 3,252
KO-3-5′ ATATTTTTAATATCCACACTGGC 55 354
KO-3-3′ AACATCTTTGCTATATTTAGGTG
EFB1a ATTGAACGAATTCTTGGCTGAC 55 554
EFB1b CATCTTCTTCAACAGCAGCTTG
a

Recognition sites of restriction enzymes are indicated by bold type.

In order to rescue the wild phenotype in Δlip8 mutants and to overexpress LIP8, the pB44 vector was constructed. First, the actin promoter (21, 49) was amplified with flanking KpnI restriction sites from the genomic DNA of C. albicans using primers Actin-5′-KpnI and Actin-3′-KpnI (Table 2), and the fragment was cloned into the pGEM-T vector, which resulted in pB40. The ORF and the 3′ untranscribed region of LIP8 flanked by KpnI restriction sites were amplified with primers LIP8-Re-5′-KpnI and LIP8-Re-3′-KpnI (Table 2) and similarly cloned into the pGEM-T vector, resulting in pB39. Next, the actin promoter was cut from pB40 with KpnI and cloned into pB39 5′ of the LIP8 fragment, forming pB41. Primers Actin-5′-3-SacI and LIP8-Re3′-3-SacI (Table 2) were used to amplify the fusion product from pB41 with flanking SacI restriction sites. The fusion product with the new restriction sites was cloned into pGEM-T (pB43) and then cut from pB43 with SacI and cloned into the pCIp10 vector containing the URA3 and RP10 genes (28) to create pB44 for retransformation and overexpression of LIP8. In the final step, URA3 was reintroduced into its original locus by transforming a URA3-IRO1 fragment as described previously (30).

Transformation of C. albicans.

Transformation of C. albicans was carried out using a protocol described for S. cerevisiae by R. D. Gietz and R. H. Schiestl (www.umanitoba.ca/faculties/medicine/biochem/gietz/method.html) that we modified for C. albicans. ura3 auxotrophic C. albicans strain CAI-4 (10), a derivative of clinical isolate SC5314 (12), was used for disruption of the LIP8 gene. Positive transformants were selected on SD agar containing 6.7 g/liter yeast nitrogen base (YNB) without amino acids, 20 g/liter glucose, and 20 g/liter agar. Only one copy of the target gene can be knocked out via integration of the disruption cassette into one of the two target alleles of LIP8. Correspondingly, the URA3 gene of the mutants was eliminated via 5-fluoroorotic acid (FOA) treatment (2), enabling disruption of the remaining LIP8 allele in a second transformation step.

Nucleic acid isolation, hybridization, cDNA synthesis, and PCRs.

Standard methods (36) were used for DNA isolation, gel electrophoresis, and Southern blotting. Labeling of the 354-bp LIP8 knockout probe using primers KO-3-5′ and KO-3-3′ (Table 2) and subsequent hybridization of the membranes at 68°C were carried out using a DIG DNA labeling and detection kit (Roche, Mannheim, Germany) by following the manufacturer's instructions.

Real-time RT-PCR for C. albicans gene expression.

LIP8 expression was analyzed by quantitative reverse transcription (RT)-PCR. Briefly, cells were harvested by vacuum filtration, and RNA was isolated by the peqGOLD RNAPure protocol (PeqLab, Erlangen, Germany). For real-time RT-PCR detection of LIP8 transcripts, 10 μg of total RNA was treated with DNase at 37°C for 1 h, precipitated with ethanol, and suspended in 100 μl of nuclease-free water. cDNA synthesis with equal amounts of RNA was carried out with a cyclic Hybaid Thermoblock (PCRSprint, Heidelberg, Germany) using reagents from Invitrogen (Groningen, The Netherlands) according to the manufacturer's instructions. The expression of the LIP8 gene was examined by RT-PCR with primers LIP8a and LIP8b (Table 2). For an internal mRNA control, we used primers specific for the EFB1 gene of C. albicans (Table 2). To confirm that similar concentrations of cDNA were obtained, signals of EFB1 PCR were compared. LIP8 transcript levels were determined and quantitatively assessed using a Bio-Rad iQ icycler and the Cycler iQ software, respectively. The cycling conditions used were 95°C for 5 min and then 40 cycles of 95°C for 15 s, 55°C for 30 s, and 72°C for 30 s. Next, the samples were cooled to 55°C, and a melting curve for temperatures between 55 and 95°C with 0.5°C increments was recorded. Real-time expression measurements were normalized against expression of the reference gene EFB1. Relative RNA levels were calculated using the ΔΔCt method; all primers resulted in amplification efficiencies of at least 95%.

Phenotypic observations.

Growth of the wild-type (Wt) C. albicans strain and the constructed mutants was analyzed on microtiter plates using liquid YPG and YNB-Tween 40 (7 g/liter YNB without amino acids, 5 g/liter ammonium sulfate, 25 ml/liter Tween 40; sterile filtered) media that were inoculated with 106 cells/200 μl medium and incubated at 37°C. Cell numbers were estimated with a Dynatech MR4000 enzyme-linked immunosorbent assay reader (Dynatech Laboratories, Chantilly, VA) at different intervals. NuTRIflex lipid solutions (B. Braun, Melsungen, Germany) were inoculated with 106 cells/ml medium and incubated at 37°C. Cell numbers were determined microscopically at different time points. Flocculation abilities were recorded 1 min after vortexing of overnight cultures grown in liquid YPG medium (23).

The temperature dependence and pH dependence of the Wt strain and constructed mutants were examined on solid YPG medium (YPG medium containing 20 g/liter agar buffered to pH 4.0, 7.0, and 10.0 with HCl or NaOH). Plates were inoculated with 10-μl drops containing 106 cells in water. Development of mycelia and chlamydospores was studied on fetal calf serum (Sigma) agar (50 ml/liter fetal calf serum, 10 g/liter agar; sterile filtered), rice extract agar (Difco, Detroit, MI), and Spider medium (22). The temperatures examined were 18, 30, 37, and 42°C.

Lipolytic activities were examined on solid Tween 20 and Tween 80 media, as well as in the supernatants of overnight cultures shaken in NuTRIflex solution at 180 rpm and 37°C. Activities were measured with a lipase assay using para-nitrophenyl palmitate (Sigma, St. Louis, MO) (51) and were related to the cell numbers, which were estimated at the end of the incubation period as described above.

Mouse infection models.

Intravenous infections were carried out by injecting 105 fungal cells into the tail vein of female BALB/c mice (age, 6 to 8 weeks) purchased from the National Cancer Institute, Frederick, MD. Animals were cared for in accordance with the guidelines of the institutional animal care and use committee of Albert Einstein College of Medicine of Yeshiva University. Numbers of CFU were determined for the liver and the kidneys after 3 and 7 days by plating on YPG agar. Additional mice were monitored for survival after infection.

BALB/c mice were inoculated intraperitoneally with 108 cells of Wt or mutant strains as described by Stehr et al. (42). Mice were sacrificed 24 or 72 h after infection, and the numbers of CFU in the kidneys and liver were determined by plating on YPG agar.

Statistical treatment of the data.

Murine experiments were powered for significance. All other experiments were performed in triplicate, and the results were expressed as means ± standard deviations. The survival curve significance was determined by a log rank test. The significance of differences between sets of data was determined by Student's t test or analysis of variance. For analysis of nonparametrically distributed data, the Kruskal-Wallis test was used.

RESULTS

Disruption of the LIP8 gene in C. albicans and molecular characterization of the Δlip8 mutants.

Both alleles of the LIP8 gene were successfully knocked out in C. albicans, and the mutant strains generated were examined by Southern blot hybridization and quantitative RT-PCR in order to demonstrate homologous integration and determine the expression level of the LIP8 gene. Figure 1 shows the results of a Southern blot analysis of a sequential series of heterozygous and homozygous LIP8 mutant strains. The resulting banding pattern indicates the success of the gene disruption process. Subsequently, we transformed a plasmid carrying the C. albicans URA3 gene into all mutants to reintroduce URA3 into its native locus.

FIG. 1.

FIG. 1.

(A) Southern blot analysis of the Δlip8 strains derived from C. albicans strain CAI-4. Bst1107I-digested genomic DNA of CAI-4 (lane 1), the LIP8/Δlip8 strain before FOA treatment (HeIbFOA) (lane 2), the LIP8/Δlip8 strain (HeI) (lane 3), the Δlip8/Δlip8 strain before FOA treatment (KoIbFOA) (lane 4), and Δlip8/Δlip8 KoI (lane 5) were used. Arrows indicate the Wt band, the alleles with the inserted disruption cassette (Wt plus hisG-URA3-hisG), and the alleles with the inserted hisG sequence after FOA treatment (Wt plus hisG). (B) Quantitative RT-PCR results for LIP8 expression normalized to the Wt for the heterozygous LIP8/Δlip8 strain (HeI), the homozygous Δlip8/Δlip8 strain (KoI), the retransformed heterozygous LIP8/Δlip8/LIP8 strain (ReI), the retransformed homozygous Δlip8/Δlip8/LIP8 strain (ReII), and the LIP8/LIP8/LIP8 OE mutant (OeI). The results are representative of three independent experiments.

The absence of LIP8 expression in the Δlip8/Δlip8 strains was demonstrated at the mRNA level by quantitative RT-PCR with primers LIP8a and LIP8b (Table 2), which have target sequences in the deleted region of the LIP8 gene. The expression was examined in YPG medium, in which LIP8 is constitutively expressed under normal conditions. The lack of the 521-bp band in the case of the isogenic, homozygous Δlip8 strain KoI indicated that there was successful disruption of the LIP8 gene (Fig. 1B).

Construction of C. albicans LIP8 reconstituted strains and mutants overexpressing the LIP8 gene.

The heterozygous and homozygous mutant strains were successfully retransformed with the pB44 vector. In contrast to the homozygous Δlip8/Δlip8 strain KoI, RT-PCR with primers LIP8a and LIP8b revealed that the reconstituted LIP8/Δlip8/LIP8 (ReI) and Δlip8/Δlip8/LIP8 (ReII) strains both expressed LIP8 (Fig. 1B). The same vector was used to construct mutants overexpressing LIP8. Our aim was to introduce a LIP8 ORF with the constitutive actin promoter into the RP10 locus of the ura3 auxotrophic strain CAI-4, resulting in a third copy of LIP8 in the genome. The heterozygous LIP8/Δlip8 mutant (HeI) and the reconstituted Δlip8/Δlip8/LIP8 strain (ReII) derived from the homozygous mutant strain showed somewhat lower expression of LIP8 than Wt strain SC5314, while the LIP8/LIP8/LIP8 OE mutant (OeI) had LIP8 transcript signals stronger than that of the Wt (Fig. 1B), indicating that the construct introduced into the genome was functional.

Phenotypic characterization of the C. albicans Δlip8 strains, reconstituted strains, and OE mutants. (i) Growth capabilities in liquid media.

Although the Δlip8/Δlip8 strain had a somewhat lower cell density in YPG medium (the absorbance at 595 nm [A595] was between 1.15 and 1.23 after 46 h of incubation) than the Wt strain (A595, 1.37), the results suggested that these strains had no significant differences in growth capabilities in complete media (P > 0.05). The results for the OE mutants were similar (data not shown). In YNB-Tween 40, the A595 values of the heterozygous and homozygous mutant strains were less than 80% of the A595 of the Wt (0.34) (P < 0.05) (Fig. 2A). The other lipid-rich medium, NuTRIflex, contains glucose, amino acids, different salts, and lipids (e.g., soy oil, triacylglycerols, egg lecithin, and sodium oleate) (pH 5 to 6). Growth of the LIP8-deficient strains stagnated after an initial increase in the cell number during the first 24 h of incubation (Fig. 2B). The cell concentrations of Δlip8/Δlip8 strains KoI and KoII reached only 37 and 40% of that of the Wt strain, respectively, after 48 h (P < 0.002) (Fig. 2B).

FIG. 2.

FIG. 2.

Growth curves for the Wt strain and mutant strains in lipid media. (A) A595 changes in YNB-Tween 40. (B) Cell numbers in NuTRIflex solution. The error bars indicate standard deviations.

(ii) Flocculation abilities.

The flocculation (cell-cell adhesion) abilities of CAI-2, as well as Δlip8 strains (HeI, HeII, KoI, and KoII), reconstituted strains (ReI and ReII), and an OE mutant (OeI), were tested after overnight growth in YPG medium at 37°C. The homozygous Δlip8 strains exhibited greater flocculation (Fig. 3A and B), while the flocculation abilities of the heterozygous Δlip8 strains, reconstituted strains, and OeI (data not shown) proved to be similar to that of the Wt.

FIG. 3.

FIG. 3.

Flocculation of C. albicans LIP8 mutants. Pictures were taken immediately (A) and 1 min (B) after vortexing of the cultures.

(iii) pH and temperature dependence on solid YPG medium.

LIP8 mutants and reconstituted strains of C. albicans were tested on solid YPG medium with different pH values (Fig. 4A, B, and C). The heterozygous (HeI) and homozygous (KoI) Δlip8 strains examined, as well as the reconstituted strain derived from the homozygous mutant (ReII), showed an altered, “rough” phenotype at pH 7.0 and 10.0 (Fig. 4B and C). Microscopic examination of the rough colonies revealed that they consisted mainly of mycelial cells. In contrast, the reconstituted strain derived from the heterozygous Δlip8 strain (ReI) and the OE mutant examined (OeI) showed the “smooth” phenotype of the Wt strain at all pH values examined (Fig. 4A, B, and C). The colonies of these strains consisted mainly of yeast cells.

FIG. 4.

FIG. 4.

Growth of the Wt strain, as well as its LIP8 mutants and reconstituted strains, on solid YPG medium at different pH values for 3 days and on Spider medium. (A) YPG medium (pH 4.0). (B) YPG medium (pH 7.0). (C) YPG medium (pH 10.0) (D) Colony morphology of the Wt and LIP8 mutants on Spider medium after incubation at 25°C for 3 days.

The influence of temperature on the growth of LIP8 mutants was examined at 18, 30, 37, and 42°C on solid YPG medium. The mutant colonies were smooth at 18°C, but the colonies became increasingly rough at ≥30°C (data not shown).

(iv) Development of mycelia and chlamydospores.

We examined whether the LIP8 mutants had any defect in the development of mycelia and chlamydospores. Different inducers of mycelial development have been reported, and serum is the most effective (9). No differences were noted for growth on agar containing serum between Wt or Δlip8 strains, reconstituted strains, and OE mutants (data not shown). However, phenotypic differences were seen when the strains were grown on Spider medium, an additional medium capable of mycelial induction (Fig. 4D) (22). Single colonies of all strains could be divided into two regions: central and outer radial growth. The reconstituted strain ReI and the OeI mutant produced intensive mycelial growth in the outer region. The central regions of the colonies of most strains were smooth; the exception was the colonies of the homozygous Δlip8 strain KoI, which exhibited a wrinkled phenotype in this region (Fig. 4D). Chlamydospore formation on rice agar occurred similarly in all strains (data not shown).

(v) Phenotype characteristics on S4D agar.

The colony morphologies of the LIP8 mutants and reconstituted strains were also studied on S4D agar supplemented with phloxine B. This is a special medium for detection of the temperature-inducible phenotype switching between the white and opaque forms of C. albicans WO-1 (1). The heterozygous and homozygous mutants examined, as well as the reconstituted strain derived from the homozygous mutant, were characterized by less dense, pinkish growth of the outer portion of the colony (Fig. 5). This region was only partially expressed by the reconstituted strain derived from the heterozygous mutant (ReI) and the OE mutant (OeI), for which increased mycelial growth and strongly expressed red sectors in the outer part of the colonies were noted (Fig. 5), which is an indication of the presence of opaque cells in the case of WO-1.

FIG. 5.

FIG. 5.

Colony morphology of the Wt strain and different LIP8 mutants on S4D agar. Arrowheads indicate “red” sectors.

(vi) Lipolytic activities of the LIP8 mutants.

The Wt strain and the mutants tested exhibited similar lipolytic activities, as demonstrated by obscured regions around the colonies on both Tween 20- and Tween 80-containing media (data not shown).

Secreted lipolytic activities were tested also in NuTRIflex lipid solution after 24 h of incubation at 37°C. The homozygous Δlip8/Δlip8 strains examined exhibited statistically significant reductions in lipolytic activities in this special medium (P < 0.005) (Fig. 6). The LIP8/LIP8/LIP8 OE mutant (OeI) produced lipolytic activity that was 1.2 times higher than that of the Wt strain.

FIG. 6.

FIG. 6.

Lipolytic activities of different LIP8 mutant strains compared to that of the Wt strain. The error bars indicate standard deviations. The asterisk indicates that the P value is <0.003 (analysis of variance test).

Analysis of the LIP8 mutants in mouse infection models: systemic infection.

In order to establish hematogenously disseminated candidiasis, mice were inoculated intravenously with Wt strain SC5314, CAI-2, or LIP8 mutants, and the fungal burden and survival were studied. For homozygous Δlip8/Δlip8 strain KoI there were significant reductions in the number of CFU in the liver and kidneys (P < 0.05) (Fig. 7). In fact, strain KoI could not be detected in the liver 3 days after infection (the threshold for detection was ≥102 CFU). The numbers of CFU of the heterozygous LIP8/Δlip8 strain (HeI) and the reconstituted strain derived from the homozygous Δlip8/Δlip8/LIP8 mutant strain (ReII) (not shown) were not significantly different from the Wt values. Figure 8 shows the mortality data. Whereas infections with other strains were lethal as early as 4 days after challenge, none of the mice inoculated with the KoI strain died during the examination period (P < 0.01). The highest mortality rate was recorded for OeI carrying three copies of the LIP8 gene (Fig. 8). Although the mice were monitored for 45 days, no additional deaths occurred in any group after day 20.

FIG. 7.

FIG. 7.

Intravenous infection of mice with different LIP8 mutants. (A) CFU in the kidneys 3 and 7 days after infection. (B) CFU in the liver 3 and 7 days after infection. All experiments were carried out with at least five animals per incubation period and per Candida strain examined. The error bars indicate standard deviations. An asterisk indicates that the P value is ≤0.02 (Kruskal-Wallis test).

FIG. 8.

FIG. 8.

Survival of mice monitored for a 20-day period after intravenous infection with different C. albicans strains. The asterisk indicates that the P value is 0.002 (log rank test).

To simulate peritonitis, BALB/c mice were inoculated intraperitoneally with either Wt strain SC5314, CAI-2, or LIP8 mutants. In this model, there were no differences in the numbers of CFU at the times analyzed (data not shown).

DISCUSSION

We constructed a set of C. albicans mutants carrying different copy numbers of the LIP8 genes. The heterozygous and homozygous Δlip8 strains showed decreased growth capabilities in the lipid-containing medium YNB-Tween 40, suggesting that the presence of both alleles is necessary for optimal growth in this medium and that the product of the gene might play an important role in digestion of lipids for nutrient acquisition. This is particularly important in the total parenteral nutrition setting (especially with intralipid administration), where the production of lipases would facilitate acquisition of nutrients by C. albicans (52). Notably, the growth capabilities of the Δlip8/Δlip8 strains were significantly decreased in NuTRIflex, which is a lipid-containing solution used for parenteral nutrition treatments that is prone to microbial contamination (8). Lip8p appears to be necessary for the optimal proliferation of C. albicans in lipid solutions, suggesting that this lipase may be important for stimulating growth in a lipid-rich environment. The LIP8 gene and the encoded enzyme might therefore be potential targets for inhibition of C. albicans proliferation in clinically utilized lipid emulsions.

In the case of Δlip8/Δlip8 strains, the expression of the rough phenotype became more pronounced with increasing temperature, whereas the phenotype of the OE mutants was similar to that of the Wt strain in the temperature range examined. Mycelium formation by the Δlip8/Δlip8 strains was induced at higher temperatures, as well as at neutral (pH 7.0) and basic (pH 10.0) pHs, while it was inhibited at lower temperatures and at an acidic pH (pH 4.0). The reconstituted strain derived from the homozygous mutant strain did not revert to the wild phenotype, while the reconstituted strain derived from the heterozygous strain did revert, suggesting that two intact LIP8 ORFs are necessary for complete reversion. However, this seems not to be the result of a gene dose effect, as both types of reconstituted strains produced higher lipolytic activities than the Wt in the NuTRIflex lipid solution. It is possible that synergistic activity of the two LIP8 alleles is needed for the wild phenotype. Furthermore, the possibility that the two alleles evolved differentially and have different functions cannot be excluded. There is evidence for such intrastrain allelic differences in C. albicans, such as the differences in the SAP2 alleles (40). This could explain why the heterozygous strains show a rough phenotype, in spite of the fact that they still carry an intact LIP8 allele. Uhl et al. (48) demonstrated that heterozygous mutants may be phenotypically different from the Wt using transposon mutagenesis to show that 146 genes that influence the yeast-to-hypha transition inadequately functioned when they were present in a single copy. The screen also revealed a possible lipase gene (LIP2 or LIP3), a transposon mutant of which resulted in diminished mycelium formation on Spider medium, suggesting that lipases might have an influence on the yeast-to-hypha transition (48). However, our LIP8 mutants proved to be similar to the Wt on Spider medium. Interestingly, OE mutants and the reconstituted strain derived from the heterozygous strain seemed to develop more mycelia at the edge of their colonies than the Wt, indicating that the presence of a third LIP8 ORF in the genome has a positive effect on mycelium formation on this medium. Similar to what was observed in Spider medium, the OE mutant and the reconstituted strain derived from the heterozygous mutant strain showed increased mycelium formation on S4D agar supplemented with phloxine B (1); furthermore, red sectors could also be observed, suggesting that the overexpression of LIP8 might have induced phenotypic switching. As a precedent, a mutant with a knockout mutation of the SIR2 (silent information regulator) gene also showed increased mycelium formation and an elevated frequency of phenotypic switching (31).

The observed phenotypic differences between the Wt and the LIP8/Δlip8/LIP8 strain (ReI), both of which carry two functional LIP8 ORFs, may be due to the fact that the reconstituted strains were constructed by introduction of the LIP8 ORF into the Δlip8 strains under the control of the constitutive actin promoter. The presence of the constitutive promoter in one of the LIP8 alleles of ReI may result in higher LIP8 expression levels as the reconstituted gene becomes constitutive and independent of the growth conditions.

LIP8 mutants had increased cell-cell adhesion, as demonstrated by flocculation. An aquaporin mutant of S. cerevisiae also showed increased flocculation ability (6). In the case of S. cerevisiae, cell flocculation in liquid medium is frequently associated with a rough colony phenotype on agar plates (14). This was also observed for the LIP8 mutants in the present study. It is known that the hyphal form is more hydrophobic than the yeast form (25, 34), and as discussed above, our LIP8 mutants exhibited more intense mycelium formation under certain conditions. Adhesion is conferred by specialized cell surface proteins called “adhesins” or “flocculins” that bind specific amino acid or sugar residues on the surface of other cells or promote binding to abiotic surfaces. In addition, the switch from nonadherent to adherent probably allows yeasts to adapt to stress (50). Flocculation, on the other hand, might protect the cells in the middle of an aggregate from environmental assaults. Apart from being a stress defense mechanism, adhesion is also crucial for fungal pathogenesis: fungi need to adhere to the appropriate host tissues in order to establish infections.

The diminished lipolytic activities of the Δlip8 strains in the NuTRIflex lipid solution were not due to the lack of a URA3 allele, as we reintroduced the URA3 gene into its original locus. OE mutant strains showed higher extracellular activities than the Wt, suggesting that more Lip8p was secreted into the medium.

The fungal cell wall is not affected by secreted lipolytic enzymes, as it consists of β-glucan (48 to 60%), mannoproteins (20 to 23%), proteins (2 to 3%), chitin (0.6 to 2.7%), and only about 2% lipids (44). Lipolytic catalysis could directly protect C. albicans via degradation of antimycotic fatty acids. Such an effect is known in the case of S. aureus, which produces a lipase that hydrolyzes the antibacterial lipids of the skin (46). Furthermore, the fatty acid-modifying enzyme of S. aureus (20) supports this function. Lipases may also play a role in directly attacking other, commensal microorganisms or could negatively affect the growth of competing microbes by changing the environment.

In the murine model of hematogenously disseminated candidiasis, C. albicans is capable of adhering to and penetrating endothelial cells of blood vessels, facilitating dissemination to diffuse organs, such as the kidneys and liver (5). Secreted lipases may play roles in the adhesion and penetration steps of this infection process. The homozygous Δlip8 strain tested could be found in the kidneys of mice in a lower number than the Wt. In this infection model, kidneys are the visceral organs most affected by the pathogen (5). Yet in our studies, the differences were even more pronounced in the liver: no liver CFU were detected at day 3 using the homozygous mutant strain. No mice died during the first 10 days after infection with the homozygous Δlip8/Δlip8 strain KoI, which clearly demonstrates that Lip8p is a virulence factor in hematogenously disseminated candidiasis. In contrast, all other strains resulted in 55 to 70% mortality, and their lethality corresponded to the number of CFU obtained. A correlation of higher mortality rates with higher numbers of CFU was similarly observed in studies on phospholipase as a virulence factor of C. albicans (17). However, survival experiments using larger inocula (2 × 105 CFU) showed that survival started to decrease even in the case of KoI after day 11 (data not shown), suggesting that the virulence defect was relatively minor. This may have been due to potential compensatory mechanisms of other members of the lipase gene family in the absence of LIP8.

In the case of intraperitoneal infection of mice, Candida cells have to penetrate tissue layers in order to reach the bloodstream. Although such infections did not result in CFU differences in the acute infection model, we did not exclude the possibility that variations may occur at a later stage of infection or, alternatively, that other members of the C. albicans lipase gene family may compensate for the lack of LIP8 expression.

The present study provides important data about the contribution of lipases to the pathogenesis of C. albicans by demonstrating that the product of the LIP8 gene is a virulence factor in candidiasis.

Acknowledgments

J.D.N. is supported in part by NIH grants AI52733 and AI056070-01A2, a Wyeth Vaccine Young Investigator Research Award from the Infectious Disease Society of America, and the Center for AIDS Research at the Albert Einstein College of Medicine and Montefiore Medical Center (NIH grant AI-51519). F.S. was supported by a Boehringer Ingelheim fellowship. L.K. is a grantee of the János Bolyai Research Scholarship (Hungarian Academy of Sciences).

Editor: A. Camilli

Footnotes

▿

Published ahead of print on 23 July 2007.

REFERENCES

  • 1.Anderson, J. M., and D. R. Soll. 1987. Unique phenotype of opaque cells in the white-opaque transition of Candida albicans. J. Bacteriol. 169:5579-5588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Boeke, J. D., F. LaCroute, and G. R. Fink. 1984. A positive selection for mutants lacking orotidine-5′-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197:345-346. [DOI] [PubMed] [Google Scholar]
  • 3.Bramono, K., M. Yamazaki, R. Tsuboi, and H. Ogawa. 2006. Comparison of proteinase, lipase and alpha-glucosidase activities from the clinical isolates of Candida species. Jpn. J. Infect. Dis. 59:73-76. [PubMed] [Google Scholar]
  • 4.Brockerhoff, H. 1974. Model of interaction of polar lipids, cholesterol, and proteins in biological membranes. Lipids 9:645-650. [DOI] [PubMed] [Google Scholar]
  • 5.Cannom, R. R., S. W. French, D. Johnston, J. E. Edwards, Jr., and S. G. Filler. 2002. Candida albicans stimulates local expression of leukocyte adhesion molecules and cytokines in vivo. J. Infect. Dis. 186:389-396. [DOI] [PubMed] [Google Scholar]
  • 6.Carbrey, J. M., M. Bonhivers, J. D. Boeke, and P. Agre. 2001. Aquaporins in Saccharomyces: characterization of a second functional water channel protein. Proc. Natl. Acad. Sci. USA 98:1000-1005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cutler, J. E. 1991. Putative virulence factors of Candida albicans. Annu. Rev. Microbiol. 45:187-218. [DOI] [PubMed] [Google Scholar]
  • 8.Deitel, M., V. M. Kaminsky, and M. Fuksa. 1975. Growth of common bacteria and Candida albicans in 10% soybean oil emulsion. Can. J. Surg. 18:531-535. [PubMed] [Google Scholar]
  • 9.Ernst, J. F. 2000. Regulation of dimorphism in Candida albicans. Contrib. Microbiol. 5:98-111. [DOI] [PubMed] [Google Scholar]
  • 10.Fonzi, W. A., and M. Y. Irwin. 1993. Isogenic strain construction and gene mapping in Candida albicans. Genetics 134:717-728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Fu, Y., A. S. Ibrahim, W. Fonzi, X. Zhou, C. F. Ramos, and M. A. Ghannoum. 1997. Cloning and characterization of a gene (LIP1) which encodes a lipase from the pathogenic yeast Candida albicans. Microbiology 143:331-340. [DOI] [PubMed] [Google Scholar]
  • 12.Gillum, A. M., E. Y. Tsay, and D. R. Kirsch. 1984. Isolation of the Candida albicans gene for orotidine-5′-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol. Gen. Genet. 198:179-182. [DOI] [PubMed] [Google Scholar]
  • 13.Gottlich, E., G. S. de Hoog, S. Yoshida, K. Takeo, K. Nishimura, and M. Miyaji. 1995. Cell-surface hydrophobicity and lipolysis as essential factors in human tinea nigra. Mycoses 38:489-494. [DOI] [PubMed] [Google Scholar]
  • 14.Hampsey, M. 1997. A review of phenotypes in Saccharomyces cerevisiae. Yeast 13:1099-1133. [DOI] [PubMed] [Google Scholar]
  • 15.Hube, B., and J. Naglik. 2001. Candida albicans proteinases: resolving the mystery of a gene family. Microbiology 147:1997-2005. [DOI] [PubMed] [Google Scholar]
  • 16.Hube, B., F. Stehr, M. Bossenz, A. Mazur, M. Kretschmar, and W. Schafer. 2000. Secreted lipases of Candida albicans: cloning, characterisation and expression analysis of a new gene family with at least ten members. Arch. Microbiol. 174:362-374. [DOI] [PubMed] [Google Scholar]
  • 17.Ibrahim, A. S., F. Mirbod, S. G. Filler, Y. Banno, G. T. Cole, Y. Kitajima, J. E. Edwards, Jr., Y. Nozawa, and M. A. Ghannoum. 1995. Evidence implicating phospholipase as a virulence factor of Candida albicans. Infect. Immun. 63:1993-1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Jaeger, K. E., F. J. Adrian, H. E. Meyer, R. E. Hancock, and U. K. Winkler. 1992. Extracellular lipase from Pseudomonas aeruginosa is an amphiphilic protein. Biochim. Biophys. Acta 1120:315-321. [DOI] [PubMed] [Google Scholar]
  • 19.Reference deleted.
  • 20.Kapral, F. A., S. Smith, and D. Lal.1992. The esterification of fatty acids by Staphylococcus aureus fatty acid modifying enzyme (FAME) and its inhibition by glycerides. J. Med. Microbiol. 37:235-237. [DOI] [PubMed] [Google Scholar]
  • 21.Leuker, C. E., A. M. Hahn, and J. F. Ernst. 1992. Beta-galactosidase of Kluyveromyces lactis (Lac4p) as reporter of gene expression in Candida albicans and C. tropicalis. Mol. Gen. Genet. 235:235-241. [DOI] [PubMed] [Google Scholar]
  • 22.Liu, H., J. Kohler, and G. R. Fink. 1994. Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog. Science 266:1723-1726. [DOI] [PubMed] [Google Scholar]
  • 23.Liu, H., C. A. Styles, and G. R. Fink. 1996. Saccharomyces cerevisiae S288C has a mutation in FLO8, a gene required for filamentous growth. Genetics 144:967-978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Longshaw, C. M., A. M. Farrell, J. D. Wright, and K. T. Holland. 2000. Identification of a second lipase gene, gehD, in Staphylococcus epidermidis: comparison of sequence with those of other staphylococcal lipases. Microbiology 146:1419-1427. [DOI] [PubMed] [Google Scholar]
  • 25.Lopez-Ribot, J. L., M. Casanova, J. P. Martinez, and R. Sentandreu. 1991. Characterization of cell wall proteins of yeast and hydrophobic mycelial cells of Candida albicans. Infect. Immun. 59:2324-2332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Miskin, J. E., A. M. Farrell, W. J. Cunliffe, and K. T. Holland. 1997. Propionibacterium acnes, a resident of lipid-rich human skin, produces a 33 kDa extracellular lipase encoded by gehA. Microbiology 143:1745-1755. [DOI] [PubMed] [Google Scholar]
  • 27.Monod, M., and Z. M. Borg-von. 2002. Secreted aspartic proteases as virulence factors of Candida species. Biol. Chem. 383:1087-1093. [DOI] [PubMed] [Google Scholar]
  • 28.Murad, A. M., P. R. Lee, I. D. Broadbent, C. J. Barelle, and A. J. Brown. 2000. CIp10, an efficient and convenient integrating vector for Candida albicans. Yeast 16:325-327. [DOI] [PubMed] [Google Scholar]
  • 29.Naglik, J. R., G. Newport, T. C. White, L. L. Fernandes-Naglik, J. S. Greenspan, D. Greenspan, S. P. Sweet, S. J. Challacombe, and N. Agabian. 1999. In vivo analysis of secreted aspartyl proteinase expression in human oral candidiasis. Infect. Immun. 67:2482-2490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Park, H., C. L. Myers, D. C. Sheppard, Q. T. Phan, A. A. Sanchez, E. J. Edwards, and S. G. Filler. 2005. Role of the fungal Ras-protein kinase A pathway in governing epithelial cell interactions during oropharyngeal candidiasis. Cell. Microbiol. 7:499-510. [DOI] [PubMed] [Google Scholar]
  • 31.Perez-Martin, J., J. A. Uria, and A. D. Johnson. 1999. Phenotypic switching in Candida albicans is controlled by a SIR2 gene. EMBO J. 18:2580-2592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Pfaller, M. A., R. N. Jones, S. A. Messer, M. B. Edmond, and R. P. Wenzel. 1998. National surveillance of nosocomial blood stream infection due to Candida albicans: frequency of occurrence and antifungal susceptibility in the SCOPE Program. Diagn. Microbiol. Infect. Dis. 31:327-332. [DOI] [PubMed] [Google Scholar]
  • 33.Ran, Y., T. Yoshiike, and H. Ogawa. 1993. Lipase of Malassezia furfur: some properties and their relationship to cell growth. J. Med. Vet. Mycol. 31:77-85. [DOI] [PubMed] [Google Scholar]
  • 34.Rodrigues, A. G., P. A. Mardh, C. Pina-Vaz, J. Martinez-de-Oliveira, and A. F. Fonseca. 1999. Germ tube formation changes surface hydrophobicity of Candida cells. Infect. Dis. Obstet. Gynecol. 7:222-226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Roustan, J. L., A. R. Chu, G. Moulin, and F. Bigey. 2005. A novel lipase/acyltransferase from the yeast Candida albicans: expression and characterisation of the recombinant enzyme. Appl. Microbiol. Biotechnol. 68:203-212. [DOI] [PubMed] [Google Scholar]
  • 36.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • 37.Schaller, M., C. Borelli, H. C. Korting, and B. Hube. 2005. Hydrolytic enzymes as virulence factors of Candida albicans. Mycoses 48:365-377. [DOI] [PubMed] [Google Scholar]
  • 38.Schaller, M., H. C. Korting, W. Schafer, J. Bastert, W. Chen, and B. Hube. 1999. Secreted aspartic proteinase (Sap) activity contributes to tissue damage in a model of human oral candidosis. Mol. Microbiol. 34:169-180. [DOI] [PubMed] [Google Scholar]
  • 39.Schofield, D. A., C. Westwater, T. Warner, and E. Balish. 2005. Differential Candida albicans lipase gene expression during alimentary tract colonization and infection. FEMS Microbiol. Lett. 244:359-365. [DOI] [PubMed] [Google Scholar]
  • 40.Staib, P., M. Kretschmar, T. Nichterlein, H. Hof, and J. Morschhauser. 2002. Host versus in vitro signals and intrastrain allelic differences in the expression of a Candida albicans virulence gene. Mol. Microbiol. 44:1351-1366. [DOI] [PubMed] [Google Scholar]
  • 41.Staib, P., M. Kretschmar, T. Nichterlein, H. Hof, and J. Morschhauser. 2002. Transcriptional regulators Cph1p and Efg1p mediate activation of the Candida albicans virulence gene SAP5 during infection. Infect. Immun. 70:921-927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Stehr, F., A. Felk, A. Gacser, M. Kretschmar, B. Mahnss, K. Neuber, B. Hube, and W. Schafer. 2004. Expression analysis of the Candida albicans lipase gene family during experimental infections and in patient samples. FEMS Yeast Res. 4:401-408. [DOI] [PubMed] [Google Scholar]
  • 43.Stehr, F., A. Felk, M. Kretschmar, M. Schaller, W. Schafer, and B. Hube. 2000. Extracellular hydrolytic enzymes and their relevance during Candida albicans infections. Mycoses 43(Suppl. 2):17-21. (In German.) [PubMed] [Google Scholar]
  • 44.Sullivan, P. A., C. Y. Yin, C. Molloy, M. D. Templeton, and M. G. Shepherd. 1983. An analysis of the metabolism and cell wall composition of Candida albicans during germ-tube formation. Can. J. Microbiol. 29:1514-1525. [DOI] [PubMed] [Google Scholar]
  • 45.Taylor, B. N., P. Staib, A. Binder, A. Biesemeier, M. Sehnal, M. Rollinghoff, J. Morschhauser, and K. Schroppel. 2005. Profile of Candida albicans-secreted aspartic proteinase elicited during vaginal infection. Infect. Immun. 73:1828-1835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Tirunarayanan, M. O., and H. Lundbeck. 1968. Investigations on the enzymes and toxins of staphylococci. Assay of lipase using Tween as the substrate. Acta Pathol. Microbiol. Scand. 72:263-276. [DOI] [PubMed] [Google Scholar]
  • 47.Tyski, S., S. Tylewska, W. Hryniewicz, and J. Jeljaszewicz. 1987. Induction of human neutrophils chemotaxis by staphylococcal lipase. Zentbl. Bakteriol. Mikrobiol. Hyg. 265:360-368. [DOI] [PubMed] [Google Scholar]
  • 48.Uhl, M. A., M. Biery, N. Craig, and A. D. Johnson. 2003. Haploinsufficiency-based large-scale forward genetic analysis of filamentous growth in the diploid human fungal pathogen C. albicans. EMBO J. 22:2668-2678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Uhl, M. A., and A. D. Johnson. 2001. Development of Streptococcus thermophilus lacZ as a reporter gene for Candida albicans. Microbiology 147:1189-1195. [DOI] [PubMed] [Google Scholar]
  • 50.Verstrepen, K. J., and F. M. Klis. 2006. Flocculation, adhesion and biofilm formation in yeasts. Mol. Microbiol. 60:5-15. [DOI] [PubMed] [Google Scholar]
  • 51.Voigt, C. A., W. Schafer, and S. Salomon. 2005. A secreted lipase of Fusarium graminearum is a virulence factor required for infection of cereals. Plant J. 42:364-375. [DOI] [PubMed] [Google Scholar]
  • 52.Wanten, G. J., M. G. Netea, T. H. Naber, J. H. Curfs, L. E. Jacobs, T. J. Verver-Jansen, and B. J. Kullberg. 2002. Parenteral administration of medium-but not long-chain lipid emulsions may increase the risk for infections by Candida albicans. Infect. Immun. 70:6471-6474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Werner, H. 1965. Untersuchungen über die Lipaseaktivität bei Hefen und hefeähnlichen Pilzen. Zentrbl. Bakteriol. Mikrobiol. Hyg. 22:113-124. [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES