Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2007 Jul 20;189(18):6655–6664. doi: 10.1128/JB.00717-07

Investigation of Transcription Repression and Small-Molecule Responsiveness by TetR-Like Transcription Factors Using a Heterologous Escherichia coli-Based Assay▿

Sang Kyun Ahn 1, Kapil Tahlan 1, Zhou Yu 2, Justin Nodwell 1,*
PMCID: PMC2045172  PMID: 17644591

Abstract

The SCO7222 protein and ActR are two of ∼150 TetR-like transcription factors encoded in the Streptomyces coelicolor genome. Using bioluminescence as a readout, we have developed Escherichia coli-based biosensors that accurately report the regulatory activity of these proteins and used it to investigate their interactions with DNA and small-molecule ligands. We found that the SCO7222 protein and ActR repress the expression of their putative target genes, SCO7223 and actII-ORF2 (actA), respectively, by interacting with operator sequence in the promoters. The operators recognized by the two proteins are related such that O7223 (an operator for SCO7223) could be bound by both the SCO7222 protein and ActR with similar affinities. In contrast, Oact (an operator for actII-ORF2) was bound tightly by ActR and more weakly by the SCO7222 protein. We demonstrated ligand specificity of these proteins by showing that while TetR (but not ActR or the SCO7222 protein) interacts with tetracyclines, ActR (but not TetR or the SCO7222 protein) interacts with actinorhodin and related molecules. Through operator-targeted mutagenesis, we found that at least two nucleotide changes in O7223 were required to disrupt its interaction with SCO7222 protein, while ActR was more sensitive to changes on Oact. Most importantly, we found that the interaction of each protein with wild-type and mutant operator sequences in vivo and in vitro correlated perfectly. Our data suggest that E. coli-based biosensors of this type should be broadly applicable to TetR-like transcription factors.


Three mechanisms commonly confer resistance to the antibiotic tetracycline: antibiotic degradation by TetX-like enzymes (31), ribosome protection by TetO-like proteins (7, 23), and, most frequently, antibiotic export by TetA-like efflux pumps (30). Many of the genes encoding these resistance determinants are under the direct control of repressor proteins referred to as the TetR-like transcription factors. Like most repressors, these proteins bind operator sequences in their target promoters preventing transcription initiation by RNA polymerase holoenzyme. A smaller number of TetR-like proteins have been implicated in transcriptional activation (6, 11).

TetR, the best-characterized member of this family, controls the expression of the efflux pump-encoding gene tetA in the transposon Tn10 (reviewed in reference 13). The tetR and tetA genes are divergently transcribed and separated by ∼80 bp of DNA that includes their promoters. The TetR protein binds tightly to two nearly identical 15-bp palindromic operator sequences (Otet) to interfere with transcription of both genes. When tetracycline enters the cell, it binds the C-terminal ligand-binding domain in TetR as a complex with Mg2+, causing its release from Otet (19, 25, 26). This relieves repression, permitting the expression of tetA and the export of the antibiotic out of the cell (16).

Genes encoding TetR-like transcription factors are common in bacterial genomes (reviewed in reference 20). For example, the filamentous antibiotic-producing bacterium Streptomyces coelicolor encodes at least 150 TetR-like transcription factors. It is noteworthy that many of these are closely linked (either as divergently transcribed genes or in operons) to genes that encode proteins similar to TetA-like efflux pumps and TetX-like monooxygenases. It is striking therefore, that relatively low concentrations of tetracycline (1 μg/ml) can impair this organism's growth (21). This constitutes considerable sensitivity given that 30 μg/ml is required to inhibit the growth of resistant Escherichia coli strains (1), and it suggests that the TetR-like transcription factors control many physiological processes unrelated to tetracycline. Only a few of the S. coelicolor TetR-like proteins have been linked to specific processes: ActR regulates export of the polyketide actinorhodin (3, 8, 24), Pip controls a putative multidrug resistance gene (10), PqrA controls a paraquat efflux pump (5), CprA and CprB may interact with γ-butyrolactones (17, 18), and ScbR controls production of the γ-butyrolactone SCB1 (27).

All of the TetR-like transcription factors that have been studied in molecular detail interact with small-molecule ligands that are chemically related or identical to the substrates of the proteins encoded by their target genes. TetR binds tetracycline (15), ActR interacts with actinorhodin and actinorhodin biosynthetic intermediates (24), and QacR binds various cationic lipophilic drugs (12). It is our view, therefore, that identification of the small-molecule ligands that interact with the C-terminal regulatory domains of TetR-like proteins of unknown function is a powerful means of deciphering their roles as well as those of the genes they control.

To facilitate this endeavor, we have developed a biosensor mechanism that we believe can be applied to many members of this family (24). The biosensors are based on synthetic promoters consisting of −10 and −35 promoter elements, separated by a putative binding site for a TetR-like transcription factor. These promoters are cloned upstream of the luxCDABE operon of Photorhabdus luminescens. LuxA and -B encode a luciferase enzyme, while LuxC, -D, and -E form a fatty aldehyde reductase complex that provides the luciferase substrate (29). The gene encoding the cognate TetR-like transcription factor is cloned into a second plasmid such that cells containing the lux plasmid are spontaneously bioluminescent while those containing both are not, due to repression of the synthetic promoter by the repressor. We showed previously with biosensors of this type based on TetR and ActR that bioluminescence could be induced by tetracycline and by actinorhodin and some of its biosynthetic intermediates, respectively (24).

In this study, we have explored the utility of this biosensor mechanism in greater depth, focusing on ActR, and the uncharacterized TetR-like SCO7222 protein. Based on the tetR/tetA paradigm, the target of the SCO7222 protein is predicted to be the divergently transcribed gene SCO7223, which encodes a probable TetX-like monooxygenase. We show that the SCO7222 protein interacts with palindromic sequences in the SCO7222/7223 intergenic sequence. These sequences are related to those bound by ActR, and indeed the two proteins exhibit considerable affinities for each other's operators, though we do not believe that these heterologous interactions are biologically relevant. SCO7222 protein does not respond to the ligands recognized by either ActR or TetR. Mutagenesis of the binding sites for the SCO7222 protein and ActR revealed that the two proteins recognize distinct nucleotides and, most importantly, that there is a perfect correlation between the in vivo and in vitro DNA-protein interactions. We suggest, therefore, that this biosensor mechanism is likely to be broadly applicable to the TetR-like proteins.

MATERIALS AND METHODS

Bacterial strains, plasmids, culture conditions, and bioluminescence measurements.

Bacterial strains and plasmids used in this study are described in Table 1. E. coli cultures were grown using Luria broth (LB) or LB agar medium containing the appropriate antibiotics when required (22). Streptomyces cultures were grown at 30°C in YEME broth or maintained on solid MS agar medium (14). Isolated E. coli colonies were used to inoculate 1-ml amounts of reporter cultures, which were grown for 16 to 20 h before measurement of luminescence using a Lumat 9507 luminometer (Bertholt Technologies). In some cases, E. coli reporter cultures were supplemented with spent Streptomyces culture supernatant (prepared as described in reference 24) or with purified tetracyclines. The half-maximal concentrations of various tetracyclines required for induction were determined using a standard sigmoidal dose-response regression equation: y = bottom + (top − bottom)/(1 + 10(EC50 − x) · hill slope), where bottom (ymin) was set to 1, as data were normalized using signal/noise ratios, and where EC50 represents the 50% effective concentration.

TABLE 1.

Bacterial strains and plasmids used in this work

Strain or plasmid Description (selection marker) Background Source or reference
Strains
    E. coli
        BL21(DE3) F−dcm ompT hsdS(rB− mB−) gal met λ(DE3) Novagen
        DH5α F′/endA1 hsdR17(rK− mK+) glnV44 thi-1 recA1 gyrA (Nalr) relA1 Δ(lacIZYA-argF)U169 deoR [80dlac (lacZ) M15] Stratagene
        XL1-Blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac[F′ proAB lacIqZΔM15 Tn10 (Tetr)] Stratagene
    Streptomyces
        M145 S. coelicolor prototroph, SCP1− SCP2− J. Innes
        84/25 S. aureofaciens tetracycline-producing strain J. Kormanec
Plasmids
    pCS26-Pac Promoterless luxCDABE reporter (Kanr) pSC101 2
    pOtetlux Reporter based on tetA operator (Kanr) pCS26-Pac 24
    pOactlux Reporter based on actII-ORF2 operator (Kanr) pCS26-Pac 24
    pO7223lux Reporter based on SCO7223 operator (Kanr) pCS26-Pac This work
    pMAlux Reporter based on actII-ORF2 operator with random mutations (Kanr) pCS26-Pac This work
    pMTlux Reporter based on SCO7223 operator with random mutations (Kanr) pCS26-Pac This work
    pACYC184 Plasmid required for repressor expression vector constructions; Cmr gene from Tn9 and Tcr gene from pSC101 (Cmr Tcr) p15A 4
    pTetR tetR gene in pACYC184; TetR-expressing vector (Cmr) pACYC184 24
    pActR actII-ORF1 (actR) gene in pACYC184; ActR-expressing vector (Cmr) pACYC184 24
    pSCO7222 SCO7222 gene in pACYC184; SCO7222 protein-expressing vector (Cmr) pACYC184 This work
    pUOA1 Plasmid required to provide tetracycline resistance for DH5α-based strains; Tcr gene from pUA466 (Tcr Apr) pUC8 28
    pBS7222 SCO7222 gene in pBluescript to provide repressor gene flanked by BamHI and NdeI restriction sites for pTO7222 construction (Apr) pBluescript SK II+ This work
    pET28a-ActR ActR-overexpressing vector for protein purification pET28a 24
    pTO7222 SCO7222-overexpressing vector for protein purification (Kanr) pET28a This work

a Kanr, kanamycin resistance; Cmr, chloramphenicol resistance; Tcr, tetracycline resistance; Apr, ampicillin resistance.

Procedures for DNA manipulation.

Standard procedures were used for plasmid DNA isolation, manipulation, and analysis (22). Oligonucleotide primers used in this study were obtained from the Institute for Molecular Biology and Biotechnology (MOBIX) facility at McMaster University or from Sigma. PCRs were carried out using Vent DNA polymerase (New England Biolabs) with the following program: 95°C for 5 min followed by 30 cycles of 95°C and 55°C (30 s each), followed by 72°C (30 or 60 s, depending on the length of a template), with a final extension step at 72°C for 7 min. DNA sequencing was carried out by the MOBIX facility to select/isolate the appropriate PCR products.

Construction of lux-based reporter plasmids and expression vectors for the TetR, ActR, and SCO7222 protein biosensors.

pOtetlux and pOactlux were constructed previously (24). Similarly, a DNA fragment containing a synthetic promoter—consisting of SCO7223 operator (O7223) flanked by the −35 and −10 regions from the Tn10 tetA promoter—was prepared by annealing T7223-1 and T7223-2 oligonucleotides (Fig. 1B and Table 2). These oligonucleotides were introduced into the BamHI-XhoI sites of pCS26-Pac to give reporter plasmid pO7223lux, in which the expression of the lux operon was under the control of the SCO7222 protein (Table 1).

FIG. 1.

FIG. 1.

Putative binding sites for ActR and the SCO7222 protein. (A) Repeated elements in the actR/actA (modified from reference 24) and SCO7222/SCO7223 intergenic regions are shown. Between actR and actA, there are three weakly palindromic sequences (underlined) that exhibit a low degree of conservation. Between SCO7222 and SCO7223 there are three 15-bp repeats that are perfectly palindromic and highly conserved. Arrows indicate repeated sequence (actR/actA) and palindromes (SCO7222/SCO7223). (B) Sequence of the synthetic promoter used in the pO7223lux. The DNA fragment contained −35 and −10 regions from the Tn10 tetA promoter, flanking O7223. Arrows indicate the palindromic nucleotides in O7223 and Otet.

TABLE 2.

Primers used in this study

Name Sequence (5′→3′)a Purpose
T7223-1 TCGAGTTGACACTGGAACGCCGTTCCAGTTATTTTACCA Positive-strand oligonucleotide for preparing O7223-based promoter
T7223-2 GATCTGGTAAAATAACTGGAACGGCGTTCCAGTGTCAAC Negative-strand oligonucleotide for preparing the O7223-based promoter
7222-1 TAAGAAGGAGAGGAGCACATGGCATCCAGGTCGC Forward primer for amplifying SCO7222 gene for pSCO7222 construction
7222-2 GGGCATGGATCCAGTGACCCATGCAACTTGGG Reverse primer for amplifying SCO7222 gene for pSCO7222 construction
TOEV-1 GGCATATGGCATCCAGGT Forward primer for amplifying SCO7222 gene from pSCO7222 for pBS7222 construction
TOEV-2 GGATCCTACCGGCCGGGC Reverse primer for amplifying SCO7222 gene from pSCO7222 for pBS7222 construction
7223IR-1 CGCTCATCCTAGACCGCTTGG Forward primer for amplifying intergenic region between SCO7222 and SCO7223
7223IR-2 GGTGCTTCCCTCCTGATGGCG Reverse primer for amplifying intergenic region between SCO7222 and SCO7223
ActIR-1 GTGCTCCTCATCGTATGGCATGAACG Forward primer for amplifying intergenic region between actR and actA
ActIR-2 GGCGTCCCCCGGGTCCTC Reverse primer for amplifying intergenic region between actR and actA
a

Compatible cohesive ends and restriction endonuclease recognition sequences introduced by these oligonucleotides are underlined.

Two expression vectors, pTetR and pActR (encoding TetR and ActR, respectively) were previously prepared (24). In parallel, the primer pair 7222-1/7222-2 (Table 2) along with S. coelicolor M145 chromosomal DNA (as template) was used to PCR amplify DNA fragments containing SCO7222. Gel-purified PCR product was then digested with BamHI and ligated to BamHI-EcoRV-treated pACYC184 to give pSCO7222, which served as the source of the SCO7222 protein in the biosensors.

Operator mutagenesis.

Double-stranded DNA products, obtained by annealing the imperfectly matched primers TA3 and TA2 and T7223-3 and T7223-2, were inserted into the BamHI-EcoRV sites of pCS26-Pac to give pMAlux (TA3-TA2) and pMTlux (T7223-3-T7223-2), respectively. TA3 and T7223-3 are identical to TA1 and T7223-1, respectively, except that the operator sequences had been doped during synthesis as follows. At each operator position, while the concentration of the correct nucleotide was as usual during synthesis, the other three nucleotides were also present, as defined by x/3n, where x represents the concentration of principle nucleotide and n represents the length of the operator sequence. The result of this is that each mutagenic oligonucleotide would be expected to possess at least one nucleotide sequence change in the operator region, embedded in an otherwise “wild-type” synthetic promoter. In both cases, we mutagenized the top strands shown in Fig. 1B. The plasmids pMAlux and pMTlux were introduced into E. coli strains containing pActR or pSCO7222, respectively, to isolate colonies that produced luminescence, indicating that the respective repressors could not bind to the mutagenized operators. Plasmid DNA was isolated from these strains and reintroduced into E. coli to isolate kanamycin-resistant and chloramphenicol-sensitive colonies, which had lost pActR or pSCO7222 but still contained pMAlux or pMTlux. The DNA sequences of the operators cloned in pMAlux and pMTlux were determined for further analysis.

Expression and purification of His6-ActR and His6-SCO7222 protein.

Previously prepared pET28a-ActR was used to express and purify N-terminal six-His-tagged ActR (His6-ActR) in E. coli (24). The primers TOEV-1 and TOEV-2 (Table 2), along with pSCO7222 plasmid DNA (as template), were used to PCR amplify a 721-bp fragment containing SCO7222, which was introduced into the EcoRV site of pBlueScript SK II+ to give pBS7222. After sequencing SCO7222, the DNA fragment encoding SCO7222 protein was isolated as an NdeI-BamHI fragment from pBS7222 and was ligated to pET28a, giving pTO7222 (Table 1).

E. coli BL21(DE3) cultures containing pTO7222 were grown at 37°C to an optical density at 600 nm of ∼0.4 to 0.6 and were then induced with 1 mM isopropyl β-d-thiogalactopyranoside for 20 h at 30°C. From this point, the same procedures were taken to purify His6-ActR and His6-SCO7222 (24).

EMSAs.

The primers TET-EMSA-F and TET-EMSA-R (24), along with pOactlux, pO7223lux, or the reporter plasmids with point-mutagenized operators (as templates), were used in PCRs to isolate double stranded DNA fragments containing operator regions, which served as probes for electrophoretic mobility shift assays (EMSAs). The DNA fragments were end labeled using [γ-32P]ATP and T4 polynucleotide kinase (22).

Labeled probe (12.7 fmol), 1.5 to 3,200 fmol of purified protein and 90 ng of salmon sperm DNA were used in 15-μl reactions containing 1× reaction buffer (10 mM Tris-Cl [pH 7.8], 150 mM NaCl, 2 mM dithiothreitol, 10% glycerol). Reaction mixtures were incubated at 30°C for 10 min and were fractionated on 12% nondenaturing polyacrylamide gels containing 1.5% glycerol. The gels were exposed using a phosphor screen (Amersham), and bands were detected using a PhosphorImager (Molecular Dynamics).

Determination of KD.

ImageQuant software (Molecular Dynamics) was used to analyze EMSA results to determine the percentages of shifted and unshifted probes, which represent bound and unbound substrate, respectively. Saturation curves (% probe bound against [protein]) were drawn with SigmaPlot 2000 to determine the dissociation constant (KD). Binding cooperativity was determined by Hill's equation: log (Y/1 − Y) = h log[S] − log KD, where Y = protein-DNA complex/total DNA, S is the protein of interest, and KD is the dissociation constant of protein binding to DNA (9). The slope of a straight line passing the point where 50% DNA binding occurs, is the Hill's coefficient (h) and indicates the binding cooperativity.

RESULTS AND DISCUSSION

Construction of biosensors using TetR, ActR, and the SCO7222 protein.

Given the TetR paradigm, we predicted that the likely target of the SCO7222 protein would be SCO7223. Examination of the 110 bp that separates these genes revealed the sequences N1, N2, and N3 (Fig. 1A) corresponding to likely binding sites for the SCO7222 protein. All of these sequences exhibit significant similarity to the nearly perfect palindrome having the consensus sequence C/TTGGAACGNCGTTCCAG/C. This is similar to the intergenic DNA of actR and actA that includes the putative ActR-binding sequences P1, P2 (Oact), and P3. We carried out gel mobility shift assays using both intergenic fragments and purified His6-SCO7222 and His6-ActR. As shown in Fig. 2, both fragments formed three exceptionally tight complexes with their cognate repressors, consistent with the presence of three repressor binding sites in each. We determined approximate KDs for each of the SCO7222 protein complexes and found them to be 0.4 nM, 3.4 nM, and 17.3 nM for the L, M, and H complexes, respectively. A Hill plot of this data demonstrates a Hill's coefficient of 1.6, consistent with positive cooperative binding of the SCO7222 protein (Hill's coefficient of >1) to its three binding sites. The interaction of ActR with the actR/actA intergenic sequence was also characterized by strong binding (KDs of 0.1 nM, 0.3 nM, and 5.8 nM), but with a Hill's coefficient of ∼1 (data not shown), there was no evidence of cooperativity.

FIG. 2.

FIG. 2.

Interactions of the SCO7222 protein and ActR with intergenic sequences. (A) A 32P-labeled probe containing the entire SCO7222/SCO7223 or actR/actA intergenic DNA (IR) sequences was incubated with the indicated concentrations of the SCO7222 protein or ActR at 30°C for 10 min and then separated in 12% nondenaturing polyacrylamide gels. Three distinguishable shifts, L (lower shift), M (middle shift), and H (higher shift), were observed in both cases. (B to D) The KD value of each SCO7222 protein shift was determined by plotting the percentage of bound DNA against the concentration of the SCO7222 protein. (E) Hill's plot was drawn to measure binding cooperativity by the SCO7222 protein.

As previously, we designed synthetic promoters in which each of the N1, N2, and N3 sequences was introduced between functional E. coli −10 and −35 promoter elements and introduced them upstream of luxCDABE operon in the vector pCS26-Pac (2). The resulting plasmids pN1lux, pN2lux, and pO7223lux were introduced into E. coli along with the previously constructed pOtetlux and pOactlux, and all conferred significant bioluminescence compared to promoterless reporter vector pCS26-Pac (Table 3). Similarly, we constructed an SCO7222 protein-producing plasmid by amplifying the gene with oligonucleotides that included a Shine-Dalgarno sequence upstream of the initiator codon and a BamHI site at the downstream end. This fragment was ligated downstream of a tetA promoter in the vector pACYC184 to create the plasmid pSCO7222. We introduced pTetR, pActR, pSCO7222, and the control pACYC184 into the E. coli strains bearing pOtetlux, pOactlux, pN1lux, pN2lux, and pO7223lux and tested each strain for bioluminescence. As previously reported, the pTetR and pActR eliminated pOtetlux- and pOactlux-dependent bioluminescence, respectively, while the control plasmid pACYC184 had no effect (24). Similarly, pSCO7222 eliminated the bioluminescence produced by pN1lux, pN2lux, and pO7223lux (Table 3), confirming direct binding as observed in vitro. The in vivo function of these three sites agrees with the mobility shift demonstrating three complexes between the SCO7222 protein and the SCO7222/SCO7223 intergenic sequence. This suggested that the SCO7222 protein is a repressor of SCO7223, and we focused the rest of our work on N3, which we refer to O7223. These results underscore the fact that in those cases (which are common) in which a tetR-like gene is paired with a putative target gene in a manner similar to the well-characterized tetR/tetA configuration, repeated palindromic sites in the intergenic sequences can be assumed to be candidate binding sites for the TetR-like protein.

TABLE 3.

Effects of TetR/ActR/SCO7222 on various reporter plasmids

Plasmid(s)a Bioluminescence (RLU)b Error (±1 SD)
pCS26-Pac 318 26
pN1lux 2.19 × 105 3.9 × 104
pN1lux + pACYC184 1.21 × 105 3.4 × 104
pN1lux + pSCO7222 187 27
pN2lux 1.09 × 104 2.0 × 103
pN2lux + pACYC184 1.25 × 104 1.0 × 103
pN2lux + pSCO7222 271 87
pO7223lux 8.87 × 104 2.7 × 103
pO7223lux + pACYC184 5.70 × 104 5.8 × 103
pO7223lux + pSCO7222 262 19
pO7223lux + pTetR 8.22 × 104 1.1 × 104
pO7223lux + pActR 360 57
pOactlux + pACYC184 3.01 × 104 2.4 × 103
pOactlux + pSCO7222 1.86 × 104 2.4 × 103
a

Analysis was carried out using E. coli XL1-Blue as the host.

b

All values are in relative light units (RLU) and represent the average of at least three independent readings.

We noted that the putative operators recognized by ActR (ACGCGACCACCGTTCCAT) and the SCO7222 protein (CTGGAACGACGTTCCAG) were similar, particularly in their right half-sites. To determine whether either repressor could bind the other's operator, we combined pActR with pO7223lux biosensor and pSCO7222 with pOactlux biosensor. We observed strong repression of pO7223lux-dependent bioluminescence by pActR (to background) and partial repression of pOactlux-dependent bioluminescence (∼1.5-fold) by pSCO7222 (Table 3).

Effects of various ligands on TetR, ActR, and the SCO7222 protein.

To determine whether tetracycline could relieve repression by SCO7222 protein, we introduced plasmid pUAO1, bearing the tetO gene from Campylobacter jejuni (28), into each biosensor strain to protect them against the antibiotic. The TetO gene product is a ribosomal protection protein that allows relatively high cytoplasmic concentrations of the antibiotic to be tolerated without substantial damage to the cells. The addition of pUAO1 had no major impact, although it slowed bacterial growth to ∼1 doubling per hour.

To determine whether the resulting strains could detect tetracycline, we cultured each of them in the presence of various concentrations of the drug (Fig. 3A). As discussed previously, we observed the dose-responsive induction of bioluminescence in the TetR biosensor that peaked when 4 μg/ml tetracycline was used (24). Higher concentrations of drug inhibited cell growth, in spite of the presence of the tetO gene, but even at levels where there was significant inhibition of growth, we could still detect bioluminescence in the TetR biosensor. Consistent with previous results, tetracycline did not induce bioluminescence in the ActR biosensor (24). The presence of tetracycline also did not relieve repression by SCO7222 protein. Similar analysis was conducted using various concentrations of demeclocycline, doxycycline, oxytetracycline, chlortetracycline, and methatetracycline, all antibiotics related in structure and mechanism to tetracycline. While the concentrations required for half-maximal induction varied (Table 4), all of the tetracycline derivatives analyzed were good inducers of the TetR biosensor (data not shown). Again, none of these molecules had any effect on the ActR-based (24) or the SCO7222 protein-based strain (data not shown) biosensors. We then applied culture supernatants from Streptomyces aureofaciens (a tetracycline producer) and S. coelicolor to all three biosensors to determine whether either streptomycete produced secondary metabolites that could interact with the SCO7222 protein. As demonstrated previously, the S. aureofaciens and S. coelicolor supernatants were able to activate bioluminescence in the TetR- and ActR-based biosensors, respectively. Neither, however, had any effect on the SCO7222 protein-based biosensor (Fig. 3B). Under the growth conditions we have employed in this work, therefore, neither strain produces an SCO7222 protein ligand, although it is possible that there was some inducing molecule in the S. coelicolor supernatant that could not cross the E. coli envelope.

FIG. 3.

FIG. 3.

Effect of purified tetracycline (A) or S. coelicolor supernatant (B) on TetR-, ActR-, and SCO7222 protein-mediated repression. (A) One to 5 μg of pure tetracycline was added to E. coli biosensors harboring pUOA1 and either pOtetlux, pOactlux, or pO7223lux along with the vector expressing the cognate repressors, respectively. (B) Ten to 40% (vol/vol) S. coelicolor supernatant was added to the same biosensor strains described above. All values were measured in relative light units (RLU), and error bars indicate ±1 standard deviation of values obtained from three independent readings.

TABLE 4.

Induction of TetR-controlled gene expression by various tetracyclinesa

Antibiotic Concn (μg/ml) for half-maximum inductionb R2
Chlortetracycline 1.0 0.98
Demeclocycline 0.18 0.63
Doxycycline 0.18 0.84
Methatetracycline 0.42 0.97
Oxytetracycline 0.47 0.86
Tetracycline 0.85 0.87
a

Plasmids were cultivated in E. coli strain DH5α.

b

Arbitrary light units were calculated from at least three independent readings.

Mutagenesis of operator sequences.

Unlike pCS26-Pac, which is a low-copy-number plasmid, pACYC184 is propagated at a moderately high copy number in E. coli: ∼20 copies per cell (4). As a result, the TetR-like transcription factors in our biosensors are probably in excess of their targets, potentially impairing small-molecule induction and explaining the observed ActR-SCO7222 protein cross talk. To provide a basis for comparing the in vivo interactions of the repressors and operators with their biochemical affinities, we constructed mutants of Oact and O7223 using two strategies. In the first, we subjected each operator sequence to randomization and screened for nonfunctional operators that exhibited bioluminescence in the presence of their cognate repressors (see Materials and Methods). We screened ∼1,600 colonies (∼800 for each repressor) and isolated 16 Oact sequences impaired in their interaction with ActR and 18 O7223 sequences impaired in their interaction with the SCO7222 protein (Table 5).

TABLE 5.

Sequences of O7223 and Oact mutants not recognized by the SCO7223 protein and ActRa

Mutant Sequence
O7223 CTGGAACGCCGTTCCAG
    pMTlux1 --------ΔN-------
    pMTlux2 -----T-------G---
    pMTlux3 -----T--------A--
    pMTlux4 ----CG---G-------
    pMTlux5 ----T--------T---
    pMTlux6 --------ΔN-----G-
    pMTlux7 ----ΔN-----------
    pMTlux8 --C----------G---
    pMTlux9 --ΔN----G--------
    pMTlux10 ---------------T-
    pMTlux11 ----G---A--G-----
    pMTlux12 -C--------CA--A--
    pMTlux13 ----GG--A--------
    pMTlux14 ----C------C-----
    pMTlux15 -------T-----G---
    pMTlux16 ----G---------A--
    pMTlux17 --C--T-T--CCA----
    pMTlux18 ----G-----C------
Oact CGCGACCACCGTTCCAC
    pMAlux1 A----------C--A--
    pMAlux2 -A-----T--------T
    pMAlux3 -----T-------T---
    pMAlux4 -----G-GG-------G
    pMAlux5 -----G-----A-----
    pMAlux6 A--------A-------
    pMAlux7 --A-------C------
    pMAlux8 ----G---G-CC-----
    pMAlux9 -------G-A-------
    pMAlux10 ----------CC-----
    pMAlux11 -AA-------CC-----
    pMAlux12 -A----------GT---
    pMAlux13 -----------CA----
    pMAlux14 -------G--C------
    pMAlux15 --G--------C-G---
    pMAlux16 --AT-------C-----
a

Only nucleotides found to be different from those present at the same position in the wild-type operator sequences are shown. Δ, nucleotide deleted; N, not applicable as either this nucleotide or the previous one has been deleted in the same operator sequence analyzed.

Interestingly, all but one (pMTlux10) of the repressor-resistant alleles exhibited multiple mutations, suggesting either that the high in vivo concentration of the repressor resulted in DNA binding that was relatively resistant to mutation or that the affinity of each repressor for its cognate operator was simply very high due to a large number of specific repressor-operator interactions. In Oact, many of the alleles were altered at position 8 or 11, while in O7223, many alleles had mutations at position 5, 14, or 15 (positions 14 and 15 were two nucleotides more frequently involved in O7223 double mutants [Table 5]). In our second strategy, therefore, we subjected these base pairs to site-directed mutagenesis. We generated the alleles OactA8G, OactG11C, O7223A5G, O7223C14G, and O7223C15A and assessed each for repression by their cognate repressors. Position 5 of Oact (OactA5G) was also tested since it is one of the palindromic nucleotides in the operator. As shown in Table 6, while the point mutation at position 8 of Oact had no effect, those at positions 5 and 11 eliminated in vivo repression by ActR. None of the point mutations in O7223 altered repression of bioluminescence in vivo.

TABLE 6.

Summary of in vivo and in vitro assay results with the SCO7222 protein

Operator Sequencea Repressionb
KD (nM) for SCO7222 protein
SCO7222 protein ActR
Oact related
    Oact CGCGACCACCGTTCCAC N Y 30
    OactA8G -------G--------- N Y 23
    OactG11C ----------C------ N N NAc
    OactA5G ----G------------ N N 15
O7223 related
    O7223 CTGGAACGCCGTTCCAG Y Y 2
    O7223A5G ----G------------ Y N 2
    O7223C14G -------------G--- Y Y 2
    O7223C15A --------------A-- Y N 2
a

For point mutants, only the specific nucleotide changes made are shown.

b

Y, strong repression; N, either no or weak repression (less than fivefold reduction).

c

Not applicable as no shift was observed even at the highest concentration of protein tested.

We also assessed the effects of each point mutation on cross-repression by ActR and the SCO7222 protein and found that the results were quite different. For example, O7223A5G and O7223C15A, which had no effect on repression by the SCO7222 protein, eliminated cross-repression by ActR. Clearly, therefore, while the operator sequences are similar, the manners in which they are recognized by the two proteins in the context of our biosensors are subtly different.

Correlation of binding strengths with in vivo repression.

To assess the significance of these results, we measured the affinities of the SCO7222 protein and ActR for O7223 and Oact and for the relevant point mutants described above. Using purified His6-SCO7222 and His6-ActR, we carried out gel mobility shift experiments with radioactively labeled probes corresponding to each operator sequence. The interaction of both proteins with their cognate operators was exceptionally strong (Fig. 4). Figure 4A shows gel mobility shift results and saturation curves for the SCO7222 protein. Consistent with the fact that the SCO7222 protein caused complete inhibition of transcription on O7223 but not on Oact in vivo, KDs for these interactions were ∼2 nM for O7223 and ∼30 nM for Oact. Even though the affinity of the SCO7222 protein for Oact was much lower than that for O7223, binding at higher concentrations explains the consistent weak repression this protein brought about on the Oact-regulated promoter in vivo (Table 3). Figure 4B shows mobility shift results for ActR. ActR could bind to O7223 as efficiently as Oact, in agreement with the capacity of this protein to repress both Oact- and O7223-regulated transcription in vivo (Table 3). Unlike the SCO7222 protein, ActR produced two shifted bands with both Oact and O7223, raising the possibility that two ActR dimers interact with each site. Protein titration and Hill plot analysis did not indicate significant cooperativity in the assembly of these complexes (data not shown).

FIG. 4.

FIG. 4.

Characterization of interactions between ActR or SCO7222 protein and Oact or O7223. A 12.7-fmol amount of 32P-labeled probes was incubated with 1.5 to 210 nM protein at 30°C for 10 min and then separated in 12% nondenaturing polyacrylamide gels. Interactions shown on the gels are between the SCO7222 protein and O7223/Oact (A), ActR and O7223/Oact (B), and SCO7222 protein/ActR and O7223A5G (C). CP, protein-DNA complex. KDs were determined by drawing the saturation curves and obtaining [SCO7222 protein] at half-maximal saturation.

We went on to assess the effect of each point mutation in Oact and O7223 on the affinities of these DNAs for ActR and the SCO7222 protein and found a nearly perfect correlation between in vitro binding and in vivo repression (Fig. 4C and Table 6). For example, in E. coli, the SCO7222 protein repressed bioluminescence from the O7223A5G operator, but ActR did not. Consistent with this, the SCO7222 protein bound to O7223A5G with a similar affinity to O7223, while much higher concentrations of ActR were required to form a complex with O7223A5G compared to either Oact or O7223 (Fig. 4C). In summary, the KDs of the SCO7222 protein for the three mutant operators it was able to repress in vivo (O7223A5G, O7223C14G, and O7223C15A) were all in the 2 to 3 nM range, whereas its KDs for those operators it could not repress in vivo were at least five times higher, and in one case, OactG11C, we observed no interaction at all.

This work raises interesting questions about possible cross talk between these two repressors. In our view, it is unlikely that the interaction of these proteins with heterologous operators is biologically meaningful. SCO7222 and -7223 are located far outside the act gene cluster, which contains most, if not all, of the genes necessary for actinorhodin biosynthesis and self-resistance. How might cross talk be avoided between these two and perhaps other members of this very large gene family in vivo? One possibility is that coupled transcription and translation, which is a characteristic of all bacteria, results in the direct delivery of a TetR protein from the ribosome on which it is synthesized to its cognate operator. This would be consistent with the fact that the repressor-encoding genes tend to be closely linked to their target genes. If, as is the case for TetR, ActR and the SCO7222 protein regulate their own production as well as that of their target resistance genes, they would limit their own intracellular accumulation and hence minimize or eliminate cross talk. Temporal and spatial regulations might also be responsible for restricting the cross talk.

More importantly for our immediate purposes, the high degree of correlation between in vitro binding and in vivo repression and the fact that we were able to specifically detect several tetracyclines as pure molecules and from a natural source suggest that this biosensor mechanism is a valuable tool for investigating TetR-like transcription factors.

Acknowledgments

We thank Michael Surette and Gerard Wright for supplying pCS26-Pac and for sharing various tetracyclines, respectively. We also thank Eric Brown, John Capone, and Gerard Wright for use of their laboratory equipment.

K.T. was supported by a postdoctoral fellowship from the Natural Science and Engineering Research Council. This work was funded by grant MOP-57684 from the Canadian Institutes for Health Research.

Footnotes

▿

Published ahead of print on 20 July 2007.

REFERENCES

  • 1.Bannam, T. L., and J. I. Rood. 1999. Identification of structural and functional domains of the tetracycline efflux protein TetA(P) from Clostridium perfringens. Microbiology 145:2947-2955. [DOI] [PubMed] [Google Scholar]
  • 2.Bjarnason, J., C. M. Southward, and M. G. Surette. 2003. Genomic profiling of iron-responsive genes in Salmonella enterica serovar Typhimurium by high-throughput screening of a random promoter library. J. Bacteriol. 185:4973-4982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Caballero, J. L., F. Malpartida, and D. A. Hopwood. 1991. Transcriptional organization and regulation of an antibiotic export complex in the producing Streptomyces culture. Mol. Gen. Genet. 228:372-380. [DOI] [PubMed] [Google Scholar]
  • 4.Chang, A. C. Y., and S. N. Cohen. 1978. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacteriol. 134:1141-1156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Cho, Y.-H., E.-J. Kim, H.-J. Chung, J.-H. Choi, K. F. Chater, B.-E. Ahn, J.-H. Shin, and J.-H. Roe. 2003. The pqrAB operon is responsible for paraquat resistance in Streptomyces coelicolor. J. Bacteriol. 185:6756-6763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Christen, S., A. Srinivas, P. Bahler, A. Zeller, D. Pridmore, C. Bieniossek, U. Baumann, and B. Erni. 2006. Regulation of the Dha operon of Lactococcus lactis: a deviation from the rule followed by the TetR family of transcription regulators. J. Biol. Chem. 281:23129-23137. [DOI] [PubMed] [Google Scholar]
  • 7.Connell, S. R., C. A. Trieber, G. P. Dinos, E. Einfeldt, D. E. Taylor, and K. H. Nierhaus. 2003. Mechanism of Tet(O)-mediated tetracycline resistance. EMBO J. 22:945-953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Fernandez-Moreno, M. A., J. L. Caballero, D. A. Hopwood, and F. Malpartida. 1991. The act cluster contains regulatory and antibiotic export genes, direct targets for translational control by the bldA tRNA gene of Streptomyces. Cell 66:769-780. [DOI] [PubMed] [Google Scholar]
  • 9.Fersht, A. 1985. Enzyme structure and mechanism, 2nd ed. W. H. Freeman and Company, New York, NY.
  • 10.Folcher, M., R. P. Morris, G. Dale, K. Salah-Bey-Hocini, P. H. Viollier, and C. J. Thompson. 2001. A transcriptional regulator of a pristinamycin resistance gene in Streptomyces coelicolor. J. Biol. Chem. 276:1479-1485. [DOI] [PubMed] [Google Scholar]
  • 11.Girard, G., S. Barends, S. Rigali, E. Tjeerd van Rij, B. J. J. Lugtenberg, and G. V. Bloemberg. 2006. Pip, a novel activator of phenazine biosynthesis in Pseudomonas chlororaphis PCL1391. J. Bacteriol. 188:8283-8293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Grkovic, S., M. H. Brown, N. J. Roberts, I. T. Paulsen, and R. A. Skurray. 1998. QacR is a repressor protein that regulates expression of the Staphylococcus aureus multidrug efflux pump QacA. J. Biol. Chem. 273:18665-18673. [DOI] [PubMed] [Google Scholar]
  • 13.Hillen, W., and C. Berens. 1994. Mechanisms underlying expression of Tn10 encoded tetracycline resistance. Annu. Rev. Microbiol. 48:345-369. [DOI] [PubMed] [Google Scholar]
  • 14.Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000. Practical Streptomyces genetics. The John Innes Foundation, Norwich, England.
  • 15.Kisker, C., W. Hinrichs, K. Tovar, W. Hillen, and W. Saenger. 1995. The complex formed between Tet repressor and tetracycline-Mg2+ reveals mechanism of antibiotic resistance. J. Mol. Biol. 247:240-280. [DOI] [PubMed] [Google Scholar]
  • 16.McMurry, L., R. E. Petrucci, Jr., and S. B. Levy. 1980. Active efflux of tetracycline encoded by four genetically different tetracycline resistance determinants in Escherichia coli. Proc. Natl. Acad. Sci. USA 77:3974-3977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Natsume, R., Y. Ohnishi, T. Senda, and S. Horinouchi. 2004. Crystal structure of a gamma-butyrolactone autoregulator receptor protein in Streptomyces coelicolor A3(2). J. Mol. Biol. 336:409-419. [DOI] [PubMed] [Google Scholar]
  • 18.Onaka, H., T. Nakagawa, and S. Horinouchi. 1998. Involvement of two A-factor receptor homologues in Streptomyces coelicolor A3(2) in the regulation of secondary metabolism and morphogenesis. Mol. Microbiol. 28:743-753. [DOI] [PubMed] [Google Scholar]
  • 19.Orth, P., W. Saenger, and W. Hinrichs. 1999. Tetracycline-chelated Mg2+ ion initiates helix unwinding in Tet repressor induction. Biochemistry 38:191-198. [DOI] [PubMed] [Google Scholar]
  • 20.Ramos, J. L., M. Martinez-Bueno, A. J. Molina-Henares, W. Terán, K. Watanabe, X. Zhang, M. T. Gallegos, R. Brennan, and R. Tobes. 2005. The TetR family of transcriptional repressors. Microbiol. Mol. Biol. Rev. 69:326-356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Rodriguez-Garcia, A., P. Combes, R. Perez-Redondo, M. C. Smith, and M. C. Smith. 2005. Natural and synthetic tetracycline-inducible promoters for use in the antibiotic-producing bacteria Streptomyces. Nucleic Acids Res. 33:e87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • 23.Sougakoff, W., B. Papadopoulou, P. Nordmann, and P. Courvalin. 1987. Nucleotide sequence and distribution of the gene tetO encoding tetracycline resistance in Campylobacter coli. FEMS Microbiol. Lett. 44:153-159. [Google Scholar]
  • 24.Tahlan, K., S. K. Ahn, A. Sing, T. D. Bodnaruk, A. R. Willems, A. R. Davidson, and J. R. Nodwell. 2007. Initiation of actinorhodin export in Streptomyces coelicolor. Mol. Microbiol. 63:951-961. [DOI] [PubMed] [Google Scholar]
  • 25.Takahashi, M., L. Altschmied, and W. Hillen. 1986. Kinetic and equilibrium characterization of the Tet repressor-tetracycline complex by fluorescence measurements. Evidence for divalent metal ion requirement and energy transfer. J. Mol. Biol. 187:341-348. [DOI] [PubMed] [Google Scholar]
  • 26.Takahashi, M., J. Degenkolb, and W. Hillen. 1991. Determination of the equilibrium association constant between Tet repressor and tetracycline at limiting Mg2+ concentrations: a generally applicable method for effector-dependent high-affinity complexes. Anal. Biochem. 199:197-202. [DOI] [PubMed] [Google Scholar]
  • 27.Takano, E., R. Chakraburtty, T. Nihira, Y. Yamada, and M. J. Bibb. 2001. A complex role for the gamma-butyrolactone SCB1 in regulating antibiotic production in Streptomyces coelicolor A3(2). Mol. Microbiol. 41:1015-1028. [DOI] [PubMed] [Google Scholar]
  • 28.Taylor, D. E., K. Hiratsuka, H. Ray, and E. K. Manavathu. 1987. Characterization and expression of a cloned tetracycline resistance determinant from Campylobacter jejuni plasmid pUA466. J. Bacteriol. 169:2984-2989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Winson, M. K., S. Swift, P. J. Hill, C. M. Sims, G. Griesmayr, B. W. Bycroft, P. Williams, and G. S. Stewart. 1998. Engineering the luxCDABE genes from Photorhabdus luminescens to provide a bioluminescent reporter for constitutive and promoter probe plasmids and mini-Tn5 constructs. FEMS Microbiol. Lett. 163:193-202. [DOI] [PubMed] [Google Scholar]
  • 30.Yamaguchi, A., T. Udagawa, and T. Sawai. 1990. Transport of divalent cations with tetracycline as mediated by the transposon Tn10-encoded tetracycline resistance protein. J. Biol. Chem. 265:4809-4813. [PubMed] [Google Scholar]
  • 31.Yang, W., I. F. Moore, K. P. Koteva, D. C. Bareich, D. W. Hughes, and G. D. Wright. 2004. TetX is a flavin-dependent monooxygenase conferring resistance to tetracycline antibiotics. J. Biol. Chem. 279:52346-52352. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES