Influence of Hepatitis B Virus X and Core Promoter Mutations on Hepatocellular Carcinoma among Patients Infected with Subgenotype C2

Abstract

Hepatitis B virus (HBV) genotypes/subgenotypes and their related mutations in the HBV genome have been reported to be associated with hepatocellular carcinoma (HCC). To determine the HCC-associated mutations of the HBV genome in the entire X, core promoter, and precore/core regions, a cross-sectional control study was conducted comparing 80 Japanese patients infected with HBV C2 and suffering from HCC with 80 age-, sex-, and hepatitis B e antigen (HBeAg) status-matched patients without HCC (non-HCC group). Each HBeAg-positive group (31 with HCC; 29 without HCC) and HBeAg-negative group (49 with HCC; 51 without HCC) was also matched with respect to age and sex. The C1479, T1485, H1499, A1613, T1653, V1753, T1762/A1764, and A1896 mutations were frequent in this population. The prevalences of the T1653 mutation in the box α region and the V1753 and T1762/A1764 mutations in the basal core promoter region were significantly higher in the HCC group than in the non-HCC group (56% versus 30%, 50% versus 24%, and 91% versus 73% [P = 0.0013, P = 0.0010, and P = 0.0035, respectively]). The platelet count was significantly lower for the HCC group than for the non-HCC group (10.7 × 10⁴ ± 5.1 × 10⁴ versus 17.3 × 10⁴ ± 5.1 × 10⁴ platelets/mm³ [P < 0.0001]). Regardless of HBeAg status, the prevalence of the T1653 mutation was higher in the HCC group (52% versus 24% [P = 0.036] for HBeAg-positive patients and 59% versus 33% [P = 0.029] for HBeAg-negative patients). In the multivariate analysis, the presence of T1653, the presence of V1753, and a platelet count of ≤10 × 10⁴/mm³ were independent predictive factors for HCC (odds ratios [95% confidence intervals], 4.37 [1.53 to 12.48], 7.98 [2.54 to 25.10], and 24.39 [8.11 to 73.33], respectively). Regardless of HBeAg status, the T1653 mutation increases the risk of HCC in Japanese patients with HBV/C2.

Hepatocellular carcinoma (HCC) is the fifth most frequent cancer and the third leading cause of cancer-related death in the world, with an estimated prevalence of >500,000 cases worldwide per year (36). It is accepted that hepatitis B virus (HBV) has carcinogenic potential in humans. HBV has been classified into eight major genotypes (A to H) by using the complete nucleotide sequence of the viral genome (34). HBV genotypes have distinct geographical distributions and correlate with the severity of liver disease (17, 18). Genotypes B and C are prevalent in Asia, and genotype C causes more-serious liver disease than genotype B (5, 35). There are two subtypes (subgenotypes) of genotype B with distinct geographical distributions, provisionally designated Ba (“a” stands for Asia) and Bj (“j” stands for Japan) (43), and clinical differences between patients infected with HBV/Ba and HBV/Bj are becoming clear (1, 42). Recently, a phylogenetic analysis revealed two major groups within genotype C: one for strains from Southeast Asia, including Vietnam, Myanmar, Thailand, and Hong Kong (named HBV/C1), and another for strains from (Far) East Asia, including Japan and China (named HBV/C2) (6, 12, 47). Chan et al. (6) designated the two subgenotypes HBV/Cs, for Southeast Asia, and HBV/Ce, for (Far) East Asia; they not only have different geographic distributions but also different nucleotide sequences in the precore region (6, 47).

Several mutations in the HBV genome have been reported to occur during the course of persistent viral infection, and there has been increasing evidence of an association between molecular alteration and the development of HCC in patients with HBV infection. Mutations in the basal core promoter (BCP) region at nucleotides (nt) 1762 and 1764 (T1762/A1764) and in the precore region at nt 1896 (A1896) are associated with HBV e antigen (HBeAg) seroconversion and persistent viral replication. It is noteworthy that both BCP and precore mutations are often found in patients with advanced liver disease (e.g., HCC) (2, 3, 16, 19, 23, 25, 38). The T1762/A1764 mutations alter HBeAg production at the transcriptional level, and the A1896 mutation in the precore region terminates the translation of precursor protein, abrogates HBeAg production, and results in seroconversion. The T1653 mutation in the box α region has been reported to increase the risk of HCC in HBeAg-negative patients infected with HBV/C (14, 44). As well, specific mutations in the enhancer II/core promoter of HBV were differently associated with HCC in the context of HBeAg status among HBV/C1/Cs and HBV/C2/Ce carriers (46). There have been many studies involving viral mutations associated with clinical features, but most previous studies have either ignored age, sex, HBeAg status, and HBV genotype/subgenotype or have examined relatively short regions.

Here we performed a cross-sectional control study of 160 age-, sex-, and HBeAg status-matched Japanese patients infected with HBV/C2 to determine the HCC-associated mutations of the HBV genome in the entire X, core promoter, and precore plus core regions.

MATERIALS AND METHODS

Serum samples.

A total of 160 serum samples were obtained from chronic HBV C2/Ce carriers who visited the Nagoya City University Hospital, Musashino Red Cross Hospital, or National Hospital Organization Nagasaki Medical Center in Japan. Of these, 140 samples were newly obtained and 20 samples were previously used (14). The study protocol conformed to the 1975 Declaration of Helsinki and was approved by the ethics committees of the institutions listed above, and informed consent was obtained from each carrier. None of the patients had a history of hepatitis C virus coinfection. In Japan, because a main transmission route of HBV is vertical, the duration of HBsAg carriage of all or most patients would correspond with their age. Hassan et al. reported that heavy alcohol consumption (>80 g ethanol per day) contributes to the majority of HCC cases (10). Heavy drinking is less prevalent in Japan; 3 of 80 patients with HCC are heavy alcohol drinkers, and 2 of 80 patients without HCC are heavy alcohol drinkers, indicating that no significant difference in heavy alcohol consumption was found in this population.

Serological assays for HBV markers.

HBeAg and anti-HBe were detected by a chemiluminescent enzyme immunoassay (Lumipulse f; FUJIREBIO Inc., Tokyo, Japan).

Amplification and sequencing of the entire X, core promoter, and precore plus core regions.

Nucleic acids were extracted from 100 μl of serum using a QIAamp DNA blood minikit (QIAGEN Inc., Hilden, Germany). HBV genes (665 bp) of the entire X, core promoter, precore, and core regions were amplified by PCR with heminested primers. The first-round PCR was performed with sense primer HBX1360F (TACACCTCCTTYCCATGGCTGCT) and antisense primer HB7R-2. The second-round PCR was performed with two sets of sense primers and antisense primers. One set comprised HBX1360 (sense) and Ia1 (antisense), and the second set comprised HB7F-2 (sense) and HB7R-2 (antisense) (Table 1). Thereafter, the PCR products were sequenced directly with a Prism BigDye Terminator cycle sequencing kit (Applied Biosystems) using an ABI 3100 DNA automated sequencer (Applied Biosystems). The sequences covered the entire X region, the enhancer II/core promoter (Fig. 1), and the precore genes, which are associated with HBeAg production, viral replication, and disease progression.

TABLE 1.

Positions and sequences of primers used for PCR amplification and sequencing

Name	Nucleotide sequence (5′ to 3′)	Positions (nt)	Polarity
HBx1360F	TACACCTCCTTYCCATGGCTGCT	1360-1383	Sense
HB7R-2	CCTGAGTGCTGTATGGTGAGG	2062-2072	Antisense
HB6R	AACAGACCAATTTATGCCTA	1803-1784	Antisense
HB7F-2	CATGGAGACCACCGTGAACGC	1607-1627	Sense

FIG. 1.

C1653T, T1753V (where V stands for “not T”), and A1762T/G1764A mutations in the X region, including the enhancer II/core promoter region.

Case-control study.

According to the Gut guidelines for diagnosis of HCC (39), 80 patients received a diagnosis of HCC on the basis of results of abdominal ultrasonography, angiography, computerized tomography, or magnetic resonance imaging, as well as elevated serum α-fetoprotein levels (≥400 ng/ml). We did pathological examinations of 25 of 80 patients with HCC. For a case-control study on age-, sex-, and HBeAg status-matched subjects, another 80 patients without HCC were compared. Among the non-HCC group, 24 patients were asymptomatic carriers and 56 had chronic hepatitis.

Statistical evaluation.

Data were expressed as means ± standard deviations (SD). Statistical analyses were performed using a χ² test and Fisher's exact test for categorical variables and Mann-Whitney's U test or one-way analysis of variance for continuous variables, as appropriate. In multivariate analysis, we used 40 U of alanine aminotransferase (ALT)/liter as the cutoff. An HBV DNA level of 5 log genome equivalents (LGE)/ml and a platelet count of 10 × 10⁴/mm³ were assessed as cutoff values, because these were used as predictors for disease progression (13, 21, 26-28, 30). Multivariate analysis with logistic regression was used to determine the independent factors associated with HCC. Differences were considered significant for P values less than 0.05. The statistical analysis software used was Stata software, version 8.0 (Stata Corp.).

Nucleotide sequence accession numbers.

The sequences reported in this paper have been deposited in the GenBank/DDBJ/EMBL databases (accession numbers AB307808 to AB307967).

RESULTS

When we examined HBV DNA sequences in the entire X region as well as the enhancer II/core promoter and precore regions, C1479, T1485, H1499, A1613, T1653, V1753, T1762/A1764, and A1896 mutations were frequent in our population. Table 2 compares ALT levels, HBV DNA levels, and platelet counts, as well as mutations in the X region, box α (enhancer II), the core promoter (Fig. 1), and the precore region, among 80 patients with HCC (HCC group) and 80 patients without HCC (non-HCC group), matched for age, sex, and HBeAg status, in a case-control study. The platelet count was significantly lower for the HCC group than for the non-HCC group (10.7 × 10⁴ ± 5.1 × 10⁴ versus 17.3 × 10⁴ ± 5.1 × 10⁴ platelets/mm³; P < 0.0001). The frequencies of the T1653 mutation in the box α region and the V1753 and T1762/A1764 mutations in the BCP region were significantly higher for the HCC group than for the non-HCC group (56% versus 30%, 50% versus 24%, and 91% versus 73%; P = 0.0013, P = 0.0010, and P = 0.0035, respectively). No other significant mutations were observed in this study. Table 3 compares ALT levels and HBV DNA levels, as well as mutations in the X region, box α (enhancer II), the core promoter, and the precore region, among 60 HBeAg-positive patients (29 non-HCC and 31 HCC) matched for age and sex in a case-control study. Among HBeAg-positive patients, the platelet count was significantly lower for the HCC group than for the non-HCC group (10.6 × 10⁴ ± 6.0 × 10⁴ versus 13.5 × 10⁴ ± 5.3 × 10⁴ platelets/mm³; P = 0.0062). The frequency of the T1653 mutation in the box α region was significantly higher for the HCC group than for the non-HCC group (52% versus 24%; P = 0.036) (Table 3). Among 100 HBeAg-negative patients (51 non-HCC and 49 HCC) matched for age and sex in a case-control study, the platelet count was significantly lower for the HCC group than for the non-HCC group (11 × 10⁴ ± 4.5 × 10⁴ versus 19 × 10⁴ ± 3.5 × 10⁴ platelets/mm³; P < 0.0001), and the frequencies of the T1653 mutation in the box α region and the V1753 and T1762/A1764 mutations in the BCP region were significantly higher for the HCC group than for the non-HCC group (59% versus 33%, 61% versus 27%, and 90% versus 69%; P = 0.016, P = 0.0012, and P < 0.0001, respectively) (Table 4).

TABLE 2.

Clinical and virologic characteristics of patients infected with HBV subgenotype C2/Ce who were matched for age, sex, and HBeAg status

Variable	Value for group		P
	Non-HCC (n = 80)	HCC (n = 80)
Mean age (yr) ± SD	54 ± 8	55 ± 8	Matched
No. (%) of male patients	67 (84)	68 (85)	Matched
No. (%) of HBeAg-positive patients	29 (36)	31 (39)	Matched
ALT level (mean U/liter ± SD)	66 ± 99	85 ± 133	0.31
HBV DNA level (mean LGE/ml ± SD)	5.7 ± 1.7	5.7 ± 1.4	0.84
Mean platelet count (104/mm3) ± SD	17.3 ± 5.1	10.7 ± 5.1	<0.0001
No. (%) of patients with a mutation in the X region
T1479C (T to P at aa 36)	39 (49)	45 (56)	0.43
C1485T (P to S at aa 38)	18 (22)	22 (28)	0.58
G1499H	57 (71)	46 (58)	0.10
G1613A	25 (31)	32 (40)	0.32
C1653T (in box α)	24 (30)	45 (56)	0.0013
T1753V (in the core promoter)	19 (24)	40 (50)	0.0010
A1762T/G1764A (in the core promoter)	58 (73)	73 (91)	0.0035
No. (%) of patients with the G1896A mutation in the precore region	41 (51)	43 (54)	0.8743

TABLE 3.

Clinical and virologic characteristics of patients infected with HBV subgenotype C2/Ce who were matched for age and were positive for HBeAg

Variable	Value for HBeAg-positive group		P
	Non-HCC (n = 29)	HCC (n = 31)
Mean age (yr) ± SD	53 ± 8	53 ± 7	Matched
No. (%) of male patients	21 (72)	23 (74)	Matched
No. (%) of HBeAg-positive patients	29 (100)	31 (100)	Matched
ALT level (mean U/liter ± SD)	99 ± 128	98 ± 190	0.98
HBV DNA level (mean LGE/ml ± SD)	6.8 ± 1.4	6.4 ± 1.0	0.20
Mean platelet count (104/mm3) ± SD	13.5 ± 5.3	10.6 ± 6.0	0.0062
No. (%) of patients with a mutation in the X region
T1479C (T to P at aa 36)	13 (45)	14 (45)	>0.9999
C1485T (P to S at aa 38)	6 (21)	5 (16)	0.74
G1499H	25 (86)	20 (65)	0.075
G1613A	8 (28)	11 (35)	0.59
C1653T (in box α)	7 (24)	16 (52)	0.036
T1753V (in the core promoter)	5 (17)	10 (32)	0.24
A1762T/G1764A (in the core promoter)	23 (79)	29 (94)	0.14
No. (%) of patients with the G1896A mutation in the precore region	6 (21)	9 (51)	0.56

TABLE 4.

Clinical and virologic characteristics of patients infected with HBV subgenotype C2/Ce who were matched for age and were HBeAg negative

Variable	Value for HBeAg-negative group		P
	Non-HCC (n = 51)	HCC (n = 49)
Mean age (yr) ± SD	54 ± 9	55 ± 4	Matched
No. (%) of male patients	44 (86)	47 (88)	Matched
No. (%) of HBeAg-positive patients	0 (0)	0 (0)	Matched
ALT level (mean U/liter ± SD)	47 ± 73	76 ± 79	0.048
HBV DNA level (mean LGE/ml ± SD)	5.1 ± 1.5	5.2 ± 1.4	0.67
Mean platelet count (104/mm3) ± SD	19 ± 3.5	11 ± 4.5	<0.0001
No. (%) of patients with a mutation in the X region
T1479C (T to P at aa 36)	26 (51)	31 (63)	0.23
C1485T (P to S at aa 38)	12 (24)	17 (35)	0.27
G1499H	32 (63)	26 (53)	0.42
G1613A	17 (33)	21 (43)	0.41
C1653T (in box α)	17 (33)	29 (59)	0.016
T1753V (in the core promoter)	14 (27)	30 (61)	0.0012
A1762T/G1764A (in the core promoter)	35 (69)	44 (90)	<0.0001
No. (%) of patients with the G1896A mutation in the precore region	35 (69)	34 (69)	>0.9999

In the multivariate analysis among all 160 patients, the presence of T1653, the presence of V1753, and a platelet count of ≤10 × 10⁴/mm³ were independent predictive factors for HCC (odds ratios [95% confidence intervals], 4.37 [1.53 to 12.48], 7.98 [2.54 to 25.10], and 4.39 [8.11 to 73.33], respectively) (Table 5). The presence of H1499 was identified as a significant negative factor for HCC (odds ratio, 0.243 [95% confidence interval, 0.078 to 0.76]).

TABLE 5.

Multivariate analysis of variables with independent predictive value for HCC among a group of 160 patients with HBV infection

Factor	OR (95% CI)a	Pb
Age
<55	1	NS
≥55	1.37 (0.53-3.53)
Sex
Female	1	NS
Male	0.55 (0.15-2.02)
HBeAg
Negative	1	NS
Positive	1.22 (0.32-4.73)
ALT (U/liter)
<40	1	NS
≥40	1.98 (0.74-5.33)
HBV DNA level (LGE/ml)
<5	1	NS
≥5	0.35 (0.10-1.24)
Platelet count/mm3
>10 × 104	1	<0.0001
≤10 × 104	24.39 (8.11-73.33)
Mutation in the X region
T1479C mutation
Absence	1	NS
Presence	2.24 (0.83-6.07)
C1485T mutation
Absence	1	NS
Presence	0.89 (0.29-2.72)
G1499H mutation
Absence	1	0.015
Presence	0.243 (0.078-0.76)
G1613A mutation
Absence	1	NS
Presence	0.48 (0.17-1.40)
C1653T mutation
Absence	1	0.0059
Presence	4.37 (1.53-12.48)
T1753V mutation
Absence	1	0.0004
Presence	7.98 (2.54-25.10)
A1762T/G1764A mutation
Absence	1	NS
Presence	2.93 (0.73-11.87)
G1896A mutation in the
precore region
Absence	1	NS
Presence	0.68 (0.22-2.07)

^aOR, odds ratio; CI, confidence interval.

^bNS, not significant.

DISCUSSION

Many studies have reported that the clinical course of chronic HBV infection may be modified by several specific HBV mutations (7, 11, 25, 49), although the significance of such specific mutations in patients with chronic hepatitis B remains controversial. Since the viral mutations might be influenced by age, sex, HBeAg status, and HBV genotype/subgenotype, in this study we investigated sequences bearing the entire X region as well as enhancer II, BCP, and precore/core regions in order to find the specific mutations associated with HCC by comparing matched control groups (HCC versus non-HCC).

The most significant result in this study was that the presence of T1653 and the presence of V1753 were independent predictive factors for HCC in the multivariate analyses. The T1653 mutation was first found in fulminant hepatitis patients (15, 33, 48) and in cases of chronic hepatitis with acute exacerbation (32). Some studies reported that the T1653 or V1753 mutation was associated with HCC (14, 44-46). Poussin et al. also reported that the T1653 mutation was found in HCC (tumor) lesions from two patients, but interestingly, wild-type 1653 was found in nontumor lesions from the same patients (37). T1653 is located in box α, which is a strong activation element of both enhancer II and the core promoter (50), and the α box elements (nt 1646 to 1668) individually stimulate promoter activity more than 100-fold (50). The T1653 mutation converts the box α binding site for C/EBP and related factors (29, 50) into the perfect palindromic sequence 1648-TCTTATATAAGA, which might enhance binding affinity and enhancer II/core promoter activity. Hence, the T1653 mutation could influence HBeAg production and viral replication through BCP activity. Although a number of studies have reported the role of the BCP mutations in viral features, the exact mechanism of HCC development still remains unclear, particularly with respect to the effect of the mutation in the X protein. In this study, the T1762/A1764 mutations were frequent in both the non-HCC and HCC groups. The T1762/A1764 mutations had been found to be highly frequent in older HBV/C carriers (≥50 years) regardless of clinical status (14); however, these results do not contradict the possibility that T1762/A1764 is associated with hepatocarcinogenesis, because the poor prognosis of HBV/C compared to HBV/B (Ba and Bj) correlates with the high prevalence of T1762/A1764 (16). Study of a prospective cohort of 1,638 high-risk individuals in Qidong (China) showed that T1762/A1764 mutation was detected in 8 of the 15 HCC cases (53.3%) before HCC development (20), suggesting that the T1762/A1764 double mutation indicates a high potential risk for hepatocarcinogenesis. The T1653 or V1753 mutation, in addition to the T1762/A1764 mutations, may be one of the promoters of HCC development.

Several functional analyses had been already reported; Günther et al. (9) analyzed T1653, C1753, T1762, and A1764 mutations (genotype D; accession number AF043594) in the context of an in vitro study involving wild-type HBV, and they reported that precore mRNA and HBeAg secretion were reduced, but the amount of progeny virus DNA in the cells and in the culture medium increased only marginally (if at all), as determined by Southern blot analysis. Lin et al. (24) analyzed HBV replicative efficiency in vitro. HBV isolated from HCC lesions included T1653, V1753, T1762, A1764, and A1896 mutations (genotype C2; accession number AF182804). An HBV isolate from the same patient's serum 4 years before HCC diagnosis included T1762, A1764, and A1896 mutations (genotype C2; AF182802). The clone from HCC showed higher replicative efficiency than the clone before HCC development (AF182802) by Southern blot analysis. However, considering that the mutant type includes not only T1653, C1753, T1762, and A1764 mutations but also other mutations, it is possible that some other mutation influenced the results in the earlier study. Further functional analyses of HBV/C strains with the T1653 mutation are needed in vitro and in vivo.

HBx, the nonstructural regulatory protein of HBV, has been strongly associated with the development of liver cancer in some HBx-transgenic mouse strains or with increased progression to liver cancer in other toxin-exposed HBx-transgenic mouse strains (reviewed in reference 4). Many functions have been ascribed to HBx, but the precise molecular mechanism(s) responsible for its activities, and how these activities affect viral replication and possibly liver cell transformation, remains poorly defined. The T1653 mutation resulted in a histidine-to-tyrosine amino acid substitution at codon 94 of the X protein, which is the center of the immunodominant antigenic domain of amino acids (aa) 85 to 110 mapped by Stemler et al. (41). Sirma et al. (40) reported that wild-type HBx inhibited the clonal outgrowth of cells and induced apoptosis but that the mutants (same sample as in reference 37), which include the T1653 mutation derived from HCC, did not. Indeed, codon 94 (nt 1653 to 1655) is within the function domain of the X protein, which has been reported to play a central role in transactivation (22). Cong et al. (8) also reported that one of the activation domain of X (aa 90 to 122) is required for binding to XAP3 (protein kinase C-binding protein). Protein kinase C is a large family of phospholipid-dependent kinases involved in cell growth, differentiation, and carcinogenesis. It is of interest whether the T1653 mutation affects the protein-protein interactions between the X protein and XAP3. The V1753 mutation and the T1762/A1764 double mutation resulted in an isoleucine-to-asparagine/serine/threonine substitution at codon 127, a lysine-to-methionine substitution at codon 130, and a valine-to-isoleucine substitution at codon 131, respectively. These amino acid changes in the X region may also affect the function of the X protein. The occurrence of multiple mutations may represent a strategy of HBV to escape immune surveillance and thus contribute to the process of multiple steps in hepatocarcinogenesis.

With regard to other X amino acid substitutions that might be associated with HCC, Yeh et al. reported that a serine-to-alanine amino acid substitution at codon 31 (a T-to-G mutation at nt 1464) was more frequent in an HCC group than in a chronic hepatitis group (49), but the substitution at codon 31 was found for only two HCC patients (and for no patients in the non-HCC group) in the present study. The discrepancy might depend on different HBV genotypes/subgenotypes between Japan and Taiwan. Very recently, Muroyama et al. reported that a serine-to-alanine amino acid substitution at codon 38 (a C-to-T mutation at nt 1485) was more frequent in an HCC group than in a chronic hepatitis group (31). Indeed, the T1485 mutation was frequent in this study, but no significant difference between the HCC and non-HCC groups was observed. On the other hand, the H1499 mutation was a significant negative factor in the multivariate analysis, even though it was not significant in the univariate analysis. The H1499 mutation does not result in an amino acid substitution in the X protein, and a previous report by Takahashi et al. showed that the frequency of the H1499 mutation was 73% among 40 HCC patients (44). The frequency was similar to that of the non-HCC group (71%) in this study; thus, the clinical significance of the H1499 mutation remains unclear.

Finally, among HBeAg-positive patients, the T1653 and T1762/A1764 mutations or the V1753 and T1762/A1764 mutations were frequent in the HCC group (sensitivity, 69%; specificity, 72%). Also among HBe-negative patients, the T1653 and T1762/A1764 mutations or the V1753 and T1762/A1764 mutations were frequent in the HCC group (sensitivity, 67%; specificity, 81%). Hence, we would predict the groups at high risk for HCC by the combination of enhancer II/core promoter mutations with X amino acid substitutions as well as by HBV genotypes/subgenotypes. Further prospective studies in countries where HBV genotype C is endemic are required to confirm whether the accumulation of these mutations causes liver disease progression.