Comparison of Single- and Multilocus Sequence Typing and Toxin Gene Profiling for Characterization of Methicillin-Resistant Staphylococcus aureus

Abstract

We compared three novel methicillin-resistant Staphylococcus aureus (MRSA) genotyping methods with multilocus sequence typing (MLST) and spa typing to assess their utility for routine strain typing. The new methods were femA and nuc sequence typing and toxin gene profiling (TGP), using a multiplex-PCR-based reverse line blot assay to detect 13 pyrogenic superantigen and exfoliative toxin genes. Forty-two well-characterized MRSA strains, representing 15 MLSTs or 9 clonal clusters (CCs), were genotyped by all methods. Twenty-two spa, nine femA, and seven nuc sequence types were identified. The femA sequence types correlated exactly with CCs; nuc sequences types were less discriminatory but generally correlated well with femA types and CCs. Ten isolates contained none of 13 toxin genes; TGPs of the remainder comprised 1 to 5 toxin genes. The combination of spa typing and TGPs identified 26 genotypes among the 42 strains studied. A combination of two or three rapid, inexpensive genotyping methods could potentially provide rapid MRSA strain typing as well as useful information about clonal origin and virulence.

Methicillin-resistant Staphylococcus aureus (MRSA) genotyping is used to study its evolution and epidemiology and to assist in infection control (39). Different typing methods provide different information. Multilocus sequence typing (MLST) reveals slowly accumulating changes in conserved genes that reflect long-term evolutionary changes and can identify global spread of the relatively small number of successful clones (13). It has limited discriminatory power and is unsuitable for outbreak investigation, whereas pulsed-field gel electrophoresis is highly discriminatory and can identify recent changes. It is most widely used for outbreak investigation and infection control (9, 28). Both methods are relatively expensive and slow, and a number of rapid, inexpensive typing methods, based on sequence or length polymorphisms of variable genes or loci, have been described that are objective and relatively inexpensive. These include coa (41) and spa (38) sequence typing and the multilocus variable number tandem repeat assay (12, 29).

spa typing, which depends on differences in the number and sequence of tandem repeats in region X of the protein A gene (44), is discriminatory, rapid, inexpensive, and objective (25, 37, 41). The development of a shareable web-based database (www.spaServer.Ridom.de) (15) and the utility of spa typing for early-warning systems (31) have contributed to the rapid uptake of MRSA spa typing by diagnostic and public health laboratories.

In this study, we investigated the potential utility of two additional S. aureus gene polymorphisms for strain typing, namely, femA, one of several genes involved in the synthesis of the branched-peptide structure of S. aureus peptidoglycan (4), and nuc, which encodes an extracellular thermostable nuclease of S. aureus (5). Both are species-specific S. aureus genes; they have been widely used as PCR targets for identification (21), but their polymorphisms have not been widely investigated (14).

S. aureus produces numerous toxins, including enterotoxins or pyrogenic superantigens and exfoliative toxins, some of which are encoded by genes carried on staphylococcal pathogenicity islands and associated with certain clonal complexes (CCs), whereas genes encoding others, such as the Panton-Valentine leucocidin (PVL), are carried on bacteriophages and readily transferred between different lineages (26, 27). This suggests that a toxin gene profile (TGP) could help identify S. aureus CCs as well as providing information about virulence. Various molecular methods have been described for studying the distribution of staphylococcal toxins (2, 10).

We used 42 well-characterized MRSA strains to compare sequence polymorphisms of femA and nuc and TGPs, based on a multiplex PCR-based reverse line blot assay (mPCR/RLB) (22), with two established typing methods—namely, spa typing and MLST—to determine their potential utility for MRSA genotyping.

MATERIALS AND METHODS

S. aureus isolates.

We used 42 well-characterized reference and clinical S. aureus isolates in this study, as shown in Table 1, including 35 from various parts of Australia, provided by Philip Giffard, Cooperative Research Centre for Diagnostics, Queensland University of Technology, Brisbane, and Graeme Nimmo, Queensland Health Pathology Services, Princess Alexandra Hospital, Brisbane, Australia. Some have been used in several previous studies (40). Seven strains were provided by Herminia de Lencastre, Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Oeiras, Portugal, and also have been used in previous studies (33, 34) Two of these strains (MW2 and COL) have been fully sequenced (26). MLST and SCCmec typing results were provided by the donors of the strains (33, 34, 40).

TABLE 1.

Genotypes and spa types of 42 well-characterized methicillin-resistant S. aureus isolates used in this study

Strain	GenBank accession no.a	Defined spa lengthb	spa typec	spa profilec	Clonal typed,e	Sources of Australian isolatesh
B827549	EF094508	134	t1784	07-34-33-13	ST∼1-SCCmec-new	QHPS
HU25g	EF094528	182	t138	08-16-02-25-17-24	ST239-SCCmec-IIIA
HDG2g	EF094527	182	t421	15-12-16-02-25-17	ST239-SCCmec-IIIB
K704540f	EF094525	206	t037	15-12-16-02-25-17-24	ST∼239-SCCmec-III	QHPS
K711532f	= EF094525	206	t037	15-12-16-02-25-17-24	ST∼239-SCCmec-III	QHPS
AH13f	= EF094525	206	t037	15-12-16-02-25-17-24	ST239-SCCmec-IIIA	AGAR
RDH81f	= EF094525	206	t037	15-12-16-02-25-17-24	ST239-SCCmec-IIIA	AGAR
AH1f	= EF094525	206	t037	15-12-16-02-25-17-24	ST128-SCCmec-IIIA	AGAR
RPAH 18f	= EF094525	206	t037	15-12-16-02-25-17-24	ST239-SCCmec-III	AGAR
RPAH15f	= EF094525	206	t037	15-12-16-02-25-17-24	ST239-SCCmec-III	AGAR
ANS46g	= EF094525	206	t037	15-12-16-02-25-17-24	ST239-SCCmec-III
PC8f	EF094507	206	t127	07-23-21-16-34-33-13	ST1-SCCmec-IV	AGAR
FH43f	= EF094507	206	t127	07-23-21-16-34-33-13	ST∼1-SCCmec-IV	AGAR
SJOG 30f	= EF094507	206	t127	07-23-21-16-34-33-13	ST1-SCCmec-IV	AGAR
RPH 85f	= EF094507	206	t127	07-23-21-16-34-33-13	ST∼1-SCCmec-IV	AGAR
SN39f	= EF094507	206	t127	07-23-21-16-34-33-13	ST∼1-SCCmec-new	AGAR
RHH58f	= EF094507	206	t127	07-23-21-16-34-33-13	ST∼1-SCCmec-IV	AGAR
RHH10f	= EF094507	206	t127	07-23-21-16-34-33-13	ST∼1-SCCmec-IV	AGAR
FH53f	= EF094507	206	t127	07-23-21-16-34-33-13	ST∼1-SCCmec-I	AGAR
RPH2f	EF094510	206	t190	11-17-34-24-34-22-25	ST8-SCCmec-new	AGAR
PAH 58f	EF094514	230	t019	08-16-02-16-02-25-17-24	ST30-SCCmec-IV	AGAR
PAH 1f	= EF094514	230	t019	08-16-02-16-02-25-17-24	ST30-SCCmec-IV	AGAR
MW2g	EF094526	230	t128	07-23-23-21-16-34-33-13	ST1-SCCmec-IV
RBH98f	EF094522	230	t202	11-17-23-17-17-16-16-25	ST93-SCCmec-IV	AGAR
13792-4492f	= EF094522	230	t202	11-17-23-17-17-16-16-25	ST∼93-SCCmec-IV	QHPS
IP01M1081f	EF094523	230	t216	04-20-17-20-17-31-16-34	ST59-SCCmec-IV	QHPS
14176-5710f	EF094524	230	t1959c	15-21-12-16-02-25-17-16	ST∼239-SCCmec-III	QHPS
B8-10f	EF094509	230	t711	04-21-17-34-24-34-22-25	ST∼8-SCCmec-IV	QHPS
J710566f	EF094516	254	t065	09-02-16-34-13-17-34-16-34	ST45-SCCmec-V	QHPS
RPH 74f	EF094517	254	t123	09-02-16-34-13-16-34-16-34	ST45-SCCmec-V	AGAR
IP01M2046f	EF094519	254	t1958c	08-21-17-13-13-new-34-33-34	ST78-SCCmec-IV	QHPS
E804531f	EF094518	278	t002	26-23-17-34-17-20-17-12-17-16	ST5-SCCmec-IV	QHPS
CH97f	= EF094518	278	t002	26-23-17-34-17-20-17-12-17-16	ST73-SCCmec-IV	AGAR
BK2464g	= EF094518	278	t002	26-23-17-34-17-20-17-12-17-16	ST5-SCCmec-II
IMVS 67f	EF094511	278	t008	11-19-12-21-17-34-24-34-22-25	ST8-SCCmec-V	AGAR
COLg	= EF094511	278	t008	11-19-12-21-17-34-24-34-22-25	ST250-SCCmec-I
DEN2988g	= EF094511	278	t008	11-19-12-21-17-34-24-34-22-25	ST8-SCCmec-IVA
F829549f	EF094521	278	t186	07-12-21-17-13-13-34-34-33-34	ST88-SCCmec-IV	QHPS
C801535f	EF094520	278	t325	07-12-21-17-34-13-34-34-33-34	ST88-SCCmec-new	QHPS
E822485f	EF094515	302	t018	15-12-16-02-16-02-25-17-24-24-24	ST36-SCCmec-II	QHPS
CH69f	EF094513	326	t1963c	26-23-13-17-31-29-17-25-17-25-16-28	ST∼22-SCCmec-IV	AGAR
CH16f	EF094512	422	t032	26-23-23-13-23-31-29-17-31-29-17-25-17-25-16-28	ST22-SCCmec-IV	AGAR

^aThe relevant spa sequences have been submitted to GenBank; other strains with identical spa sequences are indicated by “=” and the accession no. for the corresponding submitted GenBank sequence.

^bDefined spa lengths are the distances from the start and end points, equal to 1156 and 1481 in GenBank sequence J01786, which correlates with the start and end point of the suggested 5′ and 3′ signature sequences (www.spaServer.Ridom.de). The full repetitive region sequence length can be calculated by adding together the lengths of sequences of individual repeats.

^cAfter comparison with spa database (www.spaServer.Ridom.de) and GenBank sequences, three new spa types sequences were identified and submitted to the spa database (www.spaServer.Ridom.de). Please refer to the spa database for spa type and profile nomenclature.

^dST, MLST; SCCmec, staphylococcal cassette chromosome mec. Information provided by strain donors; ST∼, single nucleotide polymorphism type as described by Huygens et al. (18) using the computer program Minimum SNPs to compare with existing MLST data (17).

^eClonal type refers to the combination of ST and SCCmec type.

^fThirty-five Australian strains were provided by Philip Giffard, Cooperative Research Centre for Diagnostics, Queensland University of Technology, Brisbane, Australia, and Graeme Nimmo, Queensland Health Pathology Services, Princess Alexandra Hospital, Brisbane, and have been used in several previous studies (17, 18, 40).

^gSeven isolates were provided by Herminia de Lencastre, Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Oeiras, Portugal, and have been used in several previous studies (33, 34); spa types identified in this study were identical with those previously reported for these strains (de Lencastre, personal communication).

^hQHPS, Queensland Health Pathology Service (isolates from various diagnostic laboratories in Queensland); AGAR, Australian Group on Antibiotic Resistance (isolates from a study of community MRSA in Australia) (6).

DNA extraction.

DNA extraction was performed as described previously (23).

Toxin gene detection.

A well-established mPCR/RLB protocol developed in our laboratory (22) was used to detect 13 Staphylococcus aureus toxin genes. Target genes, primer and probe sequences, physical characteristics, and locations within selected GenBank sequences are shown in Table 2. All primers and probes had similar physical characteristics to allow simultaneous amplification and hybridization, respectively, in a multiplex reaction (22). Two gene-specific PCR primer pairs and two gene-specific probes were designed for each of 13 toxin genes. All primers were 5′ end biotinylated to allow detection of hybridization with a streptavidin peroxidase substrate. The probes were labeled with a 5′-end amine group to facilitate covalent linkage to the nylon membrane and to allow membranes to be stripped and reused repeatedly (22). Each multiplex reaction included nuc primers as the positive control for S. aureus and for quality control of DNA extraction and mPCR/RLB. All primers and probes were synthesized by Sigma-Aldrich (Sydney, Australia).

TABLE 2.

Primers and probes used in mPCR/RLB for detection of 13 toxin genes

Primer/probea	Target	Tm °Cb	GenBank accession no.	Primer/probe sequence (5′-3′)c	Referencesd
nucSb	nuc	65.68	V01281	511GCG ATT GAT GGT GAT ACG GTT531	7
nucAp	nuc	61.36	V01281	558CAT TGG TTG ACC TTT GTA CAT TAA 535	This study
nucSp	nuc	61.06	V01281	745GAT GGA AAA ATG GTA AAC GAA G766	This study
nucAb	nuc	69.12	V01281	789AGC CAA GCC TTG ACG AAC TAA AGC766	7
seaSb	sea	64.05	M18970	487CCT TTG GAA ACG GTT AAA ACG507	3
seaSp	sea	68.83	M18970	531GGA GTT GGA TCT TCA AGC AAG ACG 554	3
seaAp	sea	63.87	M18970	613TCT GAA CCT TCC CAT CAA AAA C592	3
seaAb	sea	62.91	M18970	691TTGA ATA CTG TCC TTG AGC ACC670	43
sebSb	seb	64.82	M11118	634TCG CAT CAA ACT GAC AAA CG653	3
sebSp	seb	61.1	M11118	662GTAT GTA TGG TGG TGT AAC TGA GC685	43
sebAp	seb	60.06	M11118	831CA CCA AAT AGT GAC GAG TTA GG810	43
sebAb	seb	60.4	M11118	924CAT GTC ATA CCA AAA GCT ATT CTC901	3
secSb	sec	62.5	X05815	664G CTC AAG AAC TAG ACA TAA AAG CTA GG690	3
secSp	sec	63.13	X05815	772AAC GG(/a)C AAT ACT TTT TGG TAT GAT795	3
secAp	sec	61.4	X05815	885CTT CAC A(/t)CT TTT AGA ATC AAC CG863	43
secAb	sec	60.4	X05815	935TCA AAA TCG GAT TAA CAT TAT CC913	3
sedSb	sed	60.2	M28521	332CTA GTT TGG TAA TAT CTC CTT TAA ACG358	3
sedSp	sed	64.91	M28521	360TAA AGC CAA TGA AAA CAT TGA TTC A384	3
sedAp	sed	60.85	M28521	491CTT TTA TTT TCT CCT ATT ATT GG ATTTTT463	30
sedAb	sed	61.9	M28521	653CAA TTA ATG CTA TAT CTT ATA GGG TAA ACA TC622	3
seeSb	see	63.41	M21319	424C GAT TGA CCG AAG AAA AAA AAG445	30
seeSp	see	60.2	M21319	479CTA CAG TAC CTA TAG ATA AAG TTA AAA CAA GC510	3
seeAp	see	66.87	M21319	613TTT GCA CCT TAC CGC CAA AG594	3
seeAb	see	60.38	M21319	659TAA CTT ACC GTG GAC CCT TC640	3
segSb	seg	66.14	AF064773	229CAA CCC/T GAT CCT AAA TTA GAC GAA C253	2
segSp	seg	63.09	AF064773	285GGG AAC TAT GGG T(/a)AA TGT AAT GAA TC310	2
segAp	seg	62.61	AF064773	338CTT CCT TCA ACA GGT GGA GAC318	2
segAb	seg	62.91	AF064773	485/401GGA ACG CCA AAA ATG TCT ACT T464/379	35
sehSb	seh	60.86	U11702	407TTA GAA ATC AAG GTG ATA GTG GC 429	2
sehSp	seh	61.25	U11702	454ACT GCT GAT TTA GCT CAG AAG TTT A 478	2
sehAp	seh	60.1	U11702	575AGT GTT GTA CCT CCA TAT AGA C ATTC550	35
sehAb	seh	60.47	U11702	641TTT TGA ATA CCA TCT ACC CAA AC619	2
seiSb	sei	63.01	AY158703	396G GCC ACT TTA TCA GGA CAA TAC TT419	2
seiSp	sei	61.91	AY158703	656A CA C(a)TG GTA AAG GC(t)A AAG AAT ATG679	2
seiAp	sei	62.26	AY158703	726AAA ACT TAC AGG CAG TCC ATC TC704	2
seiAb	sei	58.23	AY158703	818AAT TAT CAT TAG TTA CTA TCT ACA TAT GAT ATT TC784	35
etaSb	eta	61.39	M17347	374CTA GTG CAT TTG TTA TTC AAG ACG397	3
etaSp	eta	69.51	M17347	414CCA TGC AAA AGC AGA AGT TTC AGC 437	3
etaAp	eta	60.67	M17347	492TGC A(/g)TT GAC ACC ATA GTA CTT ATT C468	This study
etaAb	eta	62.72	M17347	794AAT GCT AAA TCA ACA CCT GC AC773	30
etbSb	etb	61.26	M17348	190TAC CAC CTA ATA CCC TAA TAA TCC AA215	3
etbSp	etb	61.37	M17348	286GAG ACA GTG CAT TAA ATG AAT AAC TTT312	3
etbAp	etb	62.41	M17348	539GAT TTC TTC TGC GCT GTA TTC TT517	This study
etbAb	etb	61.16	M17348	609C ATT ATC CGT AAT GTG TGT ATAAA GC584	43
etdSb	etd	61.75	AB057421	5963GCT CGG ATA CCC TTA TAA CTT TTC5986	This study
etdSp	etd	62.2	AB057421	6055CTG AGT CGG GAA ATT CTG G6073	43
etdAp	etd	61.47	AB057421	6120CAA CAT GAA TAC CA0A CTA ACT CTC C6096	This study
etdAb	etd	61.88	AB057421	6259CAT TAC TAA TGA GAC TGT AAT TCA GCT CT6231	This study
tsstSb	tsst-1	65.22	J02615	348AAG CCA ACA TAC TAG CGA AGG AAC371	3
tsstSp	tsst-1	60.5	J02615	394GGC GTT ACA AAT ACT GAA AAA TTA C418	30
tsstAp	tsst-1	64.36	J02615	495ATC GAA CTT TGG CCC(/a) ATA CTT T474	3
tsstAb	tsst-1	61.03	J02615	556GTA TTT GAG TTA GCT GAT GAC GAA533	43
pvlSb	pvl	65.29	X72700	2651TTT TAG GCT CAA GAC AAA GCA AC2673	This study
pvlAp	pvl	65.3	X72700	2731TAC CTC TGG ATA ACA CTG GCA TTT T2707	11
pvlSp	pvl	61.76	X72700	2733CTT CAA TCC AGA ATT TAT TGG TGT 2756	11
pvlAb	pvl	65.8	X72700	2783TTT GCA GCG TTT TGT TTT CG2764	11

^aS, sense; A, antisense; b, biotin labeled (all the primers were biotin labeled at the 5′ end); p, probe (all the probes were 5′ end C6 amine labeled).

^bT_m values were provided by the primer synthesizer (Sigma-Aldrich).

^cBoldface numbers represent the numbered base positions at which primer/probe sequences start and finish (starting at point “1” of the corresponding GenBank sequence). Underlined portions indicate modifications of published primer/probe sequences. The bases in parenthesis represent sequences with polymorphisms compared with GenBank sequences or our own sequencing results (for five probes with heterogeneous hybridization).

^dPrimers and probes were used as previously published (some with modification) except, as indicated, those designed for this study.

The mPCR/RLB was performed as previously described (22) with the following modifications: each 25-μl reaction mixture contained 0.5 U Hotstar Taq polymerase (QIAGEN, Melbourne, Australia), and the mPCR annealing temperature was optimized to 55°C.

Sequencing, sequence analysis, and phylogenetic tree.

femA, nuc, and spa PCR primers were based on the published GenBank sequences using BioManager (http://biomanager.angis.org.au/). Sequencing was performed as described previously (24). For most targets, outer primers were used for amplification and inner primers for sequencing (Table 3).

TABLE 3.

Primers used for PCR sequencing of nuc, femA, and spa genes

Primer	Target	Tm (°C)	GenBank accession no.	Primer sequence (5′-3′)c
nucS1a	nuc	60.3	V01281	226ATGACAGAATACTTATTAAGTGCTGG251
nucS2b	nuc	60.6	V01281	232GAATACTTATTAAGTGCTGGCATATG257
nucA1b	nuc	63.9	V01281	908TGACCTGAATCAGCGTTGTC889
nucA2a	nuc	63.7	V01281	912TTATTGACCTGAATCAGCGTTG891
femAS1a	femA	64.1	X17688	577ATGAAATTAATTAACGAGAGACAAATAGGAG607
femAS2b	femA	65.4	X17688	591CGAGAGACAAATAGGAGTAATGATAATGAAG621
femAA0b	femA	67.3	X17688	1868CTGTCTTTAACTTTTTTAAGTGCGGTATATGC1837
femAAa	femA	68.3	X17688	1878CTAAAAAATTCTGTCTTTAACTTTTTTAAGTGCGG1844
spaSa	spa	71.7	J01786	1077CTT CAT CCA AAG CCT TAA AGA CGA TCC TTC1106
spaAa	spa	71.4	J01786	1543CAA TTT TGTCAG CAG TAG TGC CGT TTG1517
spaSEQb	spa	71.9	J01786	1540TTT TGTCAG CAG TAG TGC CGT TTG CT1515

^aFor most targets, outer primers were used for amplification and, less commonly, for sequencing.

^bInner primers were mainly used for sequencing, since they gave better results.

^cBoldface numbers represent the numbered base positions at which primer sequences start and finish (starting at point “1” of the corresponding GenBank sequence).

The spa types were defined by reference to the shareable web-based database (www.spaServer.Ridom.de) (15). All spa repeat regions were submitted to the database, and spa types were assigned by the database by combining the sequences of all repeat regions.

Data obtained from different typing methods were recorded and stored in an Access file, which was imported into the BioNumerics software program (Applied Maths) with appropriate formatting. A phylogenetic tree was generated by using the categorical coefficient and clustered by the Ward algorithm.

Calculation of index of diversity.

Simpson's index of diversity was calculated for each individual genotyping method and for combinations of methods, as described by Hunter and Gaston (16).

Nucleotide sequence accession numbers.

The nearly full-length sequences (see below) of selected femA and nuc genes and partial spa sequences were deposited in GenBank with the following accession numbers: for femA, DQ103589 and DQ352456 to DQ352463; for nuc, DQ507377 to DQ507382; and for spa, EF094507 to EF094528. Eight S. aureus genome sequences were used for reference: AJ938182 (RF122), NC_002952 (MRSA252), AF144661 (Staphylococcus aureus subsp. anaerobius), NC_002745(N315), NC_002758 (Mu50), NC_003923 (MW2), NC_002951 (COL), and NC_002953 (MSSA476).

RESULTS AND DISCUSSION

Sequence polymorphisms of femA and nuc.

Nine femA sequence types with lengths of approximately 1,215 bp were identified, of which five were newly identified and four had been previously deposited in GenBank. A total of 39 polymorphism sites were found among those sequences. Seven nuc sequence types of approximately 700 bp were identified, with 28 polymorphisms sites. Four sequence types had not been previously identified.

spa types and TGPs.

Twenty-two spa types were identified, and sequences of each new type were submitted to GenBank with accession numbers shown in Table 1. Nineteen of the spa types were already recorded in the spa database (www.spaServer.Ridom.de) (15), and three were new types, first identified in Australian strains (Table 1; Fig. 1). There were 14 different TGPs (Fig. 1 and 2).

FIG. 1.

Relatedness of 42 MRSA strains between different typing methods. *, strains CH 69, IPO1M2046, and 14176-5710 belonged to spa types t1963, t1958, and t1959, respectively, which have not been previously deposited in the database.

FIG. 2.

The 13 toxin gene profiles of the 41 strains. Lanes 1 to 42 show results for the following isolates, in order (see Table 1): FH43, SJOG 30, RPH85, B827549, SN39, RHH58, RHH10, FH53, B8-10, RPH2, IMVS67, CH16, CH69, PAH58, PAH1, E822485, J710566, RPH74, E804531, CH97, IP01M2046, C801535, F829549, RBH98, 13792-4492, IP01M1081, 14176-5710, K704540, K711532, AH13, RDH81, AH1, RPAH18, RPAH15, COL, MW2, DEN2988, BK2464, HDG2, HU25, a control strain, and ANS46.

Comparison of MLST, femA and nuc sequence types, spa types, and TGPs.

MLST are based on sequences of seven housekeeping genes (http://www.mlst.net/). Isolates with identical sequences for all seven genes are considered to be clonal and those with five or six matching genes to belong to the same CC (27). There were 15 MLST and nine CCs among the 42 strains studied (Table 1). The latter correlated exactly with femA sequence types, suggesting that femA sequencing may be a useful “shorthand” single-locus surrogate for MLST (Fig. 1). In future, informative single nucleotide polymorphisms in the femA sequence may be able to predict femA type and CC. One of the candidate methods is rolling-circle amplification, which has been used successfully in our laboratory (42).

There were seven nuc sequence types, which were therefore less informative. One sequence type was represented among three femA sequence types (and corresponding CCs).

The relationships between MLST and TGP varied (Fig. 1). No toxin genes were found in 10 isolates belonging to four sequence types (STs) (ST-8, -78, -88, and -239). One to five toxin genes were found in various combinations in the remaining isolates. Some STs included more than one TGP, e.g., ST-5, -22, -45, and -239 each included isolates with two different TGPs, which reflects the ability of mobile genetic elements on which toxin genes are carried to transfer laterally between clones.

However, some toxin genes are transferred vertically within specific CCs (32, 36). For example, all 10 ST-1 isolates (but none belonging to other STs) contained sea and seh; sea alone was found in another eight isolates belonging to CC 8/239. seg and sei, which are part of the enterotoxin gene complex (egc), were always present together, in 10 isolates spread among four CCs (ST-5/73, -22, -45, and -30/36). This is consistent with a previous report that egc is preferentially distributed among CCs 5 and 30/36 (19). In addition, we identified mutations in regions of seg and sei probes in isolates belonging to CC 30/36.

The Panton-Valentine leukocidin gene (pvl) was identified, with a variety of other toxin genes (depending on ST/CC), in eight isolates belonging to ST-1 (three isolates), ST-93 (two isolates), or CC 30/36 (three isolates); seven of eight PVL-containing isolates belonged to SCCmec type IV, which is generally associated with community-acquired MRSA. PVL is associated with necrotic skin and soft tissue lesions and, more recently, with life-threatening necrotizing pneumonia and sepsis due to community-acquired MRSA (8, 44).

There were 22 spa types among the 42 strains tested. When combined with TGP, some spa types were further subdivided, making a total of 26 genotypes. For example, isolates belonging to spa type t002 contained two TGPs (seg-sei and sed-seg-sei), and those belonging to t008 contained three (sea, seb, and none). The combination of these two methods thus provides a high level of discrimination, using relatively inexpensive, rapid methods.

Comparison of discriminatory powers of each genotyping method and various combinations (Table 4) showed that spa typing is the most discriminatory. The addition of TGPs alone or TGP plus SCCmec typing increases the discriminatory power, but there is little additional increase from additional femA or nuc sequence typing.

TABLE 4.

Comparison of discriminatory powers of each genotyping method and various combinations of methods for 42 MRSA strains using Simpson index of diversity

Genotyping method(s)	No. of types	% of largest type	DIa
Individual
SCCmec	9	45.2	0.764
nuc sequence types	7	38.1	0.77
femA sequence types	9	38.1	0.794
TGPs	14	23.8	0.88
MLST	15	23.8	0.882
spa types	22	19	0.926
Combinations
femA-spa-TGP	27	14.3	0.959
TGP-spa	27	14.3	0.959
TGP-spa-nuc	27	14.3	0.959
TGP-spa-SCCmec	30	9.5	0.98
femA-spa-TGP-SCCmec	31	9.5	0.981
femA-spa-TGP-nuc-MLST-SCCmec	34	9.5	0.987

^aDI, Simpson index, calculated according to the method of Hunter and Gaston (16).

Significance of sequence polymorphisms.

These results indicate that femA and to some extent nuc sequence types correlate closely with MLST in this set of MRSA isolates, suggesting that these genes evolve at a rate similar to that of housekeeping genes within CCs (20, 27). spa types were more discriminatory for strain typing but correlated less well with MLST or CCs.

Significant sequence variation in femA and nuc also has potential implications for their use as species-specific PCR targets for identification of S. aureus. The possibility of mutations needs to be considered in the design of probes and primers to avoid false-negative or inaccurate quantitative PCR results. Our results show that some mutations occurred in the region of primers used as species-specific primers (1).

There were significant sequence polymorphisms in femA and nuc genes, which have not been previously well studied, which has potential implications for their use as species-specific PCR targets for identification of S. aureus. Both correlated well with each other, and femA sequence types correlated with MLST/CCs. TGPs provide useful information about potential virulence and the evolutionary history of S. aureus strains and can increase the discriminatory power of femA and spa sequence typing. Prospective testing of unselected clinical isolates will be needed to adequately determine the optimal combination of methods for MRSA surveillance.