Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2008 Oct 15.
Published in final edited form as: Dev Biol. 2007 Aug 9;310(2):442–453. doi: 10.1016/j.ydbio.2007.08.007

Transgenic over-expression of the microRNA miR-17-92 cluster promotes proliferation and inhibits differentiation of lung epithelial progenitor cells

Yun Lu 1, J Michael Thomson 2, Ho Yuen Frank Wang 1, Scott M Hammond 2,3, Brigid LM Hogan 1,*
PMCID: PMC2052923  NIHMSID: NIHMS32398  PMID: 17765889

Abstract

The miR-17-92 locus encodes a cluster of 7 microRNAs transcribed as a single primary transcript. It can accelerate c-Myc induced B cell lymphoma development and is highly expressed in many tumors, including lung tumors. However, the role of miR-17-92 in development has not been well studied. From analysis of microRNAs during lung development, expression of the miR-17-92 cluster is high at early stages, but declines as development proceeds. We used the mouse surfactant protein C (Sftpc) promoter to over-express the cluster in embryonic lung epithelium. Transgenic lungs have a very abnormal lethal phenotype. They contain numerous proliferative epithelial cells that retain high levels of Sox9, a marker of distal progenitors. The differentiation of proximal epithelial cells was also inhibited. Furthermore, a significant increase in the number of neuroendocrine cell clusters was observed in the lungs of dead transgenic pups. We identify a tumor suppressor, Rbl2 which belongs to the Rb family, as a new target for miR-17-5p. Together, these studies suggest that mir-17-92 normally promotes the high proliferation and undifferentiated phenotype of lung epithelial progenitor cells.

Keywords: miR-17-92, miRNAs, lung development, Rbl2, proliferation, progenitor epithelial cells

Introduction

MicroRNAs (miRNAs) are a class of small (~22bp), non-coding RNAs that regulate gene expression at a post transcriptional level. They are first transcribed as primary miRNAs by RNA polymerase II (Cai et al., 2004) and then cut by the RNase-III enzyme, Drosha, into ~70-nucleotide precursors (pre-miRNAs) (Lee et al., 2003; Lee et al., 2002), which are transported to the cytoplasm by Exportin 5 (Zeng and Cullen, 2004). Another enzyme, Dicer, then processes the pre-miRNAs to mature miRNAs (Bernstein et al., 2001; Hutvagner et al., 2001), which are recruited into the RNA-induced silencing complex (RISC) (Khvorova et al., 2003; Schwarz et al., 2003). Finally, this complex interferes with the translation and stability of target messenger RNAs (He and Hannon, 2004).

It is clear that miRNAs play an important role in development. Loss of Dicer, which completely blocks the processing of all miRNAs, causes embryonic lethality in both zebra fish (Giraldez et al., 2005) and mice (Bernstein et al., 2003). Hair follicle growth (Andl et al., 2006), skin morphogenesis (Yi et al., 2006) and angiogenesis (Yang et al., 2005) are also affected by deficiency of Dicer. Recently, it was reported that conditional deletion of Dicer in embryonic lung epithelium leads to inhibition of branching and increased apoptosis (Harris et al., 2006) suggesting that miRNAs play an important role in lung development. However, only a few miRNAs have been well studied for their function in mammalian development. For example, it was suggested that miR-1, regulated by serum response factors, controls the balance between differentiation and proliferation during cardiogenesis and muscle development by targeting Hand2 and HDAC4, respectively (Chen et al., 2006; Zhao et al., 2007; Zhao et al., 2005).

Here, we explore the function of a miRNA cluster, miR-17-92, in mouse lung development. MiR-17-92 is a conserved gene which encodes 7 miRNAs. It also has two homologous miRNA clusters in the mouse genome (Fig. 1A). The human gene is located at chromosome 13q31, in the intron of chr13orf25. Amplification of this region has been reported in follicular lymphoma, B-cell lymphoma and in several lung and head and neck carcinomas (Knuutila et al., 1998). Recently, a large-scale analysis of the miRNA profiles of solid tumors showed up-regulation of the human miR-17-92 cluster in many cancers, including lung cancer (Volinia et al., 2006) and small-cell lung cancer that is thought to arise from neuroendocrine cells (Hayashita et al., 2005). In addition to its upregulation in cancer cells recent studies showed that miR-17-92 is highly expressed in embryonic stem cells, with expression levels decreasing during embryonic development in mice (Thomson et al., 2004). This is consistent with miRNA cloning data from pluripotential mouse embryonic stem (ES) cells (Houbaviy et al., 2003). Taken together, these results support the idea that high level of miR-17-92 promote the proliferation of progenitor cells and inhibit their differentiation. However, little is known about the role of miR-17-92 in the development of specific organs, including the lung.

Figure 1.

Figure 1

Open in a new tab

Relative expression of miR-17-92 cluster members during lung development. (A) Genomic organization of three homologous mouse miRNA clusters (miR-17-92, miR106a-363 and miR-106b-25) (yellow boxes, pre-miRNAs; blue boxes, mature miRNAs). Note that miR-18X is a predicted miRNA, which has not yet been cloned. MicroRNA microarray (B) and Northern blot (C) show the relative expression levels of miR-17-92 cluster members in developing lungs. Five different developmental stages are shown: E11.5, E13.5, E15.5, E17.5 and adult (about 12 weeks old).

In the mouse, lung development begins around embryonic days 9.5 (E9.5) when two primordial buds of epithelial endoderm cells surrounded by mesoderm grow out of the ventral foregut (Cardoso and Lu, 2006). Subsequent lung development can be divided into four stages, termed pseudoglandular, canalicular, terminal sac and alveolar. During the first two stages the distal tips of the lung buds contain a population of highly proliferative cuboidal epithelial cells. Descendants of these cells populate the more proximal tubules as the buds elongate. Beginning around E14, the proximal cells begin to differentiate into Clara, ciliated and neuroendocrine cells. During the saccular stage the distal epithelial cells give rise to the progenitors of the primitive alveoli which subsequently differentiate into specialized type I and type II cells. At the beginning of this study, we found that miR-17-92 is highly expressed in the E11.5 lung and its level declines as development proceeds. We therefore hypothesized that miR-17-92 is important for maintaining lung progenitor cells. In this study, we over-expressed the whole miR-17-92 cluster in the distal epithelium of transgenic lungs from around E10.5, using the mouse surfactant protein C promoter. This results in a very abnormal lung phenotype, in particular the accumulation of large numbers of highly proliferative epithelial cells expressing markers of progenitors. In a search for potential targets of miR-17-5p that could account for this phenotype we have identified the tumor suppressor Rbl2. How this target may contribute to the network of genes potentially regulated by the cluster during lung development is discussed.

Materials and methods

Mice

A schematic diagram of the transgenic construct is shown in Fig. 3A. The mouse 6.5kb Sftpc promoter was kindly provided by Edward Morrisey, University of Pennsylvania. It drives transgene expression in the distal lung epithelium from about E10.5 (personal communication). The mouse 1.1kb miR-17-92 cluster DNA was cloned by PCR from C57BL/6 mouse genomic DNA, using primer sets: sense, 5′ GTCAGAATTCCCCCTTGGGTATAAGCTGTAATT; anti-sense, 5′ GTCACTCGAGACCAACGAAAGCAATAGAAATCA (Restriction sites, EcoR I and Xho I, were added for cloning). The 0.4kb SV40 small T intron and poly A were derived from plasmid pKC4 by Hind III and BamH I. A total of 8 transgenic embryos at E18.5 and 2 transgenic mice were generated by pronuclear injection of fertilized eggs of the FVB inbred strain at the Duke Transgenic Mouse Facility. Transgenic adults were crossed with ICR mice to obtain transgenic pups at P0.

Figure 3.

Figure 3

Open in a new tab

Abnormal lung phenotype observed in miR-17-92 cluster transgenic embryos and newborn pups. (A) Schematic illustration of miR-17-92 cluster transgenic construct. The cluster contains all six miRNA precursors and 133bp genomic flanking region at both ends. (B–I) H&E stained sections of left lobe from both the normal and transgenic lungs. (D,E,H,I) The enlarged pictures of (B), (C), (F) and (G) respectively. (J,K) MiR-17-5p in situ hybridization of normal and transgenic P0 lungs. (L) Microarray analysis shows that the expression levels of all six miRNAs within the cluster are increased in the transgenic lungs. Tested RNA was extracted from P0 lungs six transgenic and six normal pups from one litter of the transgenic mosaic founder. (B,C,F,G) Scale bar = 200μm; (D,E,H,I) Scale bar = 100μm; (J,K) Scale bar = 15μm.

MicroRNA In situ hybridization

Protocols for section and whole mount in situ hybridization were obtained from Exiqon (http://www.exiqon.com). Briefly, paraffin wax-embedded sections were dewaxed, pretreated with proteinase K (10 minutes at RT) and hybridized with Locked Nucleic Acid (LNA) probes (pre-designed oligos from Exiqon) in 50% formamide hybridization mix at 49°C. Probes were labeled with Digoxigenin (DIG) using DIG oligonucleotide 3′-end labeling kit, 2nd generation (Roche). Slides were then washed with 2×SSC and 2×SSC plus 50% formamide at 49 °C. The DIG-labeled probes were detected by alkaline phosphatase-coupled anti-DIG (Roche), followed by color development (Substrate: NBT, BCIP, Promega). Whole mount in situ hybridization also followed protocol from Exiqon. The proteinase K treatment for E11.5 embryos and E12.5 lungs was 30 and 10 minutes, respectively, at 37 °C. The antibody wash for E11.5 embryos and E12.5 lungs was 3 days and 6 hours respectively at 4°C.

RNA extraction and Northern blot

Lungs were collected and immediately frozen in liquid nitrogen and stored at −80°C. RNA was extracted by Trizol (Invitrogen) following the product manual. The Northern blot protocol was derived from Exiqon (http://www.exiqon.com). Briefly, total RNA was separated by 15% polyacrylamide gel electrophoresis with 0.5×TBE. After 1.5h transfer to a Hybond-N+ nylon membrane (Amersham) by semi-dry transfer cell (Bio-Rad), the membrane was prehybridized and hybridized in PerfectHyb Plus Hybridization Buffer (Sigma) at 49°C for LNA probes or room temperature (RT) for DNA probes. Probes were labeled with 32P γ-ATP by T4 Polynucleotide Kinase (New England BioLabs). The membrane was washed with 10×SSC at RT for autoradiography.

MiRNA microarray and Affymetrix analysis

MiRNA microarray was performed essentially as described (Thomson et al., 2004). For the Affymetrix analysis, total RNA (10 μg) was extracted from three normal and three transgenic lungs using Trizol (Invitrogen) and RNeasy Mini Kit (Qiagen) and assessed for quality with an Agilent Labon-a-Chip 2100 Bioanalyzer (Agilent Technologies). All the reactions were carried out at Duke Microarray Facility. In brief, probes for hybridization were prepared from total RNA according to standard Affymetrix protocols. First strand cDNA was synthesized using a T7-linked oligo-dT primer, followed by second strand synthesis. An in vitro transcription reaction was performed to generate the cRNA containing biotinylated UTP and CTP, which was subsequently fragmented chemically at 95°C for 35 minutes. The fragmented, biotinylated cRNA was hybridized in MES buffer (2-[N-morpholino]ethanesulfonic acid) containing 0.5 mg/ml acetylated bovine serum albumin to Affymetrix GeneChip Mouse 430A arrays at 45°C for 16 h, according to the Affymetrix protocol (http://www.affymetrix.com). Arrays were washed and stained with streptavidin-phycoerythrin (SAPE; Molecular Probes Inc, Eugene, USA). Signal amplification was performed using a biotinylated anti-streptavidin antibody (Vector Laboratories) at 3 μg/ml. This was followed by a second staining with SAPE. Normal goat IgG (2 mg/ml) was used as a blocking agent. All data are available in Figure S1 and Table S1.

MiRNA cloning

The miRNA cloning was performed as described (Lau et al., 2001), except that the 50μg total RNA extracted by Trizol from lung samples was first enriched for the small RNA fraction by mirVana miRNA Isolation Kit (Ambion) before cloning.

Immunohistochemistry

Tissues for immunohistochemistry were fixed in 4% freshly prepared paraformaldehyde in PBS at 4°C overnight, embedded in paraffin wax and sectioned at 7μm. After rehydration, the endogenous enzyme activity was quenched by 2% H2O2 in methanol (30 minutes). Before the blocking and antibody reaction in 2% BSA, 5% serum and 0.1% Triton X-100 in PBS, different antigen retrievals were performed for different antibodies, as follows: Mouse anti-BrdU (Sigma, 1:500): 2N HCl at 37 °C, 20 minutes and then 0.05% trypsin/PBS at room temperature (RT), 5 minutes; rabbit anti-proSurfactant protein C (Chemicon, 1:200): 0.05% trypsin/PBS at RT, 5 minutes; mouse anti-Nkx2.1 (NeoMakers, 1:500): microwave antigen retrieval with 10mM pH6.0 sodium citrate. Rabbit anti-CC10 (kindly provided by Barry Stripp, 1:10000), goat anti-Scgbla1 (CCSP/CC10) (kindly provided by Barry Stripp, 1:10000), mouse anti-β tubulin (BioGenex, 1:1000), rabbit anti-CGRP (Penlabs, 1:1000), rabbit anti-Sox9 (kindly provided by Dr. Francis Poulat, 1:2000), rabbit anti-Nmyc (SantaCruz, 1:100) and rabbit anti-Rbl2/p130 (Abcam, 1:500) did not need antigen retrieval. Secondary antibodies for the color reactions were purchased from Jackson ImmunoResearch and Molecular Probes. Signal was amplified by ABC kit (Vector) and color was developed by peroxidase substrate kit DAB (Vector).

Luciferase assay

A schematic diagram of the luciferase reporter construct is shown in Fig. 3A. The firefly luciferase gene, derived from pGL3-Basic vector (Promega), was cloned into pcDNA3.1(+) by Hind III and EcoR I. Rbl2 3′UTR fragment was cloned by PCR from C57BL/6 mouse genomic DNA and inserted into pcDNA3.1(+) behind firefly luciferase using EcoR I and Xho I. The primer sets for cloning are: sense, 5′ AGTCGAATTCTCTTCCTCTACTTAGTGCTTAC; anti-sense, 5′ AGTCCTCGAGGATAGTTTCTTTGGGATAACTAC. The point mutation procedure followed the instruction manual of QuickChange II Site-Directed Mutagenesis Kit (Stratagene). The primer sets for point mutations are: site 1 sense: 5′ AAGGAACCTGTGTAATTGGTGGGTGTTTATGGCTGTAAGATGCATAG; site 1 anti-sense: 5′ CTATGCATCTTACAGCCATAAACACCCACCAATTACACAGGTTCCTT; site 2 sense: 5′ GGGTTTGCTGTATATTTATGATGGGTGTTTCTATGGTGTGAACTTTGGTAG; site 2 anti-sense: 5′ CTACCAAAGTTCACACCATAGAAACACCCATCATAAATATACAGCAAACCC. 3×104 Hela cells were seeded per well in 24-well plate the day before transfection and then cells were transfected with 50ng firefly luciferase reporter vector, 50ng Renilla luciferase control vector pRL-SV40 (Promega) and 15 pmol Pre-miR miRNA Precursor Molecules (Ambion) per well by Lipofectamine 2000 (Invitrogen). 24h after transfection, luciferase signal was detected by Dual-Luciferase Reporter Assay System (Promega).

Results

The miR-17-92 cluster is expressed in both the endoderm and mesoderm of the developing lung

To determine which miRNAs are expressed in the developing lung, we carried out miRNA microarray analysis of total RNA from lungs of different embryonic stages and the adult (Fig. S1). We found that about 37% (73/198) of miRNAs have no or very low expression at any stage. By contrast, 36% (72/198) and 11% (22/198) of miRNAs have highest expression in the adult or early embryonic (E11.5) lung, respectively. Of the remainder, 11 show a peak at E17.5, the end of the canalicular stage, and the others show either two peaks of expression or little change during lung development.

The subclass of miRNAs shown by microarray analysis to be expressed at highest levels during early development included 6 members of the miR-17-92 cluster (Fig. 1B). This result was confirmed by Northern blot analysis (Fig. 1C). We also carried out miRNA cloning from small RNA extracted from lungs at E11.5 and E17.5. We found that more than 10% of the total small RNA clones come from the miR-17-92 cluster at E11.5 (Table 1). Five members of the cluster, miR-17-5p, miR-18, miR-19b, miR-20a and miR-92, have relatively high abundance, while miR-19a has very low abundance and miR-17-3p is not represented at all. As expected, the abundance of all six miRNAs decreases at E17.5, but the fold decrease differs among the cluster members. For example, miR-19b decreases 11 fold in abundance while the decrease in miR-17-5p is less than 2 fold. Another homologous miRNA cluster, miR-106a-363 which also contains miR-19b and miR-92 (Fig. 1A), exists on chromosome X. However, no clone of miR-106a, miR-18X, miR-20b and miR-363 was found at E11.5 or E17.5, suggesting that this cluster is not active in the lung.

Table 1.

miR E11.5 E17.5
17-5p 2.2% 1.9%
18 2.0% 1.1%
19a 0.1% 0.1%
19b 1.1% 0.1%
20 3.5% 0.7%
92 1.6% 0.7%
Open in a new tab

In situ hybridization with LNA probes to three members of the cluster, miR-17-5p, miR-19b and miR-20 supports the conclusion that the gene is widely, but not uniformly expressed in the E11.5 embryo (Fig. 2A–C). All three miRNAs have high expression levels in the central and peripheral nervous system and dorsal root ganglia, somite mesoderm and in many internal organs, including the lung, intestine, and stomach. However, the liver has only very weak expression (Fig. 2H). In the E11.5 and E12.5 lungs, the three members are expressed in both the endoderm and mesoderm (Fig. 2C–G, I–L). In the endodermal epithelial cells, the miRNAs appear to locate most strongly to the apical cytoplasm (Fig. 2F, I, K).

Figure 2.

Figure 2

Open in a new tab

MiR-17-92 expression in embryos and lungs. (A,B) E11.5 mouse embryos. (C,D) E12.5 lungs. (E-L) Cross section of E11.5 embryos and lungs. In situ hybridization of miR-17-5p, miR-19b and miR-20 were performed using LNA probes (whole mount: A–D; paraffin section: E–L). (D,F,I) High magnification of regions boxed in (C), (E) and (H) respectively. The negative control for in situ hybridization was done without the probes. (C, D, E, H) Scale bar = 200μm; (F, G, I, J, K, L) Scale bar = 50μm.

Abnormal lung development in miR-17-92 transgenic embryos and new born pups

To test the function of miR-17-92 in lung development, we over-expressed the whole cluster in the lung epithelium of transgenic embryos using the mouse surfactant protein C promoter (Fig. 3A). In total, 10 transgenic founders were obtained, which were Sftpc-miR-17-92 positive by PCR. Of these, 8 were collected at E18.5 and 5 of them showed an obvious hypercellularity phenotype in the lung (Fig. 3C,E). The 3 that showed no phenotype did not express the transgene, as judged by microRNA microarray analysis (Fig. S2). Two female founders survived and were crossed with wild type males. One mother delivered normal pups. In situ hybridization suggested that this founder did not express the transgene (data not shown). However, the pups from the other mother showed an abnormal lung phenotype. Of a total of 64 pups, 27 (42%) were transgenic. Of these pups, 7 were born dead with a very abnormal lung phenotype. There was no air in their lungs, which suggests that they died within minutes of birth. The remainder were sacrificed at P0 and all showed an abnormal lung phenotype by histological analysis (Fig. 3F,H). When the lungs of the surviving female were examined, they were normal. From this we conclude that this transgenic female survived because she was mosaic for the transgene.

The normal E18.5 embryonic lung contains many small distal saccules or primitive alveoli, which are ready to open for respiration (Fig. 3B,D). After birth, air fully enters the lung, expanding the alveoli (Fig. 3F,H). By contrast, transgenic lungs contain few normal alveoli and are packed with numerous epithelial cells (Fig 3C,E,G,I). To assess the level of transgenic expression, we carried out microarray of lungs from one litter (six transgenic and six normal pups) born to the mosaic transgenic mother. All six miRNAs were clearly up-regulated (Fig. 3L). Among cluster members, miR-17-5p and miR-20a are up-regulated by about 5 fold, while the increases in miR-18, miR-19a, miR-19b and miR-92 appear less. Considering that we extracted the RNA from the whole lung lobe, the actual increase of expression in epithelial cells is likely to be higher than the value from the array. Although these pups all inherit the same transgene, the level of expression of the cluster still varies between individuals (Fig. S3).

In situ hybridization confirmed the over-expression of miRNAs in the transgenic lungs. MiR-17-5p is hardly detected in the normal P0 lung (Fig. 3J), while in the transgenic lung, a strong signal was observed in the epithelial cells. Significantly, the miRNA appears to be concentrated in the apical cytoplasm (Fig. 3K), as seen with the endogenous miRNAs at E11.5 and E12.5.

Elevated proliferation of epithelial cells in transgenic lungs

To address whether the hypercellularity of the transgenic lung involves epithelial cells, we carried out immunohistochemistry with antibody to Nkx2.1, which marks all lung epithelial cells. The transgenic lung has a significant higher percentage of Nkx 2.1 positive cells than the wild type (Fig. 4A, B).

Figure 4.

Figure 4

Open in a new tab

Elevated number and proliferation of epithelial cells in the transgenic lungs. (A,B) Nkx 2.1 (Titf1) immunostaining. (C,D) BrdU immunostaining. The percentage of BrdU and Nkx 2.1 positive cells in the total cells of the lung are shown in the top left corner of each digram. Scale bars = 50μm.

To look at cell proliferation, we injected BrdU to the pregnant mother at E18.5 and collected the embryos one hour later. When sections of a lung with a strong phenotype were analyzed the percentage of total cells that were BrdU labeled was about 4-fold higher than in the lung of a control, non-transgenic littermate (Fig. 4C, D). Significantly, no cell death was observed by cleaved caspase 3 staining in either transgenic or normal lungs (data not shown). Control samples (E13.5 normal digits) examined at the same time ensured that apoptotic cells would have been detected.

Epithelial cell differentiation in transgenic lungs

We used immunohistochemistry to examine P0 transgenic lungs for differentiation of proximal and distal epithelial cells. The proximal airways (intralobular bronchi and bronchioles) of transgenic lungs contain Clara cells (positive for Scgb1a1/CC10), ciliated cells (positive for β-tubulin) and neuroendocrine cells (positive for CGRP) (Fig. 5A–F). Significantly, lungs of the dead pups, which had the most severe phenotype and did not contain air, contain about three times more neuroendocrine cell clusters compared with non transgenic control pups collected just before birth (Fig. 5F,M).

Figure 5.

Figure 5

Open in a new tab

Epithelial progenitor cells persist in transgenic P0 lungs. (A,B) Scgb1a1/CC10, (C,D) β-tubulin, (E,F) CGRP, (G,H) Sox9, (I,J) Nmyc and (K,L) Sp-C were detected by immunostaining. The black arrowheads in (E) and (F) mark the CGRP positive neuroendocrine cell clusters. White arrowheads mark the Sp-C positive cells. (M) CGRP stained sections from the lungs of three dead pups and three prenatal embryos were counted for CGRP cluster numbers per millimeter luminal surface of bronchus. Tg: 1.01±0.08/mm, N: 0.32±0.04/mm. P<0.0002. (N) Increase of Nmyc mRNA was confirmed by microarray analysis. Three transgenic and three normal lungs were tested in the Affymatrix array. P<0.023. (A–B,D–J) Scale bars = 50um. (E,F) Scale bars = 100um. (K,L) Scale bars = 5μm. Tg: transgenic; N: normal.

The distal region of transgenic lungs was packed with large numbers of epithelial cells and showed few primitive alveoli. These cells still maintain high levels of Sox9 (Fig. 5H). This transcription factor is normally highly expressed in the distal epithelial cells before E16.5 and is virtually undectectable in the P0 lung (Okubo et al., 2005; Perl et al., 2005). The transgenic distal epithelial cells also express high levels of Nmyc by immunohistochemistry (Fig. 5I,J). This finding was confirmed by microarray analysis of RNA extracted from transgenic and control lungs which shows a ~3 fold increase of Nmyc mRNA (Fig. 5N). Furthermore, few cells in the transgenic distal lung have strong Sp-C staining (Fig. 5L). Many of the distal cells have weak signal, which is not easily distinguishable from the background.

Analysis of lungs from E18.5 embryos also showed an abnormal phenotype that varied between individuals. In some transgenic embryos, expression of the differentiated cell marker, Scgb1a1, was significantly reduced (Fig. 6E). In two, only a very few weak positive cells were seen in the smaller bronchi and bronchioles (Fig. 6F). Similar patterns were also seen for β-tubulin staining (data not shown). The distal epithelial cells of these transgenic lungs were Sox9 positive as seen in the transgenic P0 lungs (Fig. 6H,I). The difference between E18.5 and P0 lungs suggests that not only is the proliferation of distal progenitor cells enhanced by overexpression of miR-17-92, but also the differentiation of proximal cells is delayed.

Figure 6.

Figure 6

Open in a new tab

Differentiation of proximal epithelial cells is inhibited in transgenic embryos. (A–C) H&E staining of normal and two transgenic E18.5 lungs. (D–F) Scgb1a1/CC10 immunostaining. (G–I) Sox9 immunostaining. Scale bars = 50μm.

Evidence that miR-17-5p targets retinoblastoma-like 2 (Rbl2/p130)

To elucidate the possible mechanism causing the phenotype of miR-17-92 transgenic lungs, we first used three well known miRNA target programs (TargetScan, MiRanda and PicTar) to predict 100 potential targets. Then we overlapped these 100 genes with 9,497 genes downregulated in the transgenic lungs derived from Affymetrix array. From this we obtained 65 candidate targets. Among them, Rbl2 was selected for analysis for three reasons: First, Rbl2 was predicted with a high score by three programs to have two miR-17-5p family target sites in the 3′UTR. Second, microarray analysis showed that the mRNA of Rbl2 is down-regulated by about 10% in the transgenic lungs compared with controls (Fig. 7D). Such a small downregulation is consistent with the behavior of mRNAs targeted by miRNAs (Lim et al., 2005). Third, conditional deletion of all three genes of the Rb family in the the lung results in epithelial hyperplasia and an increase in neuroendocrine clusters (Wikenheiser-Brokamp, 2004). We therefore linked the 3′UTR of Rbl2 to firefly luciferase driven by the CMV promoter (Fig. 7A), and transfected this reporter construct into HeLa cells. Co-transfection with a synthetic miR-17-5p precursor gave a decrease in the luciferase signal by about 20% compared with a control miRNA precursor. Mutation of the 3 nucleotides within the seed sequences of both putative target sites in the 3′UTR abolished this downregulation (Fig. 7C). To test whether the Rbl2 protein is regulated by miR-17-5p in vivo, we performed immunohistochemistry of transgenic and normal lungs using antibody to Rbl2. This showed that the level of Rbl2 in transgenic lung epithelial cells was significantly reduced compared with non-transgenic controls (Fig. 7H).

Figure 7.

Figure 7

Open in a new tab

Evidence that the 3′UTR of Rbl2 is targeted by miR-17-5p. (A) Schematic diagram of luciferase assay. 676bp of Rbl2 3′UTR containing two predicted target sites were cloned into the 3′ end of the firefly luciferase gene. (B) Positive control assay was performed using a sensor construct, s17, in which three perfect miR-17-5p anti-sense fragments were cloned to the 3′end of firefly luciferase. n=3. The data from the control wells, which have the control miRNA (miR-Con), is normalized to 1. (C) Rbl2 and Rbl2M 3′UTR were tested in the luciferase assay. Rbl2M is the Rbl2 3′UTR fragment with 3 point mutations in each predicted target site. Firefly luciferase reportor construct, renilla luciferase internal control vector and miRNA were co-transfected to Hela cells. P<0.002, n=9. (D) Rbl2 mRNA level is slightly decreased in transgenic lungs by microarray analysis. Two probes, Rbl2-1 and Rbl2-2, show similar ~10% down-regulation in transgenic lungs. Three transgenic and three normal P0 lung RNA samples were tested in the array. (E) Section through normal P0 lung interlobular airway. DIC image. (F) Immunofluorescence image using antibody to Rbl2. The white arrowheads mark the epithelial cells expressing high levels of the protein in the nuclear and perinuclear locations. (G) Section through transgenic P0 lung airway. (H) Immunofluorescence image of the same section of (G). Note lower levels of Rbl2 protein. Tg: transgenic; N: normal. Scale bar: 5μm.

Discussion

In this paper we have identified a total of 198 miRNAs differentially expressed during mouse lung development. We have focused on the miR-17-92 cluster which is highly expressed in both the epithelium and mesenchyme at E11.5 and declines gradually until it is barely detectable in the adult. We hypothesized that high level of miR-17-92 cluster help to maintain lung progenitor cells in a proliferative and undifferentiated state. To test this hypothesis we generated transgenic embryos which maintain this high expression level in the epithelium throughout development. Both hyperproliferation and diminished differentiation of distal epithelial cells were observed in the transgenic lungs. Our finding that miR-17-5p regulates the novel target, Rbl2, can partially explain the abnormal phenotype.

MiRNA expression patterns in the lung

We found that miRNAs expressed in the developing lung fall into several distinct subclasses. The majority, including miR-1 and Let-7 have highest expression in the adult. In other systems, miR-1 has been shown to promote the differentiation and maintain the differentiated state of cardiac and skeletal muscle (Chen et al., 2006; Zhao et al., 2007), while Let-7 limits cell growth in culture by targeting Ras (Johnson et al., 2005). It is possible that in the lung these miRNAs have a similar function. Significantly, Fgf signaling is important for the proliferation of early lung progenitor epithelial cells (White et al., 2006) and the regulation of FGF signaling mainly depends on the Ras/MAP kinase pathway (Thisse and Thisse, 2005). So the low level of Let-7 may facilitate high proliferation of lung progenitors in early development, while the adult lung needs a high level of Let-7 to slow down cell growth by targeting Ras. Loss of Let-7 could help to elevate levels of Ras in lung cancer (Johnson et al., 2005).

MiR-17-92 cluster expression

Among the miRNAs most highly expressed in the embryonic lung were some (but not all) members of the miR-17-92 cluster. This cluster encodes seven miRNAs within a 1kb region and is believed to be transcribed as one primary transcript. However, both the microarray and microRNA cloning data show that the expression level of individual cluster members varies, as reported previously (Mineno et al., 2006). Differences in the efficiency of post-transcriptional processing steps, mediated by Drosha (Han et al., 2006), Exportin5 and Dicer (Lund and Dahlberg, 2006), may account for this. However, it is still difficult to explain why the abundance of miRNAs within the cluster does not change co-ordinately between E11.5 and E17.5. One possibility is that unknown processing mechanisms exist that affect some members of the cluster but not others. This hypothesis is supported by evidences for post-transcriptional regulation of some miRNAs (Obernosterer et al., 2006; Thomson et al., 2006; Wulczyn et al., 2007).

Relationship between miR-17-92 cluster expression and Nmyc function in the developing lung

The miR-17-92 cluster was recently reported to be up-regulated by the proto-oncogene Myc (Dews et al., 2006; O’Donnell et al., 2005). Myc is a member of proto-oncogene family (Myc, Lmyc and Nmyc), which encodes basic helix-loop-helix leucine zipper (bHLHz) proteins. One gene regulated by Myc is E2f1, which is targeted by miR-17-5p and miR-20a. Since E2f1 can also induce Myc expression (Matsumura et al., 2003), it was suggested that the negative regulation of E2f1 by miR-17-5p and miR-20a could dampen Myc-E2f1 reciprocal activation (O’Donnell et al., 2005).

In the lung, Nmyc is specifically expressed in the epithelium, while Myc is transcribed only in the mesenchyme. Over-expression of Nmyc in the lung epithelium under the control of human Sftpc regulatory elements caused elevated cell proliferation and inhibition of differentiation, with a phenotype very similar to the phenotype of miR-17-92 cluster transgenic mice (Okubo et al., 2005). So it was surprising that no significant up-regulation of the miR-17-92 cluster was observed in the NmycEGFP transgenic lungs (Fig. S4) despite the structural and functional similarity between Myc and Nmyc. On the contrary, levels of Nmyc are still high in Sftpc-miR-17-92 transgenic lungs. We do not know whether the high level of Nmyc is due to the large number of undifferentiated, Nmyc expressing epithelial cells or to higher Nmyc expression per cell, or both. At least, it suggests that high levels of the miR-17-92 cluster does not negatively regulate Nmyc expression. This conclusion is supported by evidence of augmentation of Myc-induced tumor formation by co-over-expression of the miR-17-92 cluster (Dews et al., 2006; He et al., 2005).

Possible mechanisms underlying the abnormal cell proliferation and differentiation phenotype of transgenic lungs

Up to now, several genes have been identified as targets of members of the miR-17-92 cluster by in vitro assays and therefore need to be considered as candidate targets in the developing lung. These include E2f1 (targeted by miR-17-5p/20a), Pten (targeted by miR19), Ncoa3 (targeted by miR-17-5p), Thbs1 (thrombospondin, targeted by miR19) and Ctgf (connective tissue growth factor, targeted by miR-18) (Dews et al., 2006; Hossain et al., 2006; Lewis et al., 2003; O’Donnell et al., 2005). Among them, Ctgf is not apparently expressed in the embryonic lung (Ivkovic et al., 2003) so it is not considered further here. Of the remaining candidates, Ncoa3, which encodes nuclear receptor co-activator 3, is amplified in several cancers and acts as a proto-oncogene (Torres-Arzayus et al., 2004). Ncoa3 null mutant mice are smaller than normal and cells derived from mutant embryos show decreased proliferation in response to insulin-like growth factor 1 (Wang et al., 2000). It therefore appears unlikely that downregulation of this protein would be a major cause underlying the hyperproliferative phenotype reported here in miR-17-92 transgenic lungs.

Another potential target, E2f1, encodes a transcription factor that promotes cell proliferation by transactivating genes required for G1 to S transition (DeGregori et al., 1997; Johnson et al., 1993). Deceased levels of E2f1 results in reduced apoptosis (Field et al., 1996; Holmberg et al., 1998). Since neither the normal developing lung nor transgenic lungs show evidence of apoptosis, it is unlikely that miR-17-92 functions to promote expansion of the progenitor cells through inhibition of apoptosis by downregulating E2f1.

Pten is a well known tumor suppressor gene that normally restricts cell proliferation. Embryos lacking Pten die before E10.5, while heterozygous mutant mice show increased tumor incidence or hyperplasia in many tissues, including the mammary gland, prostate and lymphoid system (Di Cristofano et al., 1998; Freeman et al., 2006). Although a lung phenotype was not reported in these heterozygotes, it is possible that downregulation of Pten could contribute to the abnormal phenotype seen here. Microarray analysis showed the Pten mRNA level is downregulated by 20–30% in the transgenic lungs (Table S1).

Thbs1 is an extracellular calcium binding protein with multiple functions (Adams and Lawler, 2004). At E11.5, Thbs1 mRNA is detected in distal epithelial cells (Liu and Hogan, 2002) and Thbs1 protein is localized to the basal lamina of both the embryonic and adult lung epithelium (O’Shea and Dixit, 1988; Wight et al., 1985). In addition, Thbs1 is secreted by alveolar macrophages and type II cells (Sage et al., 1983; Yehualaeshet et al., 1999). Mice homozygous null for Thbs1 have hyperplasia in many tissues, including lung bronchial epithelium (Crawford et al., 1998). However, this phenotype may in large part be secondary to strong inflammation (Lawler et al., 1998). It is therefore unclear whether down regulation of the gene during lung development affects proliferation and differentiation.

Here, we provide evidence that another important tumor suppressor, Rbl2, is a target of miR-17-5p. Rbl2 belongs to the Rb pocket protein family, which also contains Rb and Rbl1/p107. All three members share extensive structural homology and can inhibit E2f responsive promoters (Classon and Dyson, 2001). Rbl1 and Rbl2 can at least partially compensate for loss of Rb function in vivo (Lipinski and Jacks, 1999). Studies using both in situ hybridization and Northern blot have shown that expression of Rbl2 increases during late embryonic development and are maintained at relatively high levels in the adult lung (Chen et al., 1996; Jiang et al., 1997; Pertile et al., 1995). In addition, Rbl2 mRNA is transcribed in both endoderm and mesoderm of the lung (Jiang et al., 1997). Our immunohistochemistry data shows that Rbl2 protein more abundant in non-transgenic epithelial cells compared to transgenic (Fig. 7E–H). Taken together, all these observations support Rbl2 is a direct target of miR-17-5p during normal lung development.

Recently, pocket proteins have been shown to inhibit neuroendocrine cell fate in the lung. Conditional deletion of Rb or the whole Rb family, including Rbl2, leads to epithelial cell hyperplasia and to an increase in both the number and size of neuroendocrine clusters (Wikenheiser-Brokamp, 2004). Loss of RBL2 gene is correlated with small cell lung cancer (Baldi et al., 1996; Helin et al., 1997; Xue Jun et al., 2003), which is considered to have a neuroendocrine cell origin. A significant increase in neuroendocrine cell clusters is also observed in our miR-17-92 transgenic P0 lungs, which supports the idea that pocket proteins could be miRNA targets. Although the whole Rb family has been predicted to be targeted by miR-17-5p, only the highest scored Rbl2 showed significant down-regulation in our luciferase assay (data not shown). Whether knocking down Rbl2 alone can also lead to hypercellularity of neuroendocrine cells is unclear, since no obvious phenotype has been reported in Rbl2 null mutant mice (Cobrinik et al., 1996).

In conclusion, we cannot expect to explain the phenotype of Spc-miR-17-92 transgenic lungs by any single target gene and there are likely more targets which have not yet been discovered. To address which target or targets are most important for the regulation of progenitor cell proliferation and differentiation during lung development is a topic for future research.

Supplementary Material

01

Figure S1 Expression pattern of miRNAs during lung development by miRNA microarray. Three independent RNA extractions (4μg) from E11.5, E13.5, E15.5, E17.5 and Adult lungs were analyzed on the array. Most lung expressed miRNAs were divided into different groups by their expression peak at E11.5, E17.5 or adult. Other miRNAs have two expression peaks or have no significant change in expression during lung development. Yellow is high expression; blue is low.

02

Figure S2 Microarray analysis of the miR-17-92 expression of different transgenic embryos from one litter. No miRNA over-expression was found in Tg2*, and it had no phenotype either. On the contrary, Tg1 had high overexpression level and a strong phenotype. Tg: transgenic; N: non-transgenic.

03

Figure S3 Microarray analysis of the miRNA expression of one whole litter from the transgenic mosaic female founder. The RNA was extracted from P0 lungs. Tg1* has the highest miRNA levels and was born dead. Tg: transgenic; N: non-transgenic.

04

Figure S4 Heatmap to show expression of miR-17-92 cluster members in Sftpc-Nmyc transgenic mice. Two Nmyc transgenic and two normal E18.5 lungs were taken from the embryos in one litter. The total RNA (4μg) was hybridized to the microarray.

05

Table S1 Gene expression in the transgenic and normal P0 lungs. Three transgenic and three nontransgenic litter mates were sacrificed for the Affymetrix array analysis.

Acknowledgments

We thank Dr. Edward Morrisey (University of Pennsylvania) for providing us with the mouse Sftpc promoter. We thank Dr. Fan Wang and members of Hogan lab for critical comments on the manuscript. This work was supported by NIH grant HL 071303 to BLMH. Dr. J. Michael Thomson is supported by the American Cancer Society.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Adams JC, Lawler J. The thrombospondins. Int J Biochem Cell Biol. 2004;36:961–8. doi: 10.1016/j.biocel.2004.01.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Andl T, et al. The miRNA-processing enzyme dicer is essential for the morphogenesis and maintenance of hair follicles. Curr Biol. 2006;16:1041–9. doi: 10.1016/j.cub.2006.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Baldi A, et al. Differential expression of the retinoblastoma gene family members pRb/p105, p107, and pRb2/p130 in lung cancer. Clin Cancer Res. 1996;2:1239–45. [PubMed] [Google Scholar]
  4. Bernstein E, et al. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature. 2001;409:363–6. doi: 10.1038/35053110. [DOI] [PubMed] [Google Scholar]
  5. Bernstein E, et al. Dicer is essential for mouse development. Nat Genet. 2003;35:215–7. doi: 10.1038/ng1253. [DOI] [PubMed] [Google Scholar]
  6. Cai X, et al. Human microRNAs are processed from capped, polyadenylated transcripts that can also function as mRNAs. Rna. 2004;10:1957–66. doi: 10.1261/rna.7135204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cardoso WV, Lu J. Regulation of early lung morphogenesis: questions, facts and controversies. Development. 2006;133:1611–24. doi: 10.1242/dev.02310. [DOI] [PubMed] [Google Scholar]
  8. Chen G, et al. Molecular cloning and developmental expression of mouse p130, a member of the retinoblastoma gene family. J Biol Chem. 1996;271:9567–72. [PubMed] [Google Scholar]
  9. Chen JF, et al. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. Nat Genet. 2006;38:228–33. doi: 10.1038/ng1725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Classon M, Dyson N. p107 and p130: versatile proteins with interesting pockets. Exp Cell Res. 2001;264:135–47. doi: 10.1006/excr.2000.5135. [DOI] [PubMed] [Google Scholar]
  11. Cobrinik D, et al. Shared role of the pRB-related p130 and p107 proteins in limb development. Genes Dev. 1996;10:1633–44. doi: 10.1101/gad.10.13.1633. [DOI] [PubMed] [Google Scholar]
  12. Crawford SE, et al. Thrombospondin-1 is a major activator of TGF-beta1 in vivo. Cell. 1998;93:1159–70. doi: 10.1016/s0092-8674(00)81460-9. [DOI] [PubMed] [Google Scholar]
  13. DeGregori J, et al. Distinct roles for E2F proteins in cell growth control and apoptosis. Proc Natl Acad Sci U S A. 1997;94:7245–50. doi: 10.1073/pnas.94.14.7245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dews M, et al. Augmentation of tumor angiogenesis by a Myc-activated microRNA cluster. Nat Genet. 2006;38:1060–5. doi: 10.1038/ng1855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Di Cristofano A, et al. Pten is essential for embryonic development and tumour suppression. Nat Genet. 1998;19:348–55. doi: 10.1038/1235. [DOI] [PubMed] [Google Scholar]
  16. Field SJ, et al. E2F-1 functions in mice to promote apoptosis and suppress proliferation. Cell. 1996;85:549–61. doi: 10.1016/s0092-8674(00)81255-6. [DOI] [PubMed] [Google Scholar]
  17. Freeman D, et al. Genetic background controls tumor development in PTEN-deficient mice. Cancer Res. 2006;66:6492–6. doi: 10.1158/0008-5472.CAN-05-4143. [DOI] [PubMed] [Google Scholar]
  18. Giraldez AJ, et al. MicroRNAs regulate brain morphogenesis in zebrafish. Science. 2005;308:833–8. doi: 10.1126/science.1109020. [DOI] [PubMed] [Google Scholar]
  19. Han J, et al. Molecular basis for the recognition of primary microRNAs by the Drosha-DGCR8 complex. Cell. 2006;125:887–901. doi: 10.1016/j.cell.2006.03.043. [DOI] [PubMed] [Google Scholar]
  20. Harris KS, et al. Dicer function is essential for lung epithelium morphogenesis. Proc Natl Acad Sci U S A. 2006;103:2208–13. doi: 10.1073/pnas.0510839103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hayashita Y, et al. A polycistronic microRNA cluster, miR-17-92, is overexpressed in human lung cancers and enhances cell proliferation. Cancer Res. 2005;65:9628–32. doi: 10.1158/0008-5472.CAN-05-2352. [DOI] [PubMed] [Google Scholar]
  22. He L, Hannon GJ. MicroRNAs: small RNAs with a big role in gene regulation. Nat Rev Genet. 2004;5:522–31. doi: 10.1038/nrg1379. [DOI] [PubMed] [Google Scholar]
  23. He L, et al. A microRNA polycistron as a potential human oncogene. Nature. 2005;435:828–33. doi: 10.1038/nature03552. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Helin K, et al. Loss of the retinoblastoma protein-related p130 protein in small cell lung carcinoma. Proc Natl Acad Sci U S A. 1997;94:6933–8. doi: 10.1073/pnas.94.13.6933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Holmberg C, et al. E2F-1-induced p53-independent apoptosis in transgenic mice. Oncogene. 1998;17:143–55. doi: 10.1038/sj.onc.1201915. [DOI] [PubMed] [Google Scholar]
  26. Hossain A, et al. Mir-17-5p regulates breast cancer cell proliferation by inhibiting translation of AIB1 mRNA. Mol Cell Biol. 2006;26:8191–201. doi: 10.1128/MCB.00242-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Houbaviy HB, et al. Embryonic stem cell-specific MicroRNAs. Dev Cell. 2003;5:351–8. doi: 10.1016/s1534-5807(03)00227-2. [DOI] [PubMed] [Google Scholar]
  28. Hutvagner G, et al. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science. 2001;293:834–8. doi: 10.1126/science.1062961. [DOI] [PubMed] [Google Scholar]
  29. Ivkovic S, et al. Connective tissue growth factor coordinates chondrogenesis and angiogenesis during skeletal development. Development. 2003;130:2779–91. doi: 10.1242/dev.00505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Jiang Z, et al. The retinoblastoma gene family is differentially expressed during embryogenesis. Oncogene. 1997;14:1789–97. doi: 10.1038/sj.onc.1201014. [DOI] [PubMed] [Google Scholar]
  31. Johnson DG, et al. Expression of transcription factor E2F1 induces quiescent cells to enter S phase. Nature. 1993;365:349–52. doi: 10.1038/365349a0. [DOI] [PubMed] [Google Scholar]
  32. Johnson SM, et al. RAS is regulated by the let-7 microRNA family. Cell. 2005;120:635–47. doi: 10.1016/j.cell.2005.01.014. [DOI] [PubMed] [Google Scholar]
  33. Khvorova A, et al. Functional siRNAs and miRNAs exhibit strand bias. Cell. 2003;115:209–16. doi: 10.1016/s0092-8674(03)00801-8. [DOI] [PubMed] [Google Scholar]
  34. Knuutila S, et al. DNA copy number amplifications in human neoplasms: review of comparative genomic hybridization studies. Am J Pathol. 1998;152:1107–23. [PMC free article] [PubMed] [Google Scholar]
  35. Lau NC, et al. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 2001;294:858–62. doi: 10.1126/science.1065062. [DOI] [PubMed] [Google Scholar]
  36. Lawler J, et al. Thrombospondin-1 is required for normal murine pulmonary homeostasis and its absence causes pneumonia. J Clin Invest. 1998;101:982–92. doi: 10.1172/JCI1684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Lee Y, et al. The nuclear RNase III Drosha initiates microRNA processing. Nature. 2003;425:415–9. doi: 10.1038/nature01957. [DOI] [PubMed] [Google Scholar]
  38. Lee Y, et al. MicroRNA maturation: stepwise processing and subcellular localization. Embo J. 2002;21:4663–70. doi: 10.1093/emboj/cdf476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Lewis BP, et al. Prediction of mammalian microRNA targets. Cell. 2003;115:787–98. doi: 10.1016/s0092-8674(03)01018-3. [DOI] [PubMed] [Google Scholar]
  40. Lim LP, et al. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature. 2005;433:769–73. doi: 10.1038/nature03315. [DOI] [PubMed] [Google Scholar]
  41. Lipinski MM, Jacks T. The retinoblastoma gene family in differentiation and development. Oncogene. 1999;18:7873–82. doi: 10.1038/sj.onc.1203244. [DOI] [PubMed] [Google Scholar]
  42. Liu Y, Hogan BL. Differential gene expression in the distal tip endoderm of the embryonic mouse lung. Gene Expr Patterns. 2002;2:229–33. doi: 10.1016/s1567-133x(02)00057-1. [DOI] [PubMed] [Google Scholar]
  43. Lund E, Dahlberg JE. Substrate selectivity of exportin 5 and Dicer in the biogenesis of microRNAs. Cold Spring Harb Symp Quant Biol. 2006;71:59–66. doi: 10.1101/sqb.2006.71.050. [DOI] [PubMed] [Google Scholar]
  44. Matsumura I, et al. E2F1 and c-Myc in cell growth and death. Cell Cycle. 2003;2:333–8. [PubMed] [Google Scholar]
  45. Mineno J, et al. The expression profile of microRNAs in mouse embryos. Nucleic Acids Res. 2006;34:1765–71. doi: 10.1093/nar/gkl096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. O’Donnell KA, et al. c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005;435:839–43. doi: 10.1038/nature03677. [DOI] [PubMed] [Google Scholar]
  47. O’Shea KS, Dixit VM. Unique distribution of the extracellular matrix component thrombospondin in the developing mouse embryo. J Cell Biol. 1988;107:2737–48. doi: 10.1083/jcb.107.6.2737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Obernosterer G, et al. Post-transcriptional regulation of microRNA expression. Rna. 2006;12:1161–7. doi: 10.1261/rna.2322506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Okubo T, et al. Nmyc plays an essential role during lung development as a dosage-sensitive regulator of progenitor cell proliferation and differentiation. Development. 2005;132:1363–74. doi: 10.1242/dev.01678. [DOI] [PubMed] [Google Scholar]
  50. Perl AK, et al. Normal lung development and function after Sox9 inactivation in the respiratory epithelium. Genesis. 2005;41:23–32. doi: 10.1002/gene.20093. [DOI] [PubMed] [Google Scholar]
  51. Pertile P, et al. Molecular cloning, expression, and developmental characterization of the murine retinoblastoma-related gene Rb2/p130. Cell Growth Differ. 1995;6:1659–64. [PubMed] [Google Scholar]
  52. Sage H, et al. Granular pneumocytes in primary culture secrete several major components of the extracellular matrix. Biochemistry. 1983;22:2148–55. doi: 10.1021/bi00278a015. [DOI] [PubMed] [Google Scholar]
  53. Schwarz DS, et al. Asymmetry in the assembly of the RNAi enzyme complex. Cell. 2003;115:199–208. doi: 10.1016/s0092-8674(03)00759-1. [DOI] [PubMed] [Google Scholar]
  54. Thisse B, Thisse C. Functions and regulations of fibroblast growth factor signaling during embryonic development. Dev Biol. 2005;287:390–402. doi: 10.1016/j.ydbio.2005.09.011. [DOI] [PubMed] [Google Scholar]
  55. Thomson JM, et al. Extensive post-transcriptional regulation of microRNAs and its implications for cancer. Genes Dev. 2006;20:2202–7. doi: 10.1101/gad.1444406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Thomson JM, et al. A custom microarray platform for analysis of microRNA gene expression. Nat Methods. 2004;1:47–53. doi: 10.1038/nmeth704. [DOI] [PubMed] [Google Scholar]
  57. Torres-Arzayus MI, et al. High tumor incidence and activation of the PI3K/AKT pathway in transgenic mice define AIB1 as an oncogene. Cancer Cell. 2004;6:263–74. doi: 10.1016/j.ccr.2004.06.027. [DOI] [PubMed] [Google Scholar]
  58. Volinia S, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A. 2006;103:2257–61. doi: 10.1073/pnas.0510565103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Wang Z, et al. Regulation of somatic growth by the p160 coactivator p/CIP. Proc Natl Acad Sci U S A. 2000;97:13549–54. doi: 10.1073/pnas.260463097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. White AC, et al. FGF9 and SHH signaling coordinate lung growth and development through regulation of distinct mesenchymal domains. Development. 2006;133:1507–17. doi: 10.1242/dev.02313. [DOI] [PubMed] [Google Scholar]
  61. Wight TN, et al. Light microscopic immunolocation of thrombospondin in human tissues. J Histochem Cytochem. 1985;33:295–302. doi: 10.1177/33.4.3884704. [DOI] [PubMed] [Google Scholar]
  62. Wikenheiser-Brokamp KA. Rb family proteins differentially regulate distinct cell lineages during epithelial development. Development. 2004;131:4299–310. doi: 10.1242/dev.01232. [DOI] [PubMed] [Google Scholar]
  63. Wulczyn FG, et al. Post-transcriptional regulation of the let-7 microRNA during neural cell specification. Faseb J. 2007;21:415–26. doi: 10.1096/fj.06-6130com. [DOI] [PubMed] [Google Scholar]
  64. Xue Jun H, et al. Reduced transcription of the RB2/p130 gene in human lung cancer. Mol Carcinog. 2003;38:124–9. doi: 10.1002/mc.10152. [DOI] [PubMed] [Google Scholar]
  65. Yang WJ, et al. Dicer is required for embryonic angiogenesis during mouse development. J Biol Chem. 2005;280:9330–5. doi: 10.1074/jbc.M413394200. [DOI] [PubMed] [Google Scholar]
  66. Yehualaeshet T, et al. Activation of rat alveolar macrophage-derived latent transforming growth factor beta-1 by plasmin requires interaction with thrombospondin-1 and its cell surface receptor, CD36. Am J Pathol. 1999;155:841–51. doi: 10.1016/s0002-9440(10)65183-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Yi R, et al. Morphogenesis in skin is governed by discrete sets of differentially expressed microRNAs. Nat Genet. 2006;38:356–62. doi: 10.1038/ng1744. [DOI] [PubMed] [Google Scholar]
  68. Zeng Y, Cullen BR. Structural requirements for pre-microRNA binding and nuclear export by Exportin 5. Nucleic Acids Res. 2004;32:4776–85. doi: 10.1093/nar/gkh824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Zhao Y, et al. Dysregulation of cardiogenesis, cardiac conduction, and cell cycle in mice lacking miRNA-1-2. Cell. 2007;129:303–17. doi: 10.1016/j.cell.2007.03.030. [DOI] [PubMed] [Google Scholar]
  70. Zhao Y, et al. Serum response factor regulates a muscle-specific microRNA that targets Hand2 during cardiogenesis. Nature. 2005;436:214–20. doi: 10.1038/nature03817. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01

Figure S1 Expression pattern of miRNAs during lung development by miRNA microarray. Three independent RNA extractions (4μg) from E11.5, E13.5, E15.5, E17.5 and Adult lungs were analyzed on the array. Most lung expressed miRNAs were divided into different groups by their expression peak at E11.5, E17.5 or adult. Other miRNAs have two expression peaks or have no significant change in expression during lung development. Yellow is high expression; blue is low.

NIHMS32398-supplement-01.tif (12.6MB, tif)
02

Figure S2 Microarray analysis of the miR-17-92 expression of different transgenic embryos from one litter. No miRNA over-expression was found in Tg2*, and it had no phenotype either. On the contrary, Tg1 had high overexpression level and a strong phenotype. Tg: transgenic; N: non-transgenic.

NIHMS32398-supplement-02.tif (10.9MB, tif)
03

Figure S3 Microarray analysis of the miRNA expression of one whole litter from the transgenic mosaic female founder. The RNA was extracted from P0 lungs. Tg1* has the highest miRNA levels and was born dead. Tg: transgenic; N: non-transgenic.

NIHMS32398-supplement-03.tif (4.9MB, tif)
04

Figure S4 Heatmap to show expression of miR-17-92 cluster members in Sftpc-Nmyc transgenic mice. Two Nmyc transgenic and two normal E18.5 lungs were taken from the embryos in one litter. The total RNA (4μg) was hybridized to the microarray.

NIHMS32398-supplement-04.tif (1.2MB, tif)
05

Table S1 Gene expression in the transgenic and normal P0 lungs. Three transgenic and three nontransgenic litter mates were sacrificed for the Affymetrix array analysis.

NIHMS32398-supplement-05.xls (28.2MB, xls)

RESOURCES