Facilitation versus depression in cultured hippocampal neurons determined by targeting of Ca²⁺ channel Ca_vβ₄ versus Ca_vβ₂ subunits to synaptic terminals

Abstract

Ca²⁺ channel β subunits determine the transport and physiological properties of high voltage–activated Ca²⁺ channel complexes. Our analysis of the distribution of the Ca_vβ subunit family members in hippocampal neurons correlates their synaptic distribution with their involvement in transmitter release. We find that exogenously expressed Ca_vβ_4b and Ca_vβ_2a subunits distribute in clusters and localize to synapses, whereas Ca_vβ_1b and Ca_vβ₃ are homogenously distributed. According to their localization, Ca_vβ_2a and Ca_vβ_4b subunits modulate the synaptic plasticity of autaptic hippocampal neurons (i.e., Ca_vβ_2a induces depression, whereas Ca_vβ_4b induces paired-pulse facilitation [PPF] followed by synaptic depression during longer stimuli trains). The induction of PPF by Ca_vβ_4b correlates with a reduction in the release probability and cooperativity of the transmitter release. These results suggest that Ca_vβ subunits determine the gating properties of the presynaptic Ca²⁺ channels within the presynaptic terminal in a subunit-specific manner and may be involved in organization of the Ca²⁺ channel relative to the release machinery.

Introduction

High voltage–activated Ca²⁺ channels in neurons consist of several subunits, a pore-forming α₁ subunit (Ca_vα₁), and several auxiliary subunits, including α₂δ and β (Ca_vβ; Catterall, 2000). Ca_vβ subunits are involved in transport of the pore-forming α₁ subunit to the plasma membrane (Dolphin, 2003; Herlitze et al., 2003). Ca_vβ subunits shield an ER retention signal on the α₁ subunit, thereby guiding the pore-forming subunit to the target membrane (Bichet et al., 2000).

Ca_vβ subunits also determine the biophysical properties of the Ca²⁺ channel. The effects of the Ca_vβ subunit family members on the biophysical properties are complex. Four family members have been described (Ca_vβ_1–4). P/Q-type channels assembled with Ca_vβ_1b and β₃ subunits in heterologous expression systems are fast inactivating in comparison with Ca_vβ₄- and β₂-assembled channels (Stea et al., 1994; Fellin et al., 2004; Luvisetto et al., 2004). Ca_vβ₂ has the most dramatic effects on the channel properties, causing the channel to inactivate very slowly. In addition, the Ca_vβ₂ subunit is unique because this subunit can be attached to the plasma membrane via its palmitoylated N-terminal protein domain (Chien et al., 1998).

Several studies also suggest that at least certain Ca_vβ subunit family members can target and function independently of the Ca_vα₁ subunits at the plasma membrane and other intracellular structures such as the nucleus. For example, these subunits may be involved in gene transcription (Hibino et al., 2003) and the regulation of Ca²⁺ oscillations and insulin secretion (Berggren et al., 2004).

Recently, the crystal structures of the Ca_vβ core domains and the interaction domain between Ca_vβ and Ca_vα₁ have been determined (Chen et al., 2004; Opatowsky et al., 2004; Van Petegem et al., 2004). These studies revealed that the Ca_vβ subunits belong to the membrane-associated guanylate kinase family containing Src homology type 3 and guanylate kinase domains (Hanlon et al., 1999; Richards et al., 2004; Rousset et al., 2005). A mutagenesis study of the Src homology type 3 and guanylate kinase domains showed that these domains regulate the inactivation of these Ca²⁺ channels (McGee et al., 2004) but also suggested that Ca_vβ subunits are involved in scaffolding and in the precise localization of Ca²⁺ channel complexes to defined subcellular domains. Indeed, deletion of the nonconserved N and C termini of the Ca_vβ_4b subunit results in a loss of synaptic localization and presynaptic function (Wittemann et al., 2000). In addition, the isolated N terminus of Ca_vβ_4a is capable of interacting with proteins of the vesicle release machinery (Vendel et al., 2006).

All Ca_vβ subunits are expressed in the brain. Their subcellular distribution within neurons reveals that they are localized to neuronal cell bodies and dendrites. In addition, Ca_vβ has been suggested to be localized to synaptic terminals (Herlitze and Mark, 2005). However, its precise function for determining synaptic transmission and, in particular, synaptic plasticity is unclear. Therefore, the goal of this study is to analyze the distribution of endogenously and exogenously expressed Ca_vβ subunits in hippocampal neurons and to correlate their distribution with their effects on synaptic transmission. Our results suggest that Ca_vβ_2a and Ca_vβ_4b subunits are targeted to presynaptic terminals, where they determine whether synapses facilitate or depress.

Results

Distribution of endogenous Ca_vβ subunits in hippocampal neurons

We first investigated whether hippocampal neurons in culture express endogenous Ca_vβ subunits, as would be predicted by the presence of the endogenous high voltage–activated Ca²⁺ channels (Reid et al., 1998; Wittemann et al., 2000). We produced a peptide-derived antibody, which recognizes all β-subunit family members (pan-β antibody). As indicated in Fig. 1 A, the antibody recognized specifically Ca_vβ subunits in hippocampal neurons, as demonstrated by antagonistic action of the epitope peptide (not depicted). Many, but not all, of the puncta colocalize with the synaptic markers synaptobrevin 2 (Fig. 1, A–C) and synapsin 1 (Fig. 1 D). The subunits are expressed throughout the neuron with high and uniform staining detected in the soma and proximal dendrites, with more clustered distribution in synaptic areas. We next analyzed whether we could detect Ca_vβ subunit–specific mRNAs in these neurons and whether we could see quantitative differences among the four different Ca_vβ mRNAs. As a positive control, we used 18S RNA. Real-time PCR revealed the highest mRNA levels for the Ca_vβ₃ subunits and lower mRNA levels for Ca_vβ_1,2,4 (Ca_vβ₁ ≥ Ca_vβ₄ ≥ Ca_vβ₂; Fig. 1 E). The results indicate that all four Ca_vβ subunits are expressed in hippocampal neurons in culture, which localize to the soma and to synapses.

Figure 1.

Endogenous distribution and expression of Ca_vβ subunits in cultured hippocampal neurons. (A–C) (A, green) Confocal pictures of the endogenous Ca_vβ subunits detected with a pan-β antibody reveal punctate staining. (B, red) Hippocampal neurons were stained with an anti–synaptobrevin-II antibody and visualized with an AlexaFluor546-coupled secondary antibody. (C) Overlay of A and B demonstrates that the endogenous Ca_vβ subunits are partially colocalized with the synaptic vesicle marker synaptobrevin-II. (right) Boxed areas show that several pan-staining puncta are colocalized with synaptobrevin-II (arrows). Magnification of the indicated areas from the neuron shown on the left. (D) Ca_vβ subunits colocalize with the synaptic marker synapsin-I. Confocal images of the endogenous Ca_vβ subunits in hippocampal neurons visualized with the pan-β antibody (left), synapsin-I visualized with an anti–synapsin-I antibody (middle), and overlay of the two pictures (right) reveal that endogenous Ca_vβ subunits partially colocalize with the presynaptic marker synapsin-I. (E) Endogenous Ca_vβ subunit mRNAs are expressed at different levels in cultured hippocampal neurons. The mRNA expression levels of Ca_vβ_2a, Ca_vβ₃, and Ca_vβ_4b were normalized to the mRNA level of the Ca_vβ_1b subunit. The bar graph shows that the Ca_vβ₃ mRNA level was approximately three times higher than Ca_vβ_1b, whereas the Ca_vβ_2a expression level was ∼50% lower (n = 12; **, P < 0.01) in comparison with Ca_vβ_1b. The mRNA expression level for Ca_vβ_4b was not different from that of Ca_vβ_1b. Error bars represent SEM. Bars (A–C), 25 μm; (D) 5 μm.

Distribution of exogenously expressed Ca_vβ subunits in hippocampal neurons

We next analyzed whether the exogenous expression of the Ca_vβ members resembles the endogenous distribution of the Ca_vβ subunits as determined in Fig. 1 and whether Ca_vβ subunits can target to synaptic sites when expressed alone in neurons (Fig. 2). We found that the Ca_vβ_1b and Ca_vβ₃ subunits reveal a more homogenous distribution, whereas the Ca_vβ_2a and Ca_vβ_4b subunits are highly clustered (Fig. 2, A–C). When cells expressing these exogenous subunits were immunostained with the synaptic marker synaptobrevin-II or synapsin-1, we found that Ca_vβ_4b subunits revealed a higher degree of colocalization with synaptic markers than Ca_vβ_2a. Association of the Ca_vβ subunits with the Ca_vα₁ subunits predicts that both proteins should be distributed in cytoplasmic as well as membrane regions, which we confirmed by Western blots from cytosolic and membrane fractions of whole rat brain using the pan-Ca_vβ antibody (Fig. 3, A and B). Exogenous expression of the Ca_vβ subunits revealed a similar distribution, with subtype-specific enrichment within either the cytoplasmic or the membrane fraction (Fig. 3 C). Ca_vβ_2a subunits are highly enriched in the membrane fraction, whereas Ca_vβ_1b was mostly concentrated in the cytoplasm (Fig. 3 C). Ca_vβ₃ and Ca_vβ₄ subunits were equally distributed in both fractions (Fig. 3 C). Because Ca²⁺ channel Ca_vβ_2a and Ca_vβ_4b subunits reveal a mainly punctuate distribution within the neurons, we wanted to know whether we can detect Ca_vβ subunits in presynaptic terminals on vesicles or vesicular structures (Fig. 4). The high expression levels of the GFP-tagged subunits allowed us to study their localization by immunoelectron microscopy. As a negative control, we used the untagged GFP overexpressed in hippocampal neurons. As shown in Fig. 4, Ca_vβ_2a and Ca_vβ_4b subunits were detected on vesicular structures (Fig. 4, A and B) and close to presynaptic terminals (Fig. 4, C and D). We also observed that both Ca_vβ_2a and Ca_vβ_4b were attached to the plasma membrane (Fig. 4 D). In contrast, GFP was found only in the nucleus and outside of the nucleus but was not associated with vesicles or transported to the presynapse (unpublished data). The results suggest that both Ca_vβ_2a and Ca_vβ_4b subunits are transported to synaptic sites and to the plasma membrane, where they most likely associate with the Ca_vα₁ subunits to form channel complexes.

Figure 2.

Exogenously expressed Ca_vβ_1-4 subunits distribute in different patterns in hippocampal neurons and colocalize to various degrees with presynaptic marker proteins. (A) Fluorescence pattern of neurons from low density hippocampal cultures infected with the indicated GFP-tagged Ca_vβ subunit (i.e., Ca_vβ_1–4) reveal either a punctate (Ca_vβ_2a and Ca_vβ_4b) or a more diffuse, cytosolic staining (Ca_vβ_1b and Ca_vβ₃). (B) Increased magnification of hippocampal neurites reveal that Ca_vβ_2a and Ca_vβ_4b are clustered, whereas Ca_vβ_1b and Ca_vβ₃ are diffusely distributed. (C) The bar graph indicates that neurons overexpressing Ca_vβ_2a and Ca_vβ_4b mainly reveal punctate staining similar to the endogenous distribution of Ca_vβ subunits, whereas the majority of neurons infected with Ca_vβ_1b and Ca_vβ₃ or GFP alone do not reveal punctate staining (n = 110–153 for each subunit; *, P < 0.01 compared with GFP). Quantification of the percentage of transfected neurons showing that punctate staining was performed by generating 11–13 randomly chosen fields within each group of neurons analyzed. In each field, the number of total infected neurons was counted, and the percentage of those showing punctate patterns was calculated. The percentages in each group were then averaged. n is equal to the total number of infected neurons counted. (D and E) Ca_vβ_2a and Ca_vβ_4b reveal differences in their percentages to colocalize with presynaptic marker proteins. (D) Cultured hippocampal neurons were infected with GFP-tagged Ca_vβ_2a and Ca_vβ_4b and costained with synaptobrevin-II or synapsin-I (red). Representative confocal images of hippocampal neurites reveal that the fluorescent puncta in Ca_vβ_2a- and Ca_vβ_4b (green)-expressing neurons reveal a different colocalization percentage with the presynaptic marker (red). (E) Quantification of the GFP puncta containing either Ca_vβ_2a or Ca_vβ_4b that colocalize with synaptobrevin-II. The percentage of synaptic colocalization is given as the number of Ca_vβ GFP puncta, which colocalized with the number of synaptobrevin-II puncta relative to the amount of GFP puncta within the region of interest analyzed (n = 20–21; *, P < 0.01). Error bars represent SEM. Bars (A), 15 μm; (B and D) 2 μm.

Figure 3.

Ca_vβ subunits are found in cytoplasmic and membrane fractions in hippocampal neurons. (A and B) Rat whole brains (postnatal day 0–3) were homogenized and fractionated in a discontinuous sucrose gradient. Primary membrane and cytosolic fractions were taken for Western blot analysis. (B) When immunoblotted with the pan-β antibody, the endogenous Ca_vβ subunits were mainly located in the membrane fraction but also found in the cytosolic fraction. (C) Exogenously expressed Ca_vβ subunits revealed a subunit-specific distribution between the cytosolic and membrane fraction. 13–16 h after infection with Ca_vβ subunits, 14-d in vitro hippocampal neurons were harvested, and cell extracts were blotted with anti-GFP antibodies.

Figure 4.

Immunoelectron microscopy reveals that Ca_vβ_2a and Ca_vβ_4b subunits are associated with membranes and vesicular structures and are targeted to presynaptic terminals in hippocampal neurons. (A and B) Immunoelectron microscopy pictures of 14-d in vitro autaptic neurons exogenously expressing GFP-tagged Ca_vβ_2a (A) or GFP-tagged Ca_vβ_4b (B) subunits. In neurons expressing Ca_vβ_2a and Ca_vβ_4b subunits, gold particles were found attached or close to vesicular structures (arrowheads). (C and D) In adult hippocampal slices, exogenously expressing GFP-tagged Ca_vβ_2a (C) and Ca_vβ_4b subunits (D) were found in presynaptic terminals close to synaptic vesicles and attached to the cell membranes (arrowheads). Bars, 50 nm.

Effect of Ca_vβ subunits on Ca²⁺ channel currents in HEK293 cells and hippocampal neurons

Ca_vβ subunits determine the biophysical properties of the Ca²⁺ channel. When expressed with the P/Q-type channel in Xenopus laevis oocytes or HEK293 cells, Ca_vβ subunits determine the time course of inactivation in a subunit-specific manner. Ca_vβ_1b- and Ca_vβ₃-assembled channels inactivate rapidly, whereas Ca_vβ_2a- assembled channels inactivate slowly (Stea et al., 1994). Ca_vβ_4b-assembled channels inactivate with a time course that lies between Ca_vβ_1b,3 and Ca_vβ_2a. The gating properties of the presynaptic Ca²⁺ channels determine Ca²⁺ influx into the presynaptic terminal and, therefore, determine transmitter release and synaptic plasticity, such as facilitation and depression.

We wanted to know how P/Q-type channels assembled with different Ca_vβ subunits open and closed during action potential (AP) waveforms, which we obtained from cultured hippocampal neurons. We expressed Ca_vα₁2.1 subunits together with the Ca_vα₂δ and the various Ca_vβ subunits in HEK293 cells and applied 30 APs to analyze how many channels would be opened during AP trains. To determine the proportion of open channels, we used the following protocol. Based on the voltage dependence of the activation of P/Q-type channels, we applied a 10-ms depolarizing test pulse to a test potential in which ∼100% of channels within the cells were open (Herlitze et al., 1996, 1997, 2001; Mark et al., 2000). This value is given by the amplitude of the tail current. We then compared the tail current elicited by the AP to the tail current elicited by the 10-ms depolarization to +100 mV. We were interested in three values. We wanted to know whether activation with the AP waveforms would reveal differences in the opening of the channels when assembled with different Ca_vβ subunits. The results indicated that the AP opens between 55 and 65% of the channels. No considerable differences were observed between channels assembled with the different Ca_vβ subunits (Fig. 5, A and B).

Figure 5.

Hippocampal AP waveform protocols detect differences in the amount of open P/Q-type channels assembled with the different Ca_vβ subunits during long 20-Hz stimulations but not for paired pulses. (A) HEK293 cells expressing Ca_vα₁2.1, Ca_vα₂δ, and one of the four Ca_vβ_1b, Ca_vβ_2a, Ca_vβ₃, and Ca_vβ_4b subunits were held at −60 mV, and Ca²⁺ currents were elicited by a 20-Hz AP train 1 s after a prepulse to 100 mV for 10 ms. This prepulse was given to open ∼100% of the Ca²⁺ channels expressed in the cell (top). The tail current elicited by the prepulse was used to relate the tail current elicited by the AP to gain an understanding about the percentage of channels opened by the AP. The example whole cell currents (top) and the bar graph (bottom) indicate that approximately the same amount of channels were opened by the first AP and the second AP for the Ca_vβ_1–4-assembled P/Q-type channels analyzed. (B) Increased time resolution of the underlying current elicited by the AP. The deactivation time of the tail currents can be fitted with a single exponential. Only currents were included and analyzed in the experiments described in A–E, which reveal fast deactivation kinetics and no change in the deactivation kinetics between the first and the last tail current elicited. (C) Examples of P/Q-type channel currents assembled with Ca_vβ_1–4 subunits during a 20-Hz 30-pulse AP waveform train. (D) Relative ICa²⁺ ratio for the P/Q-type channel currents assembled with Ca_vβ_1–4 subunits. The tail current amplitudes were related to the tail current elicited by the first AP. (E) Comparison of the relative amplitude of the tail currents elicited by the first and 30th AP during the 20-Hz AP train reveals that currents through P/Q-type channels assembled with Ca_vβ_1b and Ca_vβ₃ subunits are relatively smaller than currents through P/Q-type channels assembled with Ca_vβ_2a and Ca_vβ_4b. Error bars represent SEM. *, P < 0.05; **, P < 0.01.

We next compared the ratio between the amount of channels opened by the first and the second AP (Fig. 5 A). By comparing this value, we gain information on differences on the influx of Ca²⁺ through Ca²⁺ channels into the presynaptic terminal, which may determine whether synapses facilitate or depress during paired pulses. No differences were detected between channels assembled with different Ca_vβ subunits. We next analyzed whether a 20-Hz train of 30 APs leads to a decrease in channel opening, as would be expected from the inactivation of Ca²⁺ channels during long, constant depolarizations (Stea et al., 1994; Herlitze et al., 1997). When comparing the proportion of channels opened by the first AP relative to the amount of channels opened by the 30th AP, we found that currents mediated by Ca_vβ_1b- and Ca_vβ₃-assembled channels are reduced by 10–15% (Fig. 5, D and E). In contrast, currents mediated by Ca_vβ_4b- assembled channels are reduced by 2% (Fig. 5, D and E), and currents mediated by Ca_vβ_2a-assembled channels increased by 5% (Fig. 5, D and E). Thus, P/Q-type channels assembled with different β subunits reveal substantial differences in the amount of channel opening during long AP trains.

It has been shown that the biophysical properties of P/Q-type channels depends on the cellular environment in which the pore-forming Ca_vα₁ subunit is expressed (Tottene et al., 2002). We found that the maximal current elicited by a 500-ms-long voltage ramp is shifted to more negative potentials (around 20 mV) in neurons expressing non–L-type channels in comparison with HEK293 cells expressing P/Q-type channels encoded by the Ca_vα₁2.1, Ca_vα₂δ, and Ca_vβ subunits (Fig. 6 A). Therefore, Ca_vβ subunit–mediated effects on presynaptic Ca²⁺ channel (non–L type) inactivation may be shielded in neurons by, for example, neuronal-specific channel-interacting proteins. To show that the Ca_vβ subunits (i.e., Ca_vβ_2a and Ca_vβ_4b) also change the biophysical properties of non–L-type channels in hippocampal neurons, we analyzed the Ca²⁺ channel inactivation of somatic neuronal non–L-type channels. As shown in Fig. 6 B, the exogenous expression of Ca_vβ_2a and Ca_vβ_4b subunits reduce non–L-type channel inactivation in a subunit-specific manner. Ca_vβ_2a subunit expression leads to an increase in the non–L-type current during a 100-ms test pulse from −60 to 0 mV, whereas neuronal non–L-type currents in the presence of Ca_vβ_4b subunits do not change in size (Fig. 6 B).

Figure 6.

Ca_vβ subunits expressed in hippocampal neurons change the biophysical properties of the endogenous non–L-type channels. (A) The activation of non–L-type channels in hippocampal neurons is shifted to more negative potentials when compared with P/Q-type channels exogenously expressed in HEK293 cells. (top) Example current traces (IV curve) of non–L-type currents from hippocampal neurons in comparison with currents through P/Q-type channels (Ca_vα₁2.1, Ca_vα₂δ, and Ca_vβ_4b) expressed in HEK293 cells elicited by 500-ms voltage ramps from −60 to 90 mV. (bottom) Diagram of the voltage at which the peak current appears during the voltage ramp for P/Q-type channels expressed in HEK293 cells and non–L-type currents from hippocampal neurons in the presence or absence of Ca_vβ_2a and Ca_vβ_4b subunits. (B) The inactivation properties of non–L-type channels in hippocampal neurons are changed in the presence of Ca_vβ_2a and Ca_vβ_4b subunits. (left) Example traces of non–L-type currents elicited by a voltage pulse from −60 to 0 mV reveals that in the presence of Ca_vβ_2a and Ca_vβ_4b subunits, inactivation is slowed. (right) Diagram of the current change (percentage) within the 100-ms current trace. The current at the beginning of the test pulse (10 ms) is compared with the current at the end of the test pulse (95 ms). Error bars represent SEM. *, P < 0.05; **, P < 0.01.

Effects of Ca_vβ subunits on synaptic transmission

Our results on the recombinant P/Q-type channels and endogenous neuronal Ca²⁺ channels suggest that Ca²⁺ influx into the presynaptic terminal should be altered during long 20-Hz AP trains but not for paired-pulse responses. We analyzed the effect of the Ca_vβ subunits on paired-pulse facilitation (PPF) by comparing the first and second excitatory postsynaptic current (EPSC; defined as the paired-pulse ratio [PPR]) and analyzed the effect on synaptic depression by comparing the first and last EPSCs (averaged 27–30 EPSCs) within a 20-Hz stimulation protocol when 30 pulses were elicited in 4 mM of extracellular Ca²⁺ (Fig. 7, A and C). Because we did not observe effects on synaptic transmission when Ca_vβ_1b and Ca_vβ₃ subunits were expressed in our initial studies (unpublished data), we only analyzed Ca_vβ_4b and Ca_vβ_2a subunit effects on synaptic transmission in the following experiments. According to our results regarding the effects of Ca_vβ subunits on the inactivation properties of Ca_v2 channels, we found that Ca_vβ_2a subunits did not change the PPR as expected from the aforementioned biophysical analysis. However, Ca_vβ_4b subunits increased the PPR, leading to facilitation (Fig. 7, A and C).

Figure 7.

Ca_vβ subunit–specific determination of facilitation and depression in autaptic hippocampal neurons. (A and B) EPSC recordings of autaptic hippocampal neurons exogenously expressing Ca_vβ_2a and Ca_vβ_4b subunits in 4 mM Ca²⁺. (A) Representative autaptic EPSC traces from noninfected and Ca_vβ_2a and Ca_vβ_4b subunit–infected neurons reveal that in the presence of Ca_vβ_2a and Ca_vβ_4b subunits, synaptic depression is increased during long 20-Hz stimulations. Gray areas represent the asynchronous release. (B) Bar graph of the quantified EPSC ratios of Ca_vβ_2a and Ca_vβ_4b subunit–infected and noninfected neurons. The EPSC amplitudes of the first and second EPSC (top), the first and the mean from the 27–30th EPSC (middle), and the largest EPSC during a train and the mean from the 27–30th EPSC (bottom). (C) Relative EPSCs for Ca_vβ_2a- and Ca_vβ_4b-infected and noninfected neurons. The EPSC amplitudes during the 20-Hz pulse train were related to the EPSC elicited by the first pulse. The decline in EPSC amplitude could be fitted with a single exponential starting from the largest EPSC within the pulse train. (D) Bar graph of the mean maximal EPSC amplitude of Ca_vβ_2a and Ca_vβ_4b subunit–infected and noninfected neurons during a 20-Hz pulse train. (E and F) Comparison of the RRP before and after 30 2-ms-long pulses to 10 mV (20-Hz stimulation). (E) Example traces of sucrose responses before (P2) and after the 20-Hz stimulation (P1). (F) Relative pool size for Ca_vβ_2a- and Ca_vβ_4b-infected and noninfected neurons. The relative pool size was determined by the ratio between the sucrose response after the 20-Hz stimulation (P1) and the sucrose response before the stimulation (P2). (G) Time course of asynchronous release during a 20-Hz pulse train. The charge of the largest EPSC (EPSC_max) within the 20-Hz train was compared with the charge of the asynchronous release for each EPSC. (H) Bar graph of the quantified total charge during a 20-Hz stimulation protocol for the phasic release and asynchronous release for Ca_vβ_2a- and Ca_vβ_4b-infected and noninfected neurons. The mean values of the time course of depression (C) and the asynchronous release (G) were fitted with a single exponential, and the time constants for each fit and the number of experiments (given in parentheses) are given in the diagrams. Error bars represent SEM. * P, < 0.05; **, P < 0.01.

We next analyzed whether the Ca_vβ_4b and Ca_vβ_2a subunits influence synaptic transmission during longer AP trains. The biophysical analysis predicts that in the presence of Ca_vβ_4b and Ca_vβ_2a subunits, Ca²⁺ influx into the presynaptic terminal should be increased as a result of the noninactivating properties of the presynaptic Ca²⁺ channels in comparison with Ca_vβ_1b and Ca_vβ₃ subunits. The increased Ca²⁺ influx may cause more vesicle depletion (depression) and may influence asynchronous transmitter release, which has been shown to be proportional to the residual [Ca²⁺]_i (Atluri and Regehr, 1998). Analysis of the synaptic responses during 30 20-Hz AP trains revealed that Ca_vβ_4b- and Ca_vβ_2a-expressing neurons show larger depression in comparison with wild-type neurons (Fig. 7, A–C) Note that the amount of depression is related to the largest EPSC compared with the minimal EPSC at the end of the stimulus train. The largest EPSC in noninfected neurons and Ca_vβ_4b-expressing neurons is the EPSC elicited by the second pulse. Therefore, depression is significantly larger for Ca_vβ_2a (0.34 ± 0.01; n = 14) as well as for Ca_vβ_4b (0.49 ± 0.03; n = 15) in comparison with noninfected neurons (0.7 ± 0.01; n = 15). To determine whether Ca_vβ_4b- and Ca_vβ_2a-expressing neurons reveal more vesicle depletion during AP trains, we compared the readily releasable pool size before and after 20-Hz train stimulations. As shown in Fig. 7 (E and F), the pool size is substantially reduced in Ca_vβ_2a-expressing neurons (12 ± 3.5%) and is slightly reduced in Ca_vβ_4b-expressing neurons (9 ± 2.7%) in comparison with control neurons (3 ± 2.2%). However, the Ca_vβ_4b effects were not substantial. To further verify that Ca_vβ_4b- and Ca_vβ_2a-expressing neurons may increase the Ca²⁺ influx into the presynaptic terminal, we analyzed the asynchronous release. We found that onset of the asynchronous release was much faster and the amount of asynchronous relative to the phasic release at the beginning of the AP train was increased in Ca_vβ_4b- and Ca_vβ_2a- expressing neurons in comparison with control neurons (Fig. 7 G). Although the total amount of phasic and asynchronous release (Fig. 7 H) as well as the mean EPSC amplitude (Fig. 7 D) were slightly increased in Ca_vβ_4b-expressing neurons in comparison with control and Ca_vβ_2a-expressing neurons, the differences were not substantial.

These aforementioned results support the idea that during AP trains, the Ca²⁺ influx into the presynaptic terminal is larger in the presence of Ca_vβ_4b and Ca_vβ_2a subunits. A larger Ca²⁺ influx into the presynaptic terminal during AP trains in Ca_vβ_4b and Ca_vβ_2a subunit–expressing neurons should also result in faster vesicle recycling (Stevens and Wesseling, 1998). To test this hypothesis, we repeated the experiments described in Stevens and Wesseling (1998). We first analyzed the recovery of the readily releasable vesicle pool (RRP) after RRP depletion without 20-Hz stimulation trains applied during depletion. No differences were found for the recovery of the RRP regardless of whether Ca_vβ_4b or Ca_vβ_2a subunits were expressed in the neurons (Fig. 8, A and B). Also, recovery of the EPSC after RRP depletion was not different between neurons expressing or not expressing Ca_vβ_4b and Ca_vβ_2a subunits (Fig. 8, C and D), suggesting that exogenously expressed Ca_vβ_4b and Ca_vβ_2a subunits most likely do not interfere with the vesicle recycling. We next analyzed the RRP recovery after 20-Hz stimulation trains were applied during the initial sucrose application (Fig. 8 E). We confirmed the observation described by Stevens and Wesseling (1998) that the RRP recovery for all neurons analyzed (regardless of whether Ca_vβ subunits were expressed or not) was accelerated by the 20-Hz stimulus train (Fig. 8, E and F). Interestingly, RRP recovery was faster in Ca_vβ_4b and Ca_vβ_2a subunit–expressing neurons in comparison with control neurons (τ_rec without 20-Hz train stimulation: control = 11.4 s, Ca_vβ_2a = 9.1 s, and Ca_vβ_4b = 12.6 s; τ_rec after 20-Hz train stimulation: control = 4.1 s, Ca_vβ_2a = 1.8 s, and Ca_vβ_4b = 1.6 s), suggesting again that Ca²⁺ influx into the presynaptic terminal is increased during 20-Hz stimulation trains in Ca_vβ_4b and Ca_vβ_2a subunit–expressing neurons.

Figure 8.

Ca_vβ_2a and Ca_vβ_4b subunits expressed in hippocampal neurons accelerate the recovery of the readily releasable pool when trains of APs have been evoked previously. To evaluate whether Ca_vβ_2a and Ca_vβ_4b subunits affect vesicle recycling, we analyzed the recovery of the RRP and the EPSC after RRP depletion. The RRP was measured by applying hypertonic solution (500 mM sucrose) for 4 s. (A) Example traces of the time-dependent RRP recovery. (B) Time course of the recovery of the RRP. There were no substantial differences in the time course of RRP recovery between Ca_vβ_2a- and Ca_vβ_4b-expressing and nonexpressing neurons. (C) Example traces of the EPSC recovery after RRP depletion. (D) Time course of the recovery of the EPSC after RRP depletion. EPSCs were elicited by a 2-ms test pulse to 10 mV. (E) Example traces of the time-dependent RRP recovery when 20 stimulus trains have been evoked for 1 s at the end of the first sucrose application. (F) Time course of the recovery of the RRP reveals that in the presence of Ca_vβ_2a and Ca_vβ_4b, the RRP recovery is faster. The relative recovery of the RRP and the EPSC was calculated by comparing the sucrose or EPSC response after the initial sucrose response to the initial (first) response. For RRP recovery in E and F, the sucrose response after the first depletion (P1) was compared with the sucrose response 30 s after the second sucrose response (P2). The interpulse intervals are given in A, C, and E. The mean values of the recovery of the RRPs and EPSCs shown in B, D, and F were fitted with a single exponential, and the time constant for each fit are given in the diagram. The numbers of experiments are given in parentheses. Error bars represent SEM.

Although the exogenous expression of Ca_vβ subunits determines the synaptic responses during long AP trains according to the biophysical properties of the assembled presynaptic Ca²⁺ channels, the induced facilitation by Ca_vβ_4b during paired pulses cannot be explained by the biophysical properties of presynaptic Ca²⁺ channel assembled with the Ca_vβ_4b subunit. However, this may suggest that in the presence of Ca_vβ_4b subunit, the Ca²⁺ dependence of the vesicle release is altered, which may result in a reduced release probability (Thomson, 2000). Therefore, we compared the release probability of noninfected and Ca_vβ_2a- as well as Ca_vβ_4b-expressing neurons. The release probability can be examined by comparing the RRP with the number of vesicles elicited by a single AP. The RRP size is determined by application of a hypertonic sucrose solution (Rosenmund and Stevens, 1996). As shown in Fig. 9, we found that the release probability in the presence of Ca_vβ_4b was reduced in comparison with noninfected and Ca_vβ_2a-expressing neurons. No differences in the mean RRP and EPSC size were detected between the neurons expressing different Ca_vβ subunits, probably because only a small number of cells were analyzed.

Figure 9.

Ca_vβ_4b subunits expressed in hippocampal neurons reduce the synaptic release probability, change the Ca²⁺-dependent transmitter release, and are more sensitive to EGTA. (A, left) Representative EPSC traces evoked by 2-ms depolarizing pulses from −60 to 10 mV are shown for noninfected and Ca_vβ_2a- and Ca_vβ_4b-infected neurons. (right) Representative traces of the hypertonically mediated release of quanta from the same neuron shown on the left upon the application of 500 mM sucrose for 4 s. (B) Probability of synaptic vesicle release was evaluated by calculating the ratio of release evoked by the AP to that evoked by hypertonic sucrose. In autaptic neurons infected with Ca_vβ_4b, the vesicular release probability is significantly reduced compared with noninfected or Ca_vβ_2a subunit–infected neurons. (C) Representative EPSC traces elicited by the application of increasing extracellular Ca²⁺ concentrations of autaptic hippocampal neurons expressing Ca_vβ_4b subunits. (D) Dose-response curve of the EPSC amplitude by increasing extracellular Ca²⁺ concentrations. The Ca²⁺-dependent EPSC responses of noninfected, Ca_vβ_4b-, or Ca_vβ_2a-infected neurons were free fitted according to the Hill equation (EPSC = EPSC_maximal/(1 + (EC₅₀/[Ca²⁺]_o)^{Hill coefficient}). The EPSCs were then normalized to the maximal EPSC given by each fit. The mean normalized EPSCs for the given Ca²⁺ concentrations are shown. The curves again were fitted according to the Hill equation. The Hill coefficients are 2.7 ± 0.4 for control and Ca_vβ_2a-infected neurons and 1.9 ± 0.4 for Ca_vβ_4b-infected neurons. (E) Representative EPSC traces before and after a 50-μM EGTA-AM application evoked by two 2-ms depolarizing pulses from −60 to 10 mV within 50 ms are shown for noninfected and Ca_vβ_2a- and Ca_vβ_4b-infected neurons. (F) Bar graph of the remaining EPSC amplitude after 10 mM EGTA was applied intracellularly for 20 min (top) and after 50 μM EGTA-AM was applied extracellularly for 15 min (bottom). Error bars represent SEM. *, P < 0.05.

The relationship between the Ca²⁺ influx into the presynaptic terminal and the vesicle release is approximately given by the following equation: vesicle release ∝ [Ca²⁺]^{Hill coefficient}, where the Hill coefficient is defined as the Ca²⁺ cooperativity. The Ca²⁺ cooperativity in many synapses is high (three to four), indicating that a small change in Ca²⁺ influx can result in drastic changes in transmitter release. Thus, in our experiments, the Hill coefficient gives an indirect measure of the Ca²⁺ influx through presynaptic Ca²⁺ channels relative to the transmitter release. This means that a change in the number, localization, or organization of the presynaptic Ca²⁺ channels most likely results in a change in Ca²⁺ dependence of the transmitter release. Interestingly, in the presence of the Ca_vβ_4b subunits, the Ca²⁺-dependent transmitter release dose-response curve became more shallow, with a small change in the half maximal [Ca²⁺] concentration (EC₅₀) when compared with wild-type neurons or neurons exogenously expressing Ca_vβ_2a subunits (Fig. 9). Because the Ca_vβ_4b subunit particularly changed the cooperativity of the transmitter release, this result may suggest that Ca_vβ_4b is involved in organization of the Ca²⁺ channel domains necessary for efficient vesicle release. For example, Ca_vβ_4b-assembled channels may be further apart from the release machinery. If this is the case, synaptic transmission in Ca_vβ_4b-expressing neurons should be more sensitive to the slow Ca²⁺ buffer EGTA. Indeed, we found that when 10 mM EGTA was applied intracellularly or 50 μM EGTA-AM was applied extracellularly, the EPSC amplitude was substantially more reduced in Ca_vβ_4b-expressing neurons to 60 and 93%, whereas in Ca_vβ_2a-expressing neurons and control neurons, the EPSC amplitude was reduced only by 50 and 87–89% (Fig. 9, E and F).

Discussion

In this study, we investigated the targeting and function of Ca_vβ subunits in hippocampal neurons. We found that Ca_vβ_2a and Ca_vβ_4b are sufficiently targeted to synaptic sites, where they influence synaptic transmission during long AP trains according to the biophysical properties that these subunits induce in the presynaptic Ca²⁺ channel. During paired pulses, Ca_vβ_4b subunits also altered the Ca²⁺ dependence of transmitter release. The physiological consequences and implications of the findings are discussed below.

Targeting of Ca_vβ subunits to the plasma membrane and synaptic terminals

We show that Ca_vβ_2a and Ca_vβ_4b are targeted to synaptic sites and colocalize with synaptic markers. All Ca_vβ subunits (exogenously and endogenously expressed) are found to various degrees in cytoplasmic and membrane fractions, as suggested by an overexpression study of Ca_vβ subunits in HEK293 cells (Chien et al., 1998). In particular, Ca_vβ_2a subunits are associated with the membrane fraction, as predicted from their N-terminal located palmitoylation site (Dolphin, 2003; Herlitze et al., 2003). This is in agreement with previous studies performed in HEK293 cells in which palmitoylated Ca_vβ_2a subunits reach the plasma membrane independently of the Ca_vα₁ subunit (Chien et al., 1998; Bogdanov et al., 2000). Ca_vβ_2a subunits could also be found on vesicular structures, supporting the view that they most likely are associated with Ca_vα₁ subunits, where they are transported as preassembled channel complexes to synaptic sites (Ahmari et al., 2000; Shapira et al., 2003). Our studies for Ca_vβ_1b and Ca_vβ₃ reveal that these subunits, when expressed alone, distribute more homogenously in neurons and do not substantially influence the synaptic parameters analyzed. The reason for this could be that Ca_vβ_1b and Ca_vβ₃ are not sufficiently transported to the presynaptic terminals as suggested by Maximov and Bezprozvanny (2002). On the other hand, because Ca_vβ₃ is the main mRNA detected in hippocampal neurons, most synaptic Ca²⁺ channels could be assembled with Ca_vβ₃ subunits. Therefore, the biophysical properties of the presynaptic Ca²⁺ channels would not be affected by either Ca_vβ_1b and Ca_vβ₃, because the biophysical differences of channels assembled with these subunits are small.

Ca_vβ subunits may determine synaptic plasticity during longer AP trains as a result of the effects on the inactivation properties of the presynaptic Ca²⁺ channel complexes

Ca_vβ in particular determines the time course of inactivation of high voltage–activated Ca²⁺ channels. How P/Q-type channels assembled with different Ca_vβ subunits behave when AP waveforms derived from hippocampal neurons are used as command potentials has not been studied before. Interestingly, we did not detect substantial differences in the opening of the channels for the first two APs, which would determine the Ca²⁺ influx into the presynaptic terminal during paired pulses underlying short-term synaptic plasticity, but found that Ca_vβ_1b- and Ca_vβ₃-assembled channels exhibited substantial differences in the proportion of channels open after 30 APs or longer trains when compared with the Ca_vβ_2a- and Ca_vβ_4b-assembled channels (20 Hz; Fig. 5 D). We have to point out that the determination of the biophysical properties of the P/Q-type channel in HEK293 cells cannot directly be compared with the effects these subunits have on the native presynaptic Ca²⁺ channels. For example, Tottene et al. (2002) showed that the maximal current amplitude (when the peak current was analyzed with voltage step protocols) of the pore-forming human Ca_vα₁2.1 subunit expressed in neurons from Ca_vα₁2.1 knockout mice was shifted by −20 mV when compared with the same channel subunit coexpressed with Ca_vα_2bδ and Ca_vβ_2e in HEK293 cells. A similar shift in the maximal current amplitude was seen in our experiments when we compared the voltage ramps of rat Ca_vα₁2.1-, Ca_vα₂δ-, and Ca_vβ_2a,4b-assembled channels in HEK293 cells with the non–L-type currents elicited by voltage ramps in noninfected or Ca_vβ subunit–infected neurons. This indicates that non–L-type currents in neurons differ in their biophysical properties probably because of cell type–specific interacting proteins and variations as well as combinations of splice variants contributing to the non–L-type current. The differences in channel opening and, therefore, Ca²⁺ influx correlate well with the observed effects Ca_vβ subunits have on synaptic depression, asynchronous release, and activity-dependent RRP recovery.

Synaptic depression can be achieved via various cellular mechanisms. Therefore, an increase in Ca²⁺ influx leading to faster vesicle depletion is only one possibility (Zucker and Regehr, 2002). Synaptic depression can also be independent of vesicle depletion. For example, a decrease in presynaptic Ca²⁺ influx into the calyx of Held is the major cause of synaptic depression at this synapse type (Xu and Wu, 2005). In addition, a reduction in the AP amplitude during high repetitive firing (>20 Hz) has been correlated with a reduction in the transmitter release (Brody and Yue, 2000). Because we did not observe any change in the AP amplitude when we elicited and measured 20-Hz AP trains in the presence or absence of Ca_vβ_2a and Ca_vβ_4b subunits, a decline in AP amplitude is most likely not involved in the depression effects observed (Fig. S1, available at http://www.jcb.org/cgi/content/full/jcb.200702072/DC1). Because our synaptic terminals are too small to directly record the Ca²⁺ influx, we cannot exclude the possibility that the presynaptic Ca²⁺ influx into the terminal is reduced. However, the decrease in channel inactivation, particularly for Ca_vβ_2a subunit–assembled channels, correlated with the faster RRP recovery and faster onset of asynchronous release does not agree with this mechanism but rather suggests a larger Ca²⁺ influx into the presynaptic terminal.

Ca_vβ_4b subunits change the cooperativity of transmitter release

Exogenous expression of Ca_vβ_4b subunits induced PPF. PPF occurs at low release probability synapses during high frequency stimulation and is associated with a restricted Ca²⁺ influx during the first AP accompanied by a build up in presynaptic Ca²⁺ concentration and, thus, an increase in the synaptic release probability once the second AP reaches the presynaptic terminal (Thomson, 2000; Zucker and Regehr, 2002). To analyze whether the increase in PPR in the presence of Ca_vβ_4b subunits could account for a reduction in channel opening caused by Ca_vβ_4b, we examined the possibility of detecting differences in the amount of channels opened by a hippocampal AP. We could not detect substantial differences between the Ca_vβ-assembled channels during the paired-pulse protocol used. To provide an explanation for the facilitation behavior of Ca_vβ_4b-expressing synapses, we analyzed several parameters, including Ca²⁺ dependence of the transmitter release, the effect of the expression of Ca_vβ subunits on the contribution of N- and P/Q-type channels to synaptic transmission, and somatic non–L-type currents. We found that the expression of Ca_vβ_4b changes the shape of the Ca²⁺ response curve, which is most likely not correlated with a change in the ratio between the P/Q- or N-type channel or a Ca_vβ_4b channel–specific effect on the terminal (Fig. S2, available at http://www.jcb.org/cgi/content/full/jcb.200702072/DC1). This result suggests that in the presence of Ca_vβ_4b subunits at the presynaptic terminal, the cooperativity of the Ca²⁺- dependent transmitter release is changed. Recently, the cooperativity of the transmitter release was determined using the same rat hippocampal autapse system. The cooperativity was estimated to around 3 (Reid et al., 1998), a value which we determined and confirmed in our study of wild-type and Ca_vβ_2a-expressing neurons. The authors did not find a difference in the contribution between N- or P/Q-type channels. This is important to note because Ca_vβ₄ could preferentially assemble with one or the other channel type. For example, the preferential assembly with N- or P/Q-type channels would have important implications for the synaptic transmission at the calyx of Held, where N-type channels are suggested to be further apart from the release site than P/Q-type channels (Wu et al., 1999). The change in cooperativity in the presence of Ca_vβ_4b subunits may suggest that the coupling between the Ca²⁺ channels and the release machinery is affected or that the Ca²⁺ channels are more distant from the release site. The idea is supported by our finding that Ca_vβ_4b-expressing neurons are more sensitive to the slow Ca²⁺ chelator EGTA. This is an important finding given the recent observation that the N terminus of the Ca_vβ_4a subunit can bind synaptotagmin and the microtubule- associated protein 1A (Vendel et al., 2006). This raises the possibility that the Ca_vβ_4a subunit is creating a Ca_vβ subunit–specific anchor between the Ca²⁺ channel and the synaptic release machinery (Weiss, 2006), whereas the Ca_vβ_4b subunit would not. Therefore, Ca_vβ_4b subunit–assembled channels might be further apart from the release machinery or may change the placement of the readily releasing vesicle next to the Ca²⁺ channels, which may cause the change in the Ca²⁺ response curve. In fact, it has been suggested recently that recruitment and placement of the synaptic vesicles to sites where Ca²⁺ channels cluster are important for rapid neurotransmitter release (Wadel et al., 2007).

Physiological consequences of neuronal Ca²⁺ channels assembled with different Ca_vβ subunits

Ca_vβ subunit–specific effects on synaptic transmitter release (i.e., facilitation and/or depression) will arise if a certain subunit is abundant in a neuronal circuit or synapse. For example, in the thalamus, a brain region that is critical for seizure activity, high expression levels of Ca_vβ₄ subunits are found, whereas Ca_vβ_1–3 subunits seem to be absent or at a lower abundance (Tanaka et al., 1995; Burgess and Noebels, 1999). Loss of Ca_vβ₄ subunit function results in absence seizure epilepsy correlated with a reduced excitatory synaptic transmission in the thalamus (Caddick et al., 1999). Ca_vβ₂ subunits have been suggested to play a crucial role for Ca_v1.4 function at the ribbon synapse of the outer plexiform layer of the retina, where these channels mediate glutamate release, whereas the role of Ca_vβ₂ within the brain is poorly understood. Because Ca_vβ subunits are targets of protein phosphorylation and regulate the trafficking of the Ca²⁺ channels (Dolphin, 2003; Herlitze et al., 2003), it can be expected that activity-dependent trafficking of specific Ca_vβ subtypes in and out of synaptic terminals may occur as an important mechanism for the regulation of synaptic plasticity within a presynaptic terminal.

Materials and methods

Cell culture

Microisland and continental cultures of hippocampal neurons were prepared according to a modified version of published procedures (Bekkers and Stevens, 1991). In brief, hippocampal CA1-CA3 neurons from newborn rats (postnatal day 0–3) were enzymatically dissociated in 2 U/ml DME plus papain (Worthington) for 60 min at 37°C. Dissociated neurons were either plated onto astrocyte-covered poly-d-lysine/collagen (Sigma- Aldrich)-treated microislands that were prepared 3–5 d before plating (autaptic cultures) or were plated onto poly-d-lysine/collagen-treated coverslips that were placed invertly over astrocyte feeder cells (continental cultures). Neuronal cultures were grown in Neurobasal-A media (Invitrogen) supplemented with 4% B-27 (Invitrogen) and 2 mM Glutamax (Invitrogen) for 12–15 d.

Immunocytochemistry and imaging

Continental hippocampal cultures were prepared as described in the previous section and were infected with GFP-tagged Ca_vβ subunits. 12–18 h after infection, neurons were fixed with 4% PFA and permeabilized with 0.2% Triton X-100 in PBS. Anti–synaptobrevin-II (SYSY) and antisynapsin (Invitrogen) antibodies were used to label the synaptic markers. Neurons were incubated with the primary antibody overnight at 4°C, washed, and incubated with AlexaFluor568-conjugated secondary antibody (Invitrogen) for 30 min at room temperature. Cells were embedded in Prolong Gold Antifade (Invitrogen). Images were acquired with a confocal microscope (LSM 510; Carl Zeiss MicroImaging, Inc.) mounted on an inverted microscope (Axiovert 200M; Carl Zeiss MicroImaging, Inc.). Images were acquired with a 63× oil plan Apo NA 1.4 objective at room temperature, processed with the built-in LSM 510 software (version 3.5; Carl Zeiss MicroImaging, Inc.), and analyzed by using VOLOCITY software (Improvision).

Pan-β antibody

Polyclonal anti–pan-β antibody was raised by Harlan Bioproduct for Science according to a published procedure (Vance et al., 1998). In short, a highly conserved peptide sequence presented in all β subunits (CESYTSRPSDSDVSLEEDRE) was synthesized, and a standard 112-d protocol was used for polyclonal antibody production (Harlan Bioproduct for Science). The specificity of the product was documented with Western blots using rat brain homogenate as well as homogenates of HEK293 cells expressing Ca_vβ_1b, Ca_vβ₂, Ca_vβ₃, or Ca_vβ₄ subunit and resulted only in bands with desired molecular weights.

Electrophysiology and analysis

For HEK293 cell recordings, HEK293 cells (tsA201 cells) were transfected with the Ca²⁺ channel subunits Ca_vα₁2.1 and Ca_vα₂δ, with Ca_vβ_1b, Ca_vβ_2a, Ca_vβ₃, or Ca_vβ_4b, and with GFP to identify positively transfected cells (molar ratio of 2:1:1:0.25). Whole cell recordings were performed as described previously (Li et al., 2005). For EPSC recordings, only dots containing a single neuron forming excitatory synapses (autapses) were used using an EPC-9 amplifier (HEKA). Recordings were performed at room temperature.

For EPSC measurements as well as for recordings of Ca²⁺ currents in HEK293 cells, the extracellular recording solution contained 172 mM NaCl, 2.4 mM KCl, 10 mM Hepes, 10 mM glucose, 4 mM CaCl₂, and 4 MgCl₂, pH 7.3; the internal solution contained 145 mM potassium gluconate, 15 mM Hepes, 1 mM potassium-EGTA, 4 mM Na-ATP, and 0.4 mM Na-GTP, pH 7.3. For EGTA experiments (Fig. 9, E and F), the internal solution contained 10 mM potassium EGTA (Sigma-Aldrich), or 50 μM EGTA-AM (Invitrogen) was applied 15 min before recording to the extracellular recording solution. Currents were elicited by a 2-ms-long test pulse to 10 mV and recorded and analyzed as described previously (Wittemann et al., 2000). For recordings using various extracellular Ca²⁺ concentrations (extracellular [Ca²⁺]_o), solutions containing different extracellular [Ca²⁺]_o were applied directly onto the recorded neurons by using a fast-flow perfusion system (ALA Scientific). Non–L-type channel recordings in cultured hippocampal neurons were performed as previously described (Li et al., 2005; Han et al., 2006). The internal recording solution contained 120 mM N-methyl-d-glucamine, 20 mM tetraethylammonium-Cl⁻, 10 mM Hepes, 1 mM CaCl₂, 14 mM phosphocreatine (Tris), 4 mM Mg-ATP, 0.3 mM Na₂GTP, and 11 mM EGTA, pH 7.2, with methanesulfonic acid. The external solution contained 145 mM tetraethylammonium, 10 mM Hepes, 10 mM CaCl₂, and 15 mM glucose, pH 7.4, with methanesulfonic acid. In addition, 1 μM tetrodotoxin (Sigma-Aldrich) and 5 μM nimodipine (Sigma-Aldrich) were added to the external solution to block voltage-dependent Na⁺ channels and L-type Ca²⁺ channels. Non–L-type currents were elicited by 500-ms voltage clamp ramps from –60 to 90 mV with 1-min intervals and by 100-ms-long voltage pulses from −60 to 0 mV (Fig. 6 B). Here, capacitative and tail currents were subtracted after the experiment. The sizes of RRPs were measured according to published procedures (Rosenmund and Stevens, 1996; Han et al., 2006). In short, 500 mM sucrose was applied directly onto the recorded autaptic neurons for 4 s by using a fast-flow perfusion system (ALA Scientific). The EPSC and RRP charge was calculated by integrating the currents elicited by the single AP or the sucrose application.

The asynchronous and phasic release was calculated as described in Otsu et al. (2004). In brief, we estimated the phasic release by integrating the EPSC after each pulse within the 20-Hz stimulation protocol after subtraction of a baseline value measured 1 ms before each test pulse. The asynchronous release was calculated by subtracting the phasic release from the total integrated current for each EPSC. The holding current was subtracted before integration in every experiment. Statistical significance throughout the experiments was evaluated with analysis of variance using Igor Pro software (Wavemetrics). Standard errors are mean ± SEM.

Quantitative real-time PCR

10⁷ cells of acutely dissociated hippocampal neurons were plated on poly-d-lysine–collagen–coated plates for continental culture as described in the Cell culture section. The total RNA was subtracted from 14-d in vitro–cultured neurons with the RNeasy Mini kit (QIAGEN) and purified with on-column DNase digestion using the RNase-Free DNase Set (QIAGEN). For RT-PCR, 1 μg RNA was used for reverse transcription with the Advantage RT-for-PCR kit (BD Biosciences) to generate 100 μl cDNA, and 3 μl of the final RT product was used for real-time PCR of each Ca_vβ subunit. Real-time PCR quantification was performed on the iCycler Iq Detection System (Bio-Rad Laboratories) with CYBR green assay (Bio-Rad Laboratories). The DNA fragments of Ca_vβ_1b, Ca_vβ_2a, Ca_vβ₃, and Ca_vβ_4b were amplified from cDNA with the following primer pairs: Ca_vβ_1b forward (GGCTGTGAGGTTGGTTTCAT) and Ca_vβ_1b backward (TGTCACCTGACTTGCTGGAG); Ca_vβ₂ forward (CATGAGACCAGTGGTGTTGG) and Ca_vβ₂ backward (CAGGGAGATGTCAGCAGTGA); Ca_vβ₃ forward (CAGGTTTGATGGCAGGATCT) and Ca_vβ₃ backward (GTGTCAGCATCCAACACCAC); Ca_vβ₄ forward (GAGAGCGAAGTCCAAACCTG) and Ca_vβ₄ backward (TCACCAGCCTTCCTATCCAC); and 18S forward (AAACGGCTACCACATCCAAG) and 18S backward (CCTCCAATGGATCCTCGTTA).

The specificity of RT-PCR products was documented with gel electrophoresis and resulted in a single product with desired length. The melt curve analysis showed that each primer pair had a single product- specific melting temperature. All primer pairs have at least 95% of PCR efficiency, as reported from the slopes of the standard curves generated by iQ software (version 3.1; Bio-Rad Laboratories). The PCR reactions used a modified two-step profile with initial denaturation for 3 min at 95°C, 40 cycles of 95°C for 15 s, and at 57°C for 25 s. Relative gene expression data were analyzed with the 2-ΔΔCT method (Livak and Schmittgen, 2001).

Electron microscopy

For immunoelectron microscopy of the cultured hippocampal neurons, 14-d in vitro neurons were infected with GFP-tagged Ca_vβ_2a or Ca_vβ_4b subunits with the Semliki Forest virus (SFV) expression system for 12 h before fixing with 4% PFA in 1× PBS for 20 min at 4°C. Cells were washed with 1× PBS containing 0.05% (vol/vol) Triton X-100, blocked with 10% goat serum (Invitrogen), and incubated with polyclonal rabbit anti-GFP antibody (Invitrogen) at 4°C overnight. The neurons were then rinsed five times with PBS/0.05% Triton X-100 for 3 min and incubated with goat anti–rabbit IgG conjugated with 10-nm gold particles (Electron Microscopy Sciences) for 2 h at room temperature on a shaker. After rinsing, neurons were fixed with 2% glutaraldehyde and 4% PFA in 0.1 M cacodylate buffer at 4°C overnight. After postfixing with 1% osmium tetroxide and staining with 1% uranyl acetate, neurons were dehydrated through an ethanol series from 50 to 100% ethanol and were transferred to propylene oxide, infiltrated with Embed 812 (Electron Microscopy Sciences) for 12 h, and hardened for 24 h at 60°C. Coverslips were removed, and 60-nm sections were cut on an ultramicrotome (Ultracut E; Reichert-Jung. The slices were recovered on Formvar-coated single slot copper grids and examined in a electronic microscope (JEM-1200EX; JEOL) at 80 kV.

For the brain slice immunoelectron microscopy, 100-nm-thick adult rat brain slices were prepared on a vibrating blade microtome (VT 1000S; Leica) and immediately infected with GFP-tagged Ca_vβ_2a or Ca_vβ_4b subunits with the SFV expression system for 12 h in an incubator with 5% CO₂ at 37°C. The expression of the subunits was verified by the GFP fluorescent signals before the slices were fixed with 4% PFA in 1× PBS at 4°C overnight. The slices were rinsed with 1× PBS containing 0.05% (vol/vol) Triton X-100 five times for 3 min, blocked with 10% goat serum (Invitrogen), and incubated with a polyclonal rabbit anti-GFP antibody (Invitrogen) overnight at 4°C. Procedures and conditions for the second antibody, postfixation, and embedding, etc., were the same as for cultured neurons.

cDNAs and virus production

Rat Ca_vβ_1b, Ca_vβ_2a, Ca_vβ₃, and Ca_vβ_4b were gifts from T. Snutch (University of British Columbia, Vancouver, Canada) and E. Perez-Reyes (University of Virginia, Charlottesville, VA). They were cloned in frame into pEGFP-C_1–3 vectors (CLONTECH Laboratories, Inc.) and then into the Semliki forest virus vector pSFV1 (Life Technologies) for virus production. Thus, the GFP tag is located on the N terminus of the Ca_vβ subunits.

Membrane fractionation

About 8 × 10⁶ hippocampal neurons were cultured on four collagen/poly-d-lysine–coated 100-mm culture dishes for 14 d and infected with GFP-tagged Ca_vβ_1b, Ca_vβ_2a, Ca_vβ₃, and Ca_vβ_4b carrying virus for 13–16 h. Infected or noninfected cells were scraped in 0.32 M sucrose-TBS (0.15 M NaCl and 0.05 Tris, pH 7.4) containing 1× Complete Mini protease inhibitor (Roche) and were homogenized for 50 strokes with Dounce tissue grinder (Wheaton Millville) before promptly being loaded on top of freshly prepared 0.8 M/1.2 M sucrose-TBS gradient for centrifugation. Centrifugation was performed in a J-2-21 M/E ultracentrifuge (Beckman Coulter) at 3 × 10⁴ rpm with a SW25.1 rotor for 45 min at 4°C. Equal volumes of the cytosol and membrane fractions were used for Western blots, which were performed according to standard procedures (Mark et al., 1995).

Online supplemental material

Fig. S1 shows that the AP amplitude during 20-Hz stimulations is not reduced in noninfected or Ca_vβ_2a and Ca_vβ _4b subunits expressing hippocampal neurons. Fig. S2 shows that Ca_vβ subunits expressed in hippocampal neurons do not change the relative contribution of N- and P/Q-type channels to non–L-type currents and EPSCs. Fig. S3 shows that the N terminus of Ca_vβ_4b interferes with synaptic transmitter release in hippocampal neurons. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200702072/DC1.