TRPC-like conductance mediates restoration of intracellular Ca²⁺ in cochlear outer hair cells in the guinea pig and rat

Abstract

Ca²⁺ signalling is central to cochlear sensory hair cell physiology through its influence on sound transduction, membrane filter properties and neurotransmission. However, the mechanism for establishing Ca²⁺ homeostasis in these cells remains unresolved. Canonical transient receptor potential (TRPC) Ca²⁺ entry channels provide an important pathway for maintaining intracellular Ca²⁺ levels. TRPC3 subunit expression was detected in guinea pig and rat organ of Corti by RT-PCR, and localized to the sensory and neural poles of the inner and outer hair cells (OHCs) by confocal immunofluorescence imaging. A cation entry current with a TRPC-like phenotype was identified in guinea pig and rat OHCs by whole-cell voltage clamp. This slowly activating current was induced by the lowering of cytosolic Ca²⁺ levels ([Ca²⁺]_i) following a period in nominally Ca²⁺-free solution. Activation was dependent upon the [Ca²⁺]_o and was sustained until [Ca²⁺]_i was restored. Ca²⁺ entry was confirmed by confocal fluorescence imaging, and rapidly recruited secondary charybdotoxin- and apamin-sensitive K_Ca currents. Dual activation by the G protein-coupled receptor (GPCR)–phospholipase C–diacylglycerol (DAG) second messenger pathway was confirmed using the analogue 1-oleoyl-2-acetyl-sn-glycerol (OAG). Ion substitution experiments showed that the putative TRPC Ca²⁺ entry current was selective for Na⁺ > K⁺ with a ratio of 1: 0.6. The Ca²⁺ entry current was inhibited by the TRPC channel blocker 2-aminoethyl diphenylborate (2APB) and the tyrosine kinase inhibitor, erbstatin analogue. We conclude that TRPC Ca²⁺ entry channels, most likely incorporating TRPC3 subunits, support cochlear hair cell Ca²⁺ homeostasis and GPCR signalling.

Calcium homeostasis is central to the maintenance of sound transduction and auditory neurotransmission. Ca²⁺ has a range of effects on cochlear sensory hair cells, e.g. regulation of membrane conductances (Housley & Ashmore, 1992; Mammano & Ashmore, 1996; Raybould & Housley, 1997; Sridhar et al. 1997; Raybould et al. 2001; Housley et al. 2006), the transducer current (Mammano et al. 1999; Kennedy et al. 2003, 2005; Chan & Hudspeth, 2005), synaptic signalling (Evans et al. 2000; Beutner et al. 2001; Lioudyno et al. 2004), and outer hair cell (OHC) electromotility (Dallos et al. 1997; Frolenkov et al. 2000). The influx of Ca²⁺, release of stored Ca²⁺, and Ca²⁺ extrusion mechanisms (principally the plasma membrane calcium ATPases (PMCA)), act in concert to determine the spatiotemporal characteristics of Ca²⁺ signalling, which regulate cochlear hair cell function.

Transient receptor potential (TRP) ion channels represent a superfamily of non-selective cation channels which contribute to a wide range of cell functions, and have a particular significance in sensory systems (Clapham, 2003). The six mammalian subfamilies have been shown to exhibit polymodal activation (Ramsey et al. 2006). Expression of several members of the TRP channel family have been identified in cochlear tissues, including TRPA1 and TRPV4 (Corey, 2006). Canonical transient receptor potential (TRPC) channels are considered to be Ca²⁺ entry channels because of their high Ca²⁺ permeability, their association with store-coupled capacitative Ca²⁺ entry following discharge of intracellular Ca²⁺ stores, and store-independent Ca²⁺ entry (Clapham, 2003; Putney, 2004; Ramsey et al. 2006). TRPC channels are primary candidates for a Ca²⁺ entry pathway which can balance Ca²⁺ extrusion and establish Ca²⁺ homeostasis. A decrease in cytosolic Ca²⁺ ([Ca²⁺]_i) activates TRPC channels (Mizuno et al. 1999). In recombinant expression models, the calmodulin-inositol trisphosphate receptor (IP₃R) binding domain (CIBD) has been shown to enable the binding of calmodulin to TRPC subunits and oppose channel activation (Tang et al. 2001; Zhang et al. 2001). Lowering [Ca²⁺]_i decreases calmodulin binding and thereby promotes Ca²⁺ entry. The restoration of [Ca²⁺]_i reverses this process. The seven TRPC subunits form tetrameric ion channels via homo- or heteromeric assembly. TRPC3, TRPC6, TRPC7 form a subfamily that can also be directly activated by the G protein-coupled receptor (GPCR) second messenger diacylglycerol (DAG) (Hofmann et al. 1999; Okada et al. 1999). TRPC3 channels are distinguishable by their regulation via tyrosine kinase-dependent phosphorylation (Vazquez et al. 2004; Kawasaki et al. 2006).

Here we have identified TRPC3 transcript and protein expression in cochlear hair cells, and characterized a novel TRPC-like Ca²⁺ entry pathway in cochlear OHCs. The Ca²⁺ entry current was activated by the lowering of cytosolic Ca²⁺ levels and had biophysical and pharmacological properties consistent with TRPC channels incorporating TRPC3 subunits. These data show that TRPC channel-mediated Ca²⁺ entry contributes to the restoration of OHC Ca²⁺ levels when [Ca²⁺]_i falls. The TRPC-mediated Ca²⁺ entry channels may also be directly activated by DAG to complement G protein-coupled receptor-mediated release of stored Ca²⁺.

Method

All procedures were approved by the University of Auckland Animal Ethics Committee. The experiments used cochlear tissue obtained from rats and guinea pigs killed by an intraperitoneal injection of sodium pentobarbital (90 mg kg⁻¹, Nembutal, Abbott Laboratories).

RT-PCR detection of TRPC3 mRNA

TRPC3 mRNA expression was assessed using RT-PCR analysis of microdissected guinea pig and rat organ of Corti (two cochleae each), as previously described (Housley et al. 1999). Organ of Corti cDNAs were identified as positive for TRPC3 and prestin (an OHC specific gene marker; Zheng et al. 2000) by seminested PCR using the primer sets listed below. TRPC3 (Mizuno et al. 1999) sense (outer), GATGTGGTCTGAGTGCAAGGAGCTGTT; sense (inner), CCTGAGCGAAGTCACACTCCCAC; antisense, CCACTCTACATCACTGTCATCC; produced first and second round amplicons of 701 bp and 529 bp, respectively. Prestin sense (outer), ACGTGTGTTCCCTAGGCGTCGGCCTCA; sense (inner), ACACTTCCTCTGGGACTACTCCCACCC; antisense, GCCAGATGGTCAACTCGATTTTGCTGGT; produced first and second round amplicons of 645 bp and 460 bp, respectively. In addition, single rat OHCs were aspirated using patch pipettes and expelled into 0.5 ml microfuge tubes in an 11 μl reaction mix. First strand cDNA synthesis was initiated by the addition of 0.5 μl of reverse transcriptase (Superscript II; Invitrogen, San Diego, CA, USA). The reaction proceeded for 1 h at 37°C after preincubations at 65°C, and then at 25°C for 10 min to promote random priming. A 3 μl cDNA mixture was used for seminested PCR amplification of TRPC3 and prestin. The 25 μl reaction mixtures for the first and second round amplifications were as described above. An aliquot (3 μl) was then re-amplified for an additional 50 cycles using the inner primer sets. PCR products (15 μl) were resolved on ethidium bromide-stained 2% agarose gels.

Immunofluorescence localization of TRPC3 protein

Confocal immunofluorescence microscopy was used to localize TRPC3 protein in whole-mount rat and guinea pig organ of Corti as previously described (Housley et al. 1999). Briefly, after fixation with 4% paraformaldehyde (BDH, England) in phosphate buffer (0.1 m, pH 7.4), the tissue was permeabilized using 0.5% Triton X-100 (BDH) in 0.1 m phosphate-buffered saline (PBS) for 30 min at room temperature and blocked overnight in PBS containing 2% bovine serum albumin (BSA; Sigma, Australia) and 5% normal goat serum (NGS; Vector Laboratories, Burlington, CA, USA). The immunolabelling utilized a polyclonal rabbit antimouse TRPC3 antibody (Alomone Laboratories, Israel) raised against a peptide corresponding to residues 822–835 in the TRPC3 intracellular C-terminus (accession no. Q9QZC1; Mori et al. 1998)). Western blot analysis recognized TRPC3 in rat brain (Alomone Laboratories). Control experiments included omission of the primary antiserum or preadsorption of the primary antiserum with the target antigen (7.5 μg ml⁻¹) at 4°C for 1 h. The anti-TRPC3 antiserum was used at a dilution of 1: 100 or 1: 250 in PBS containing 0.1% Triton X-100, 2% BSA and 5% NGS, and incubated at 4°C overnight. After washes in PBS, a Texas Red sulphonyl chloride-labelled secondary antibody (1: 250 in PBS with 2% BSA, 5% NGS and 0.1% Triton X-100; affinity purified donkey antirabbit IgG; Jackson ImmunoResearch, PA, USA) was applied for 4–6 h at 4°C. Tissues were mounted (Citifluor; Agar Scientific, UK) after final washes, and imaged using a TCS SP2 laser scanning confocal microscope (Leica Microsystems, Germany) at 543 nm excitation, a 580 nm dichroic mirror and 600–700 nm band-pass filter.

Hair cell isolation and electrophysiology

OHCs were isolated from either the adult guinea pig or rat cochlea as previously described (Raybould & Housley, 1997). The organ of Corti was microdissected from either all, or selected turns of cochleae placed in a perilymph-like (standard) solution (composition (mm): NaCl, 150; KCl, 4.0; Na₂HPO₄, 8.0; NaH₂PO₄, 2.0; MgCl₂, 1.0; CaCl₂, 1.5; d-glucose, 4.0; osmolarity = 320 mosmol l⁻¹; pH 7.25 with NaOH). Following incubation in 0.5 mg ml⁻¹ Trypsin (Gibco) for 10 min, the cells were triturated and placed in a 100 μl bath mounted on the stage of an inverted microscope (Nikon TMD, Japan) equipped with Nomarski DIC optics. Bath solutions were rapidly exchanged by a peristaltic pump (up to 850 μl min⁻¹; Gilson, France). All experiments were performed at room temperature (20–25°C).

Recording pipettes were made from borosilicate glass (GC120TF-10; Harvard Apparatus, UK) with a resistance of 2–5 MΩ (Model PB-7; Narishige, Japan) and filled with internal solution (composition (mm): KCl, 150; MgCl₂, 2.0; NaH₂PO₄, 1.0; Na₂HPO₄, 8.0; d-glucose, 3.0; CaCl₂ 0.01; EGTA, 0.5; osmolarity = 300 mosmol l⁻¹; pH 7.25). Whole-cell patch-clamp recordings were made using an Axopatch 200 patch-clamp amplifier (Molecular Devices, Sunnyvale, CA, USA) controlled by software (pCLAMP 8.0; Digidata 1200B Interface, Molecular Devices). Data were corrected for junction potential errors, which were 1.8 mV or less, except for the Tris⁺ substitution experiments (−5.4 mV). Series resistance-derived voltage errors were reduced by adjustment of the voltage-clamp series resistance compensation to provide residual errors of <2 mV.

The current–voltage (I–V) relationship was obtained from voltage ramps (−100 to +50 mV, 1 s, holding potential (V_h) = −60 mV) repeated every 3 or 5 s as previously described (Raybould & Housley, 1997). The nominal Ca²⁺-free external solution had a calculated residual 3.4 μm Ca²⁺.

Sources of chemicals were: 2 aminoethyl diphenylborate (2APB), apamin, cyclopiazonic acid, 1-oleoyl-2-acetyl-sn-glycerol (OAG), dimethyl sulfoxide (DMSO), ruthenium red, Sigma; charybdotoxin, Alomone Laboratories; Tris-HCl, BDH; erbstatin analogue, Merck Biosciences.

Differences were considered statistically significant at P < 0.05 for paired and unpaired Student's t tests. Data are presented as the mean ± s.e.m.

Guinea pig OHC length ranged from 21.6 μm to 69.1 μm; average = 45.9 ± 1.2 μm (n = 245); average capacitance (C_M) = 18.2 ± 0.5 pF; average zero current potential (V_z) = −66.7 ± 0.8 mV. Rat OHC length ranged from 20.3 μm to 38.1 μm; average = 28.6 ± 0.9 μm (n = 45); average (C_M) = 12.1 ± 0.6 pF; average V_z = −63.9 ± 1.6 mV.

Confocal Ca²⁺ imaging

OHC intracellular Ca²⁺ levels were imaged using a Zeiss LSM410 inverted confocal microscope (Zeiss, Jenna, Germany), as previously described (Soeller & Cannell, 1996). Isolated OHCs were loaded with the Ca²⁺ indicator Fluo-3 (100 μm; Molecular Probes, OR, USA) included in the internal solution with EGTA omitted. Alternatively, dissected organ of Corti was incubated with Fluo-4 AM (5 μm; Molecular Probes) in standard extracellular solution, for 30 min prior to cell trituration. DMSO (1.8%) was used to aid the solubility of OAG. DMSO at this concentration had no effect on OHC membrane conductance. The fluorescent indicators were excited by an argon ion laser at 488 nm (Uniphase, San Jose, CA, USA), and emitted light was collected by a 40× water immersion objective (NA 1.2, Zeiss) and detected at 535 ± 25 nm. Data are displayed as fluorescence at a given time/resting fluorescence immediately prior to the evoked changes in [Ca²⁺]_i. Data processing was performed using custom routines (Interactive Data Language, Research Systems Inc., Boulder, CO, USA).

Results

Detection of TRPC3 mRNA expression in the organ of Corti

TRPC3 mRNA was detected in guinea pig and rat organ of Corti by RT-PCR (Fig. 1A and B). The organ of Corti cDNAs were also positive for prestin, the OHC electromotility protein (Zheng et al. 2000), and for β-actin (López-Candales et al. 1995). The identity of the 529 bp TRPC3 amplicon in guinea pig organ of Corti was confirmed by direct sequencing. The guinea pig TRPC3 cDNA amplicon (accession no. AB090949) included substitutions: C1464G; G1465A; A1467G; C1477A, compared with the rat homologue (accession no. NM021771; Mizuno et al. 1999). Expression of the TRPC3 transcript in individual rat OHCs was confirmed by single cell RT-PCR (Fig. 1C), using prestin as a positive control. Three rat OHCs were confirmed as positive for TRPC3. Negative controls with no template, or omission of reverse transcriptase, showed no amplicon.

Figure 1. RT-PCR detection of TRPC3 mRNA.

A and B, PCR amplicons from guinea pig and rat tissues. In each panel, lanes show: L, ladder; 1, organ of Corti TRPC3 + RT; 2, TRPC3 – RT; 3, cerebellum TRPC3 + RT; 4, no template control; 5, blank; 6, organ of Corti prestin + RT; 7, organ of Corti β-actin + RT. Semi-nested PCR; TRPC3 cDNA = 529 bp; prestin cDNA = 460 bp; β-actin cDNA = 660 bp. C, single-cell RT-PCR confirming TRPC3 expression by rat outer hair cells (left lane = ladder).

TRPC3 immunolocalization to cochlear hair cells

TRPC3 immunofluorescence labelling was localized to the OHCs and IHCs where it had a pronounced bipolar distribution (Fig. 2, 13 rat and 3 guinea pig experiments). Labelling was absent in the supporting cells and pillar cells. In OHCs, TRPC3 antibody labelling was predominantly in both the cell wall and cytoplasm immediately below the cuticular plate, and at the plasma membrane of the synaptic region beneath the nucleus (Fig. 2A–C). No labelling of the stereocilia was detected, however, discrete labelling occurred within the cuticular plate (Fig. 2C) at the site of regression of the kinocilium. IHC TRPC3 labelling was comparable to that of OHCs. Omission of the primary antibody or preadsorption with the target epitope peptide blocked the immunolabelling (Fig. 2A and B insets).

Figure 2. TRPC3 confocal immunofluorescence in outer (OHC) and inner hair cells (IHC) from rat and guinea pig organ of Corti.

A and B, anaglyph (red (left eye)/green (right eye)) stereoimages constructed from stacks of optical sections taken though whole-mount organ of Corti. Note labelling in the cuticular plate (cp) – upper third of the cell and also in the basal (synaptic, syn) region of both sensory cell types. tC, tunnel of Corti – showing absence of labelling of pillar cells. Insets are comparable stereoimages obtained using image stacks from control tissue; Inset A is a peptide block of rat organ of Corti immunolabelling; Inset B is a control for guinea pig organ of Corti where the primary antibody was omitted. Scale bars = 10 μm, except for insets (30 μm). C, detail of rat OHC labelling from a series of optical sections; the depth of each section from the apical surface is indicated. The greatest density of labelling occurred within approximately 6 μm of the cuticular plate and also in the basal synaptic region.

Outer hair cell currents enabled by lowering [Ca²⁺]

Given the ability of TRPC channels to mediate Ca²⁺ entry following reductions in [Ca²⁺]_i (Mizuno et al. 1999), guinea pig and rat OHCs were exposed to a Ca²⁺ conditioning protocol known to deplete [Ca²⁺]_i (Ashmore & Ohmori, 1990) (see also Fig. 8A–C). OHCs were initially superfused with an extracellular solution containing 1.5 mm Ca²⁺ (${\text{Ca}}_o^{2+}$) (see Methods) until membrane currents were steady (Fig. 3A and B). Exposure to a nominally Ca²⁺-free solution reduced voltage-dependent membrane current as previously described (Raybould & Housley, 1997). The subsequent return of the Ca²⁺-containing solution elicited a transient overshoot in the outward current, accompanied by a progressive increase in inward current (arrows, Fig. 3A and B). The inward current component, activated over tens of seconds, was seen in 165 out of 187 guinea pig OHCs and in 28 out of 45 rat OHCs. This current subsequently declined over several minutes (not shown). The current response was robust and could be generated several times in individual guinea pig and rat OHCs by the repeated cycling of [Ca²⁺]. The current response was unaffected when the Mg²⁺ concentration was maintained at 2.5 mm throughout the experiment (n = 4). Initial experiments included continuous video recording of the OHC. Post hoc analysis of these data (after Housley et al. 1995) showed that there was no significant change in OHC volume during the cycling of ${\text{Ca}}_o^{2+}$ (OHC volume in standard solution = 4.1 ± 0.7 pl; volume in Ca²⁺-free solution = 3.8 ± 0.7 pl; volume at peak of inward current = 3.8 ± 0.6 pl; P > 0.05; Student's paired t tests; n = 4). These data are consistent with the activation of a TRPC-like current (subsequently referred to as the TRPC current). The data described below provide evidence that discriminates this TRPC current from other members of the TRP channel superfamily, including TRPA1 and TRPV4 which are known to be expressed in OHCs (Liedtke et al. 2000; Corey et al. 2004; Kwan et al. 2006; Shen et al. 2006).

Figure 8. TRPC channel-mediated Ca²⁺ entry in guinea pig OHCs.

A, simultaneous Ca²⁺ imaging (Fluo-3) and whole-cell patch-clamp recordings show that the removal of ${\text{Ca}}_o^{2+}$ decreased [Ca²⁺]_i and reduced I_K,Ca. The subsequent return of ${\text{Ca}}_o^{2+}$ (Std; including 1.5 mm ${\text{Ca}}_o^{2+}$) produced an overshoot in both [Ca²⁺]_i and I_K,Ca (dashed line shows membrane current at +10 mV; continuous line Ca_i²⁺). B and C, Ca²⁺ imaging (Fluo-4 AM) showing the block of the TRPC-mediated Ca²⁺ influx by erbstatin analogue (100 μm). From a reference level (1), superfusion of the nominally Ca²⁺-free solution produced a large decrease in emitted fluorescence (2). The restoration of ${\text{Ca}}_o^{2+}$ (3) resulted in an overshoot in [Ca²⁺]_i (combined data, n = 6). Subsequent cycling of ${\text{Ca}}_o^{2+}$, with erbstatin analogue inhibited the response (n = 3) (6), compared with the repeatable TRPC-mediated overshoot in [Ca²⁺] (S3; n = 3). Erbstatin analogue largely blocked the restoration of [Ca²⁺]_i (*P < 0.05 in C); compare images (3) and (6) in B. D, direct activation of TRPC channels by 1-oleolyl-2-acetyl-sn-glycerol (OAG) in guinea pig OHCs. Bath superfusion of OAG (1 mm) in standard (Std) solution recruited OHC I_K,Ca, consistent with Ca²⁺ influx through TRPC channels. Chart record of membrane currents elicited by repeated voltage ramps as previously described. The OAG-mediated increase in guinea pig OHC Ca²⁺ levels was confirmed by confocal fluorescence imaging using Fluo-4 AM (right panel). OHC fluorescence intensity was determined as the change in ratio relative to the fluorescence signal prior to the application of OAG.

Figure 3. TRPC currents in guinea pig and rat OHCs.

A, chart record of guinea pig OHC membrane current in response to repeated voltage ramps (−100 to + 50 mV, 1 s, every 3 s, V_h=−60 mV) during the sequential superfusion of standard (Std; including 1.5 mm ${\text{Ca}}_o^{2+}$), nominally Ca²⁺-free, and return of Std solutions. Removal of ${\text{Ca}}_o^{2+}$ produced a reduction in membrane current. The subsequent restoration of ${\text{Ca}}_o^{2+}$ produced a biphasic current response. The baseline current record (at V_h) shows the time course for activation of an underlying TRPC inward current with restoration of Ca²⁺ (see arrows). B, chart record of rat OHC membrane current during the cycling of ${\text{Ca}}_o^{2+}$ shows a similar recruitment of currents with the restoration of ${\text{Ca}}_o^{2+}$. Scale bars = 10 μm.

The Ca²⁺ dependency of the TRPC current response was analysed by varying the restoration [Ca²⁺]_o subsequent to the lowering of [Ca²⁺]_i using the Ca²⁺-free solution as described. These experiments showed that the underlying inward current component of the response, measured at −90 mV, was dependent upon the presence of ${\text{Ca}}_o^{2+}$, and that the amplitude of the current progressively increased with higher [Ca²⁺]_o (Fig. 4A). In contrast, the outward current component had a sigmoidal [Ca²⁺]_o dependency with an EC₅₀ = 462 μm (Fig. 4B). This is consistent with ${\text{Ca}}_o^{2+}$ regulating the gating of the underlying TRPC inward current and the rapid secondary activation of I_K,Ca, which saturates at physiological [Ca²⁺]_o levels.

Figure 4. Dependency of TRPC current activation on [Ca²⁺]_o in guinea pig OHCs.

A, [Ca²⁺]_o dependency of the TRPC inward current during the cycling of ${\text{Ca}}_o^{2+}$. Peak inward current was measured at –90 mV (close to E_K) following the return of varying concentrations of ${\text{Ca}}_o^{2+}$. B, dependency of secondary I_K,Ca on [Ca²⁺]_o was assessed by measuring the peak outward current at +10 mV during cycling with varying [Ca²⁺]_o. Data fitted by a Boltzman equation with EC₅₀= 462 μm and maximum recruitment of I_K,Ca at ∼1.5 mm ${\text{Ca}}_o^{2+}$. Each data point represents a mean ±s.e.m. for independent experiments (n = 3–8).

Pharmacological separation of Ca²⁺-dependent currents

The outward current component, activated by the restoration of ${\text{Ca}}_o^{2+}$, was inhibited by the K_Ca channel blockers apamin and charybdotoxin, revealing the TRPC inward current component (Fig. 5). The small-conductance K_Ca channel (SK) blocker apamin (1 μm; Yamamoto et al. 1997) produced a moderate reduction in the Ca²⁺ depletion-induced overshoot in guinea pig OHC membrane current (mean = 24%, n = 7, data not shown). Following washout of apamin, the larg-conductance K_Ca channel (BK) blocker charybdotoxin (ChTx, 100 nm to 1 μm; Nenov et al. 1997) blocked the majority of the outward current component (mean = 76%, P < 0.05; n = 4). The ChTx-mediated block was reversible with washout (Fig. 5A). In rat OHCs, the outward current response was reduced by 28% by apamin (n = 9), and 85% by ChTx (n = 2).

Figure 5. Pharmacology of TRPC currents.

A, left panel shows chart record of guinea pig OHC membrane currents during repeated voltage ramps (–100 to +50 mV, 1 s, every 3 s, V_h=−60 mV) during the cycling of ${\text{Ca}}_o^{2+}$. ChTx (100 nm) largely blocked the recruitment of outward current (76%) with the restoration of ${\text{Ca}}_o^{2+}$ (Std; including 1.5 mm ${\text{Ca}}_o^{2+}$) and revealed the development of the underlying TRPC inward current. This block was reversible with washout. Right panel shows examples of I–V relationships that were derived by plotting the marked current traces elicited by the voltage ramps: (1) peak of the TRPC inward current; (2) peak of the secondary I_K,Ca (TRPC3 current masked by recruited K⁺ current); (3) peak TRPC inward current with I_K,Ca. B, in the presence of ChTx, the TRPC current was reversibly blocked by the local application of 2-aminoethyl diphenylborate (2APB; 1 mm). C, in the presence of apamin (1 μm) and charybdotoxin (400 nm), erbstatin analogue (100 μm) blocked the TRPC inward current, which was evident in the preceding cycling of ${\text{Ca}}_o^{2+}$. Right panel (inset) shows the I–V of the isolated TRPC current (2 – 1), obtained by subtracting the control I–V (1) from the I–V at the peak of the inward current response (2); 3, 4, nominally Ca²⁺-free control and with the restoration of ${\text{Ca}}_o^{2+}$ (Std) I–V relationships in the presence of erbstatin analogue. Note that the TRPC current E_rev=+32 mV (I–V inset, trace 2 – 1).

It has been reported that TRPC channels are blocked by 2APB (Lievremont et al. 2005). As shown in Fig. 5B, application of 2APB (1 mm) in the presence of ChTx (1 μm; n = 3) produced a marked decrease in the TRPC current components that was reversible upon washout. Inclusion of 2APB in the internal solution (1 mm) did not block the TRPC current response (data not shown).

Erbstatin analogue, a tyrosine kinase inhibitor which selectively antagonizes TRPC3 channel activation (Vazquez et al. 2004) was used to further consolidate the characterization of the TRPC current. Figure 5C shows that erbstatin analogue (100 μm) blocked the OHC current response induced by the cycling of Ca²⁺ in the presence of ChTx and apamin (both 1 μm). This block was irreversible for up to 1.5 hours and eight iterations of Ca²⁺ cycling. Erbstatin analogue blocked the TRPC inward currents by 91.7 ± 4.3% (100 μm, n = 6; V_h = −60 mV). Erbstatin analogue had no effect on the control OHC currents in the Ca²⁺-free solution. In the absence of K_Ca channel blockers, erbstatin analogue produced a block of both the inward current (84.5 ± 6.7% at 100 μm, n = 4; 93.8 ± 3.0% at 400 μm, n = 2; V_h = –60 mV) and secondary K_Ca outward current elicited by the restoration of ${\text{Ca}}_o^{2+}$ (data not shown).

The TRPC currents were studied in a range of OHCs isolated from all turns of the guinea pig cochlea. In the presence of the K_Ca channel blockers apamin (1 μm) and ChTx (400 nm), the restoration of ${\text{Ca}}_o^{2+}$ elicited a mean inward current of −721 ± 74 pA (n = 36; V_h = −60 mV) (see trace 2 in Fig. 5C). This produced an average depolarizing shift in zero-current potential (V_z) of +22.5 ± 1.8 mV measured from the current–voltage (I–V) relationship (compare Fig. 5A, I–V traces 1 and 2). The I–V relationship of the TRPC current elicited by the restoration ${\text{Ca}}_o^{2+}$ (Fig. 5C, I–V inset) was derived by subtracting the I–V in the Ca²⁺-free solution with ChTx and apamin (Fig. 5C, I–V trace 1) from the I–V at the peak of the inward current (Fig. 5C, I–V trace 2). The TRPC current had a linear I–V relationship, with a mean reversal potential (TRPC3_Erev) of +21.7 ± 3.0 mV (Fig. 5C I–V inset; n = 35).

The TRPC inward current was correlated with the tonotopically related background conductance (Fig. 6). The TRPC currents were largest in the shorter OHCs, which have higher background membrane conductances. It has previously been shown that OHC membrane conductance increases progressively from the apical (low-frequency) turn towards the basal (hig-frequency) turns of the guinea pig cochlea (Housley & Ashmore, 1992; Mammano & Ashmore, 1996; Raybould & Housley, 1997). The average specific TRPC current (I_TRPC at V_h normalized to C_m) increased ∼3-fold with increasing specific membrane conductance (measured about −75 mV).

Figure 6. Tonotopic variation in TRPC inward current.

Normalized guinea pig OHC TRPC inward current (V_h=−60 mV, normalized to C_m) elicited by the cycling of ${\text{Ca}}_o^{2+}$, was positively correlated with OHC-specific membrane conductance (G_{–75 mV}, normalized to C_m). Data are fitted by linear regression with 95% confidence intervals, R= 0.8.

Given the composition of intracellular and extracellular solutions, the positive TRPC3_Erev of ∼+ 22 mV is consistent with a channel more selective for Na⁺ than K⁺. The relative permeability of the TRPC channel was determined by replacing ${\text{Na}}_o^{+}$ with Tris⁺. Local application of a solution including 36 mm Na⁺ and 140 mm Tris⁺ immediately reduced the TRPC inward current and produced a mean hyperpolarizing shift in V_z of −13.5 ± 3.8 mV (n = 4) (Fig. 7). The I–V relationship of the isolated TRPC current, obtained by subtracting the fully corrected I–V from the preceding control I–V, showed a shift in E_rev of −7.0 ± 3.2 mV (Fig. 7 I–V inset). From the Goldman–Hodgkin–Katz equation, this suggests a non-selective cation permeability ratio of P_Na: P_K 1: 0.6, and is consistent with the results of Na⁺ substitution experiments with recombinant TRPC3 channels (Lintschinger et al. 2000). While TRPC3 channels conduct a Ca²⁺ current, the recording of this is problematic, even in recombinant expression systems. However, Ca²⁺ imaging confirmed that TRPC-mediated Ca²⁺ entry in OHCs was primed by lowering [Ca²⁺]_i.

Figure 7. The TRPC inward current is largely borne by Na⁺.

The inward current elicited by the cycling of ${\text{Ca}}_o^{2+}$ was blocked by focal application of a solution with Tris⁺ (140 mm) replacing the majority of Na⁺. Left panel shows chart record of guinea pig OHC current in response to repeated voltage ramps (–100 to +50 mV, 1 s, every 3 s, V_h=−60 mV). Right panel shows I–V relationships for representative traces just prior to restoration of ${\text{Ca}}_o^{2+}$ (Std; including 1.5 mm ${\text{Ca}}_o^{2+}$) (1), at the peak of the TRPC inward current (2) and during the block of this current by Tris⁺ (3). The inset shows the leftward shift in E_rev of the isolated TRPC currents calculated by subtracting the control I–V from the I–V after activation of the TRPC current.

Imaging of TRPC channel-mediated Ca²⁺ influx

Simultaneous Ca²⁺ imaging and whole-cell patch-clamp recordings from guinea pig OHCs confirmed rapid Ca²⁺ entry followed the restoration of ${\text{Ca}}_o^{2+}$. Intracellular dialysis with the Ca²⁺ indicator Fluo-3 (100 μm) took approximately 5 min to reach a steady level of fluorescence in the Ca²⁺-containing solution. Superfusion of the nominally Ca²⁺-free solution produced a decrease in the [Ca²⁺]_i fluorescence signal over approximately 2 min, with a concomitant reduction in I_K,Ca (Fig. 8A; n = 5). The subsequent restoration of ${\text{Ca}}_o^{2+}$ elicited both a rapid overshoot in [Ca²⁺]_i and a coincident recruitment of I_K,Ca (Fig. 8A).

Superfusion with the sarcoplasmic/endoplasmic reticulum calcium ATPase (SERCA) pump blocker cyclopiazonic acid (CPA; 10 μm; n = 7) in standard solution, caused an increase in membrane (K_Ca) conductance consistent with the release of stored Ca²⁺. However, the presence of CPA during the cycling of ${\text{Ca}}_o^{2+}$ had no obvious effect on the TRPC current response (data not shown), suggesting that in OHCs the TRPC current is not coupled to intracellular Ca²⁺ stores. Similarly, ruthenium red (100 μm), an antagonist of Ca²⁺ store signalling (Zucchi & Ronca-Testoni, 1997) and TRPV4 receptors (Shen et al. 2006), failed to block the OHC TRPC current response when included in the recording electrode (n = 6 rat OHCs, data not shown).

As predicted by the block of the TRPC inward current by the selective antagonist erbstatin analogue, confocal Ca²⁺ imaging with Fluo-4 AM showed that erbstatin analogue blocked the increase in [Ca²⁺]_i elicited by the restoration of ${\text{Ca}}_o^{2+}$ (Fig. 8B and C). These experiments reconciled the electrophysiological characterization of a TRPC inward current with direct measurement of Ca²⁺ influx. Restoration of ${\text{Ca}}_o^{2+}$ invoked an overshoot in [Ca²⁺]_i with a mean F/F₀ of 1.35 ± 0.07 (n = 6) (Fig. 8C). A second cycling of [Ca²⁺] resulted in a Ca²⁺ influx which did not significantly vary from the first response in control experiments, but whuch was reduced by 72% in the presence of erbstatin analogue (mean F/F₀ = 0.33 ± 0.07; P < 0.01, Student's paired t test).

Second messenger activation of TRPC-mediated Ca²⁺ entry

Ca²⁺ entry channels assembled from TRPC3 subunits can be activated either by modulation of [Ca²⁺]_i or directly by DAG, a second messenger in the GPCR-PLC signalling pathway (Hofmann et al. 1999; Okada et al. 1999; Lintschinger et al. 2000; Ma et al. 2000). In guinea pig OHCs, bath application of 1-oleolyl-2-acetyl-sn-glycerol (OAG; an analogue of DAG; 100 μm to 1 mm; n = 14) in standard solution produced a dose-dependent increase in membrane current (Fig. 8D). In the absence of extracellular Ca²⁺, OAG had no effect. In control experiments, bath superfusion of the carrier DMSO alone produced no significant change in membrane current (data not shown). Confocal Ca²⁺ imaging confirmed that OAG increased [Ca²⁺]_i (1 mm OAG; n = 3; Fig. 8D). The OAG-mediated increases in both OHC membrane conductance and Ca_i²⁺ developed over several minutes.

Discussion

This study characterizes a TRPC Ca²⁺ entry current in guinea pig and rat outer hair cells which is activated by the lowering of Ca²⁺ levels following exposure to nominally Ca²⁺-free solution, and may provide a homeostatic mechanism that returns [Ca²⁺]_i to a set-point over a period of minutes. The conductance activated over seconds once Ca²⁺ was returned to the bathing solution, and led to the restoration of intracellular Ca²⁺ levels. Outward K⁺ current was rapidly recruited by the TRPC current, indicating a close coupling between the Ca²⁺ entry channels and K_Ca channels. The TRPC Ca²⁺ entry current was also activated by the DAG second messenger pathway, and is therefore positioned to augment G protein-coupled Ca²⁺ signalling in these cells. The pharmacological and biophysical characterization of the OHC Ca²⁺ entry current matches the phenotype of TRPC ion channels that incorporate TRPC3 subunits. The assignment of the OHC Ca²⁺ entry current to TRPC3-like channels was supported by RT-PCR and confocal immunofluorescence experiments, which identified strong TRPC3 expression in the hair cells, with a bipolar distribution of the TRPC3 protein at the apical transduction and basal synaptic poles.

The development of the slowly activating inward current in OHCs following depletion of cytosolic Ca²⁺ by exposure to low-Ca²⁺ solution is consistent with regulation of TRPC channel activation via calmodulin binding (Mizuno et al. 1999; Tang et al. 2001; Zhang et al. 2001). In addition, our observation that the OHC TRPC inward current, although largely borne by Na⁺, requires ${\text{Ca}}_o^{2+}$ (see Fig. 4A), is consistent with previous voltage-clamp studies of recombinant TRPC3 channels (Lintschinger et al. 2000). Similarly, the putative TRPC current in OHCs exhibited little rectification and a positive reversal potential indicative of a significant selectivity for Na⁺, as seen with recombinant TRPC3 homomeric and TRPC3/TRPC1 heteromeric Ca²⁺ entry channels (Lintschinger et al. 2000; Strubing et al. 2001; Hofmann et al. 2002). The OHC TRPC current was rapidly blocked by extracellular 2APB, comparable to the block of recombinant TRPC3 channels (Ma et al. 2000; Trebak et al. 2002). The use of the tyrosine kinase inhibitor erbstatin analogue provided the strongest pharmacological evidence that the OHC Ca²⁺ entry pathway is attributable to TRPC3 channels (Vazquez et al. 2004). Erbstatin analogue blocked both the Ca²⁺ depletion-activated OHC inward current and re-entry of Ca²⁺.

It seems likely, from our experiments, that TRPC-mediated Ca²⁺ entry establishes a ‘set-point’ for OHC [Ca²⁺]_i by balancing (via negative feedback control of TRPC channel activation) Ca²⁺ extrusion mechanisms such as the plasma membrane CaATPase (PMCA) (Dumont et al. 2001). Our data indicate that a fall in [Ca²⁺]_i below the reported resting levels of ∼100 nm (Ashmore & Ohmori, 1990) would activate TRPC channel Ca²⁺ entry and restore [Ca²⁺]_i. Dialysis of the cell with the modest Ca²⁺ buffering provided by 0.5 mm EGTA did not appear to activate TRPC current.

In OHCs, we used OAG to show that Ca²⁺ entry could be directly activated by the GPCR–Gq–PLC–PiP₂–DAG pathway, as reported for recombinant TRPC3 channels (Hofmann et al. 1999; Zitt et al. 2002). The production of DAG in the OHC plasma membrane is a previously unconsidered component of the P2YR–Gq–PLC_β pathway that promotes the release of Ca²⁺ from IP₃R-sensitive stores of Hensen's body found in the subcuticular plate region of guinea pig OHCs (Mammano et al. 1999; Okamura et al. 2001). Direct activation of TRPC-mediated Ca²⁺ entry by DAG may also contribute to OHC efferent regulation through the Gq-linked M₃ muscarinic receptor (Khan et al. 2002). However the dominant cholinergic efferent effect on OHCs is via the α₉/α₁₀ nicotinic receptor, where Ca²⁺ entry and associated Ca²⁺-induced Ca²⁺ release recruits the SK conductance within hundreds of milliseconds to hyperpolarize the cells (Housley & Ashmore, 1991; Evans et al. 2000; Oliver et al. 2000; Lioudyno et al. 2004). The TRPC channel Ca²⁺-entry pathway may also contribute to regulation of afferent synaptic neurotransmission. In cochlear hair cells, Ca_i²⁺ affects the rate and magnitude of vesicle exocytosis and endocytosis (Beutner et al. 2001), and the interaction between ryanodine-sensitive Ca²⁺ stores and BK channels, which inhibits IHC synaptic transmission (Beurg et al. 2005). The immunolocalization of TRPC3 in the basal region of OHCs matches that of the BK and SK channels (Oliver et al. 2000; Hafidi et al. 2005) and implies a spatial coupling with these K_Ca channels. Our voltage-clamp experiments clearly demonstrate a close coupling between the OHC TRPC Ca²⁺ entry pathway and the apamin-sensitive SK channels and ChTx-sensitive BK channels. The BK channels in particular were shown to have a major influence on OHC membrane filter properties by our manipulation of Ca²⁺ extrusion and Ca²⁺ entry. Figure 5A shows that the BK conductance is recruited about 5 s after the restoration of ${\text{Ca}}_o^{2+}$. This delay is similar to the onset of the underlying (TRPC) inward current and is consistent with the low threshold for [Ca²⁺]_o required to activate BK through this mechanism. The BK conductance was fully activated within 20 s in the example shown, whereas maximal activation of the TRPC inward current took twice as long.

As noted, expression of other members of the TRP channel superfamily has been shown in hair cells (Corey, 2006). However, the pharmacological properties of these channels (Ramsey et al. 2006) are incompatible with those of the OHC TRPC current reported here. TRPV4 expression has been identified in the hair cells and stria vascularis (Liedtke et al. 2000; Shen et al. 2006) where TRPV4 currents were activated by hypoosmotic stress and the phorbol ester 4-α-phorbol 12,13-didecanoate (4α-PDD) (Shen et al. 2006). TRPV4 currents are known to be potentiated with rises in [Ca²⁺]_i (Strotmann et al. 2003). In contrast, the OHC TRPC current appeared to be independent of changes in cell volume, and reduces as [Ca²⁺]_i rises. TRPA1 channels have been localized to the tip regions of the stereocilia (Kwan et al. 2006) where coupling with K_Ca channels would not occur. 2APB provides an effective block of TRPC current, and is a standard tool for functional analysis of recombinant TRPC channels (Trebak et al. 2002; Lievremont et al. 2005). However, 2APB may also inhibit IP₃R-gated Ca²⁺ release (Maruyama et al. 1997) and can affect several types of ion channels differently (Hu et al. 2004; Lemonnier et al. 2004). We noted a small reduction in background conductance by 2ABP in addition to the block of the TRPC current. Erbstatin analogue is a better discriminator for TRPC3 channels, as it inhibits non-receptor tyrosine kinase phosphorylation of TRPC3 channels, which is integral to their activation (Vazquez et al. 2004), but not other TRPC channels (Kawasaki et al. 2006). While erbstatin analogue may block KCNQ-type channels (Gamper et al. 2003), under our experimental conditions erbstatin analogue had no effect on the background conductance (see Fig. 5C), which would be largely mediated by KCNQ4 channels (Marcotti & Kros, 1999). Furthermore, we have directly demonstrated that erbstatin analogue blocks Ca²⁺ entry. Thus, while we cannot exclude the contribution of additional TRPC subunits to the TRPC channel, our data strongly implicate a functional role for the TRPC3 subunit. Full resolution of the molecular physiology of TRPC channels in OHCs will require screening for additional TRPC transcripts and proteins, advances in TRPC channel pharmacology, and subunit-specific manipulation of TRPC gene expression in animal models.

In summary, the TRPC-like Ca²⁺ entry mechanism in OHCs is a new element in hair cell Ca²⁺ signalling, which contributes to the regulation of sound transduction and auditory neurotransmission. The OHC TRPC conductance provides a negatively regulated feedback pathway for Ca²⁺ entry which contributes to Ca²⁺ homeostasis, and via activation by DAG, complements GPCR-mediated Ca²⁺ signalling. The TRPC Ca²⁺ entry current is closely linked to K_Ca channel activation and influences the OHC membrane conductance. The pharmacological and biophysical properties of the TRPC-like Ca²⁺ current are compatible with either homomeric or heteromeric TRPC ion channel assembly with TRPC3 subunits expressed by the hair cells.