Skip to main content
Journal of Neurology, Neurosurgery, and Psychiatry logoLink to Journal of Neurology, Neurosurgery, and Psychiatry
. 2007 Sep;78(9):977–979. doi: 10.1136/jnnp.2006.105940

Glucocerebrosidase gene mutation is a risk factor for early onset of Parkinson disease among Taiwanese

Yih‐Ru Wu 1,2, Chiung‐Mei Chen 1,2, Chih‐Ying Chao 1,2, Long‐Sun Ro 1,2, Rong‐Kuo Lyu 1,2, Kuo‐Hsuan Chang 1,2, Guey‐Jen Lee‐Chen
PMCID: PMC2117856  PMID: 17702778

Abstract

Background

Mutations in the glucocerebrosidase (GBA) gene have recently been identified as contributing to the development of Parkinson disease (PD) in Ashkenazi Jews.

Methods

To investigate whether this finding can be confirmed in a Taiwanese population, we conducted a case control study in a cohort of 518 PD patients and 339 controls for the three common GBA mutations in Taiwan, L444P, RecNciI and R120W, using PCR restriction enzyme assay and DNA sequencing.

Results

Heterozygous GBA mutations were detected in 16 PD patients (3.1%) and four controls (1.2%). Although this difference was not statistically significant (p = 0.0703), the average age at disease onset of the 16 PD patients (50.6 (12.3) years) was significantly younger than that of the total patient group (63.8 (10.5) years; p = 0.0007) and the non‐carrier patient group (64.2 (10.2) years; p = 0.0005). After stratification by age, the frequency of mutation carriers was significantly higher for the early onset PD (EOPD, age at onset ⩽50 years) group than for age matched controls (12.9% vs 1.8%; p = 0.0335) and there was a trend towards an increased risk of the mutation carrier with EOPD (odds ratio 8.30; 95% CI 1.45 to 156.53). Clinically, all 16 patients carrying a GBA mutation presented with a typical parkinsonian phenotype and experienced a good or excellent response to levodopa.

Conclusions

Mutations of the GBA gene may be associated with the development of EOPD in Taiwan.


Parkinson disease (PD) is the second most common neurodegenerative disease, characterised by resting tremor, bradykinesia, rigidity and postural instability. These symptoms result predominantly from selective loss of dopaminergic neurons in the substantia nigra pars compacta and subsequent depletion of dopamine in their projections. Pathologically, PD is defined by the presence of Lewy bodies, intracellular neuronal inclusions in the substantia nigra pars compacta and other brain sites.1 The pathogenesis of PD remains unclear. An interaction between environmental factors and genetic predisposition is thought to contribute to disease development.2 Causal mutations in the genes for α‐synuclein, parkin, DJ‐1, PTEN induced kinase 1 and leucine‐rich repeat kinase‐2 have been identified.3 However, mutations of these genes do not account for the occurrence of PD in all patients. Identifying novel PD genetic risk factors is important to understand its pathogenesis.

Gaucher disease (GD) is a recessively inherited glycolipid storage disorder caused by deficiency of the lysosomal enzyme glucocerebrosidase (GBA).4 Clinically, GD is characterised by vast phenotypic heterogeneity and is classified into three types based on the severity of associated neurological symptoms.5 Recent studies have reported genetic association between GD and PD.6,7 The molecular pathogenic mechanism causing PD in GBA mutation carriers remains unclear.

The gene encoding GBA has been localised at chromosome 1q21, and there is a highly homologous pseudogene (GBAP) sequence located 16 kb downstream.8 More than 200 mutations, including point mutations, deletions and rearrangements, have been identified in this gene (http://www.hgmd.cf.ac.uk/ac/gene.php?gene = GBA). Mutation analysis of GD patients in Taiwan has reported three common mutations, L444P, RecNciI (the recombination allele between the GBA and GBAP genes) and R120W, that account for 87% of Gaucher chromosomes.9 R120W was defined as a mild mutation associated with non‐neuropathic GD in Taiwanese.9

To investigate the possible association between the GBA gene mutations and PD in Taiwan, we examined the frequency of these three GBA mutations to determine whether the GBA mutations are genetically associated with PD, using a case control study design.

Methods

Subjects

In total, 518 unrelated patients with sporadic PD (45.2% woman), mean age at onset 63.8 (10.5) years (range 27–85), were enrolled. All patients were examined clinically and observed longitudinally by two neurologists (YRW and CMC) at outpatient clinics at Chang‐Gung Memorial Hospital Linkuo. Mean age of 339 unrelated healthy adult volunteers (47.5% female) was 60.3 (8.9) years (range 34–89). These control subjects were matched for age, gender, ethnic origin and area of residence. Data on family history, demographic characteristics, clinical data and neurological examination were completed for each patient. A clinical diagnosis of PD was based on published diagnostic criteria.10 Patients with a known genetic cause of parkinsonism were excluded. All subjects gave consent to the study and the protocol was approved by the hospital's internal ethics and scientific boards.

Analysis of GBA mutations

Mutation screening was performed by PCR amplification using two primer pairs separately. The PCR products were digested with restriction enzyme NciI and the resulting fragments were separated by agarose gel electrophoresis (table 1). The L444P (1448 T>C), RecNciI (1448 T>C, 1483 G>C, 1497 G>C) and R120W (475 C>T) mutations were confirmed by direct sequencing of PCR products from a second amplification. Mutation frequencies in patients and controls were compared using a two tailed Fisher exact test. Statistical significance was set at p<0.05. The difference in age at onset between carriers and non‐carriers or total patients was tested using the two tailed Student's t test. Odds ratios with 95% confidence intervals (95% CI) were calculated to test for the association between the GBA mutation and PD.

Table 1 PCR conditions and restriction enzyme detection of glucocerebrosidase mutations.

Mutation Anneal (°C)/ MgCl2 (mM) Enzyme (fragment bp)
R120W (C>T)
 F: GCAGAGTCCCATACTCTCCT 56/1.25 NciI: CCGGG
 R: TGGGTGACAGAGAGAGAGACT (454, 83/537)
L444P (T>C)
 F: GGAGGACCCAATTGGGTGCGT 58/1.0 NciI: CCCGG
 R: ACGCTGTCTTCAGCCCACTTC (638/536, 102)

Results

The distributions and association of GBA mutations in patients and controls are shown in table 2. In total, 16 patients (3.1%) carried a heterozygous mutant GBA allele: 13 had L444P, two had RecNciI and one had R120W. In addition, four control subjects (1.2%) had a heterozygous mutant GBA allele: two had L444P and two had RecNciI (table 3). The difference in percentages of mutation frequencies in patients (3.1%) and controls (1.2%) was not statistically significant (p = 0.0814). However, the average age at disease onset of the 16 PD patients (50.6 (12.3) years) was significantly younger than that of the total patient group (63.8 (10.5); p = 0.0007) and the non‐carrier patient group (64.2 (10.2); p = 0.0005). Following stratification by age, the frequency of mutation carriers was significantly higher for the early onset PD (EOPD) group (age at onset ⩽50 years) than age matched controls (12.9% vs 1.8%; p = 0.0335). There was a trend towards an increased PD risk for the mutation carrier (odds ratio 8.30, 95% CI 1.45 to 156.53; p = 0.0496) (table 2).

Table 2 Distributions and association of glucocerebrosidase mutations in patients and controls.

PD (518) (n (%)) Controls‐1 (339) (n (%)) Odds ratio* (95% CI) p Value
Non‐carrier 502 (96.9) 335 (98.8) 1.00
Carrier of GD 16 (3.1) 4 (1.2) 2.67 (0.97–9.38) 0.0814
EOPD (62) (n (%)) Controls‐2 (57) (n (%)) Odds ratio* (95% CI) p Value
Non‐carrier 54 (87.1) 56 (98.2) 1.00
Carrier of GD 8 (12.9) 1 (1.8) 8.30 (1.45–156.53) 0.0496

EOPD, early onset Parkinson disease; GBA, glucocerebrosidase; GD, Gaucher disease; PD, Parkinson disease.

*Odds ratios of GBA mutation carriers were calculated by comparing the value to the non‐carrier individuals.

Table 3 Clinical data for patients with Parkinson disease and glucocerebrosidase mutations.

Study ID Mutation Age at onset* (y) Disease duration (y) Family history of PD Sex Additional information
Patients
 H44 L444P 60 7 N F L‐dopa response (+), motor fluctuation (+)
 H46 R120W 62 4 N M L‐dopa response (+)
 H80 RecNciI 34 8 N F L‐dopa response (+), motor fluctuation (+)
 H86 L444P 29 13 N M L‐dopa response (+), motor fluctuation (+), STN‐DBS implantation (+)
 H213 L444P 57 19 Y M L‐dopa response (+), motor fluctuation (+), STN‐DBS implantation (+)
 H351 L444P 57 11 N F L‐dopa response (+), motor fluctuation (+), STN‐DBS implantation (+)
 H434 L444P 46 3 N F L‐dopa response (+), motor fluctuation (+)
 H507 L444P 64 12 N F L‐dopa response (+), motor fluctuation (+), dementia (+)
 H590 L444P 67 4 N F L‐dopa response (+)
 H707 L444P 55 5 N M L‐dopa response (+)
 H837 L444P 46 3 N M L‐dopa response (+)
 H867 L444P 64 2 N M L‐dopa response (+)
 H1279 L444P 30 8 N M L‐dopa response (+), motor fluctuation (+)
 H1405 RecNciI 49 4 N F L‐dopa response (+), depression (+)
 H1421 L444P 50 7 N F L‐dopa response (+), depression (+)
 H1500 L444P 40 7 N M L‐dopa response (+), motor fluctuation (+)
Controls
 C769 L444P 76 N F
 C806 L444P 73 N F
 C877 RecNciI 57 N F
 C972 RecNciI 43 N F

PD, Parkinson disease; STN‐DBS, subthalamic nucleus deep brain stimulation.

*Age at study inclusion for control individuals.

Table 3 presents the demographic and clinical characteristics of the 20 carriers. Clinically, all 16 patients carrying a GBA mutation presented with a typical parkinsonian phenotype and experienced a good or excellent response to levodopa. Marked fluctuations and dyskinesias were seen in two EOPD patients (H80 and H86). Three patients (H86, H213 and H351) experienced an excellent response to subthalamic nucleus deep‐brain stimulation. During disease progression, two patients (H1405 and H1421) experienced depression and one (H507) developed dementia after having the disease for >10 years.

Discussion

We examined the possible role of GBA mutations in PD in an ethnically homogeneous Taiwanese population. Although PD patients (3.1%) had a higher frequency of the three GBA mutations compared with controls (1.2%), the difference was not significant. This finding is similar to, and more relevant than, the study reported by Toft et al11 in which 2.3% of Norwegian patients with PD carried N370S or L444P mutation compared with 1.7% of controls (p = 0.58). Our results differ from those of increased susceptibility to PD in GBA mutation carriers in an Ashkenazi Jewish population in which 31.3% of PD patients carried 1 of 6 examined GBA mutations,6 and from those in Caucasians of Canadian origin in which 5.7% of PD patients carried 1 of 7 examined GBA mutations.7 Notably, following stratification by age, we observed a higher frequency of the GBA mutations in EOPD patients (12.9%) compared with controls aged <50 years (1.8%) (p = 0.0335). Average age at onset of the carrier PD group (50.6 (12.3) years) was significantly younger than that of non‐carriers (64.2 (10.2) years; p = 0.0005). This finding is compatible with that reported by Sato et al7 where a marginally significant association of GBA mutations with PD was demonstrated, 70% of all PD patients were aged <50 years at onset and all GBA mutation carriers presented with asymmetrical early onset (range 31–52 years). Combined with a trend towards an increased risk of having the mutation carrier with EOPD (odds ratio 8.30, 95% CI 1.45 to 156.53), our results demonstrate that the GBA gene mutation is a risk factor for EOPD in Taiwanese subjects.

Identification of genes that cause PD (α‐synuclein and parkin) indicates that the underlying ubiquitin–proteasome pathway is involved in the pathogenesis of PD. Perturbation of normal α‐synuclein function probably plays a role in onset or progression of sporadic PD. The lysosomal pathway is an alternative mechanism for regulation and degradation of proteins. As glucocerebroside accumulation interferes with the affinity of a functional form of α‐synuclein for lipid surfaces,12 a recent finding that elevated binding of α‐synuclein to glucocerebroside containing glycosphingolipids in GBA mutation carriers supports this scenario.13 Further evidence suggests that processing of α‐synuclein occurs in lysosomes,14 the site of glycosphingolipid metabolism. Mutations in GBA may lead to its misfolding and affect lysosomal targeting and proteosomal function, thereby interfering with α‐synuclein aggregation clearance. A possible PD–GD connection would therefore involve a toxic gain of function related to improper α‐synuclein degradation, aberrant α‐synuclein accumulation or a combination of both processes.

Although mutations in the GBA gene are relevant to idiopathic PD in Ashkenazi Jews, no difference in age at disease onset between carriers and non‐carrier patients was reported.15 This is different from our observation that PD patients carrying the GBA mutations had an earlier age of onset of disease. These different findings may be explained by the fact that the modifier gene(s) contributing to the disease phenotype may differ in different populations, and that epistatic gene–gene interactions or specific multi‐loci haplotype may be involved in determining age of disease onset. Moreover, other environmental factors may account for this diversity. Our observation that variations in the GBA gene may be a common susceptible factor for the development of EOPD may provide an example of the heterozygosity of a Mendelian disorder gene acting as a risk factor for a complex disease. A large series of clinically and genetically well defined studies is warranted to resolve the true frequency of GBA mutations in the general population and their contribution to PD, thereby strengthening the association observed in this study.

Acknowledgements

The authors thank the patients with Parkinson disease and normal controls for participating in this study. A portion of this work was supported by grants NSC‐95‐3112‐B‐003‐002 and NSC‐95‐2314‐B‐182A‐061 from the National Science Council, Executive Yuan, Taiwan.

Abbreviations

EOPD - early onset Parkinson disease

GBA - glucocerebrosidase

GD - Gaucher disease

PD - Parkinson disease

Footnotes

Competing interests: None.

References

  • 1.Gibb W R, Lees A J. The significance of the Lewy body in the diagnosis of idiopathic Parkinson's disease. Neuropathol Appl Neurobiol 19891527–44. [DOI] [PubMed] [Google Scholar]
  • 2.Warner T T, Schapira A H. Genetic and environmental factors in the cause of Parkinson's disease. Ann Neurol 200353(Suppl 3)S16–S23. [DOI] [PubMed] [Google Scholar]
  • 3.Gasser T. Genetics of Parkinson's disease. Curr Opin Neurol 200518363–369. [DOI] [PubMed] [Google Scholar]
  • 4.Beutler E, Grabowski G A. Gaucher disease. In: Scriver CR, Beaudet AL, Sly WS, et al eds. The metabolic basis of inherited diseases. New York: McGraw‐Hill Press, 20013635–3668.
  • 5.Germain D P. Gaucher's disease: a paradigm for interventional genetics. Clin Genet 20046577–86. [DOI] [PubMed] [Google Scholar]
  • 6.Aharon‐Peretz J, Rosenbaum H, Gershoni‐Baruch R. Mutations in the glucocerebrosidase gene and Parkinson's disease in Ashkenazi Jews. N Engl J Med 20043511972–1977. [DOI] [PubMed] [Google Scholar]
  • 7.Sato C, Morgan A, Lang A E.et al Analysis of the glucocerebrosidase gene in Parkinson's disease. Mov Disord 200520367–370. [DOI] [PubMed] [Google Scholar]
  • 8.Horowitz M, Wilder S, Horowitz Z.et al The human glucocerebrosidase gene and pseudogene: structure and evolution. Genomics 1989487–96. [DOI] [PubMed] [Google Scholar]
  • 9.Wan L, Hsu C M, Tsai C H.et al Mutation analysis of Gaucher disease patients in Taiwan: High prevalence of the RecNciI and L444P mutations. Blood Cells Mol Dis 200636422–425. [DOI] [PubMed] [Google Scholar]
  • 10.Hughes A J, Daniel S E, Kilford L.et al Accuracy of clinical diagnosis of idiopathic Parkinson's disease: a clinico‐pathological study of 100 cases. J Neurol Neurosurg Psychiatry 199255181–184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Toft M, Pielsticker L, Ross O A.et al Glucocerebrosidase gene mutations and Parkinson disease in the Norwegian population. Neurology 200666415–417. [DOI] [PubMed] [Google Scholar]
  • 12.Bussell R, Jr, Eliezer D. Effects of Parkinson's disease‐linked mutations on the structure of lipid‐associated α‐synuclein. Biochemistry 2004434810–4818. [DOI] [PubMed] [Google Scholar]
  • 13.Cullen V C, Muething J, Meisen I.et al Binding of synuclein to human glycosphingolipids. Soc Neurosci 20041405 [Google Scholar]
  • 14.Cuervo A M, Stefanis L, Fredenburg R.et al Impaired degradation of mutant α‐synuclein by chaperone‐mediated autophagy. Science 20043051292–1295. [DOI] [PubMed] [Google Scholar]
  • 15.Aharon‐Peretz J, Badarny S, Rosenbaum H.et al Mutations in the glucocerebrosidase gene and Parkinson disease: phenotype–genotype correlation. Neurology 2005651460–1461. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Neurology, Neurosurgery, and Psychiatry are provided here courtesy of BMJ Publishing Group

RESOURCES