Skip to main content
Neoplasia (New York, N.Y.) logoLink to Neoplasia (New York, N.Y.)
. 2007 Dec;9(12):1111–1121. doi: 10.1593/neo.07712

Oxidative Stress Modulates DNA Methylation during Melanocyte Anchorage Blockade Associated with Malignant Transformation1

Ana C E Campos *,2, Fernanda Molognoni *,2, Fabiana H M Melo *, Luciano C Galdieri , Célia R W Carneiro *, Vânia D'Almeida , Mariangela Correa *, Miriam G Jasiulionis *,
PMCID: PMC2134907  PMID: 18084618

Abstract

Both oxidative/nitrosative stress and alterations in DNA methylation are observed during carcinogenesis of different tumor types, but no clear correlation between these events has been demonstrated until now. Melanoma cell lines were previously established after submitting the nontumorigenicmelanocyte lineage, melan-a, to cycles of anchorage blockade. In this work, increased intracellular oxidative species and nitric oxide levels, as well as alterations in the DNA methylation, were observed after melan-a detachment, which were also associated with a decrease in intracellular homocysteine (Hcy), an element in the methionine (universal methyl donor) cycle. This alteration was accompanied by increase in glutathione (GSH) levels and methylated DNA content. Furthermore, a significant increase in dnmt1 and 3b expression was identified along melan-a anchorage blockade. lG-Nitro-l-arginine methyl esther (l-NAME), known as a nitric oxide synthase (NOS) inhibitor, and N-acetyl-l-cysteine (NAC) prevented the increase in global DNA methylation, as well as the increase in dnmt1 and 3b expression, observed during melan-a detachment. Interestingly, both l-NAME and NAC did not inhibit nitric oxide (NO) production in these cells, but abrogated superoxide anion production during anchorage blockade. In conclusion, oxidative stress observed during melanocyte anchorage blockade seems to modulate DNA methylation levels and may directly contribute to the acquisition of an anoikis-resistant phenotype through an epigenetic mechanism.

Keywords: Anoikis, carcinogenesis, epigenetics, DNA methylation, oxidative stress

Introduction

The interaction between cells and their surrounding extracellular matrix is a major determinant of cell behavior by modulating gene expression, cell growth, differentiation, migration, and overall tissue architecture. Cell survival also depends on anchorage to extracellular matrix and on cell-cell contacts. Apoptosis induced by loss of appropriate cell-matrix contact has been termed anoikis and plays an essential role in regulating homeostasis, as it maintains the correct cell number of high turnover tissues [1,2]. An important feature of transformed cells is loss of anchorage-dependent growth control, leading to increased survival time and facilitating an eventual reattachment. Thus, the ability of escaping anoikis regulation is a critical step in oncogenesis [3].

Reduced substrate adhesion or lack of growth factors represent adverse conditions that confer a dramatic rise in cellular stress, characterized by damage to various cellular constituents such as DNA, protein, and lipids that ultimately triggers death signals [4,5]. Low or subtoxic levels of reactive oxygen species (ROS) can act as potent second messengers in signal transduction pathways that regulate cell growth and transformation [6,7]. High levels of ROS have been considered direct DNA-damaging agents that increase the mutation rate and promote and maintain the oncogenic phenotype [8–10]. Neither superoxide (O2·-) nor hydrogen peroxide (H2O2) are particularly toxic, but cells can greatly increase the toxicity of superoxide by producing nitric oxide (NO) that may function as an antiapoptotic or proapoptotic agent depending on concentration and cell type [11]. Superoxide anion and NO react to produce peroxynitrite (ONOO-) that can readily modify proteins and other molecules [12]. In addition to causing genetic changes, ROS may lead to epigenetic alterations that strongly affect gene expression without changing the DNA base sequence [13–15].

Epigenetic changes, including alterations in DNA methylation status, have been implicated with malignant transformation and progression of numerous tumor types. The addition of methyl (CH3) radicals to the cytosine nucleotide is catalyzed in mammals mainly by three different DNA methyltransferases (Dnmt), namely DNMT 1, 3a, and 3b. DNMT3 group comprises two enzymes with catalytic activity (DNMT 3a and 3b) and DNMT 3L, which has a regulatory role [16,17].

Neoplastic cells present simultaneously regional DNA hypermethylation and global hypomethylation. Hypermethylation of promoter regions is associated with tumor suppressor gene silencing by interfering with the binding of transcription factors or by recruiting corepressor complexes containing, for example, histone deacetylases. Global DNA hypomethylation can result in oncogene expression, genomic instability, and loss of imprinting. Alterations in methylation patterns can thus determine the gene expression profile, which is crucial for comprehension of carcinogenesis [18–20].

Recently, an in vitro transformation model of murine melanocytes has been developed in our laboratory, after submitting a nontumorigenic melanocyte lineage, melan-a, to sequential cycles of anchorage blockade [21,22]. The aim of the present study was to determine whether anchorage blockade results in altered ROS and/or NO levels, and the resulting effect on DNA methylation, which may contribute to melanocyte malignant transformation.

Materials and Methods

Cell Culture

Murine nontumorigenic melanocyte lineage melan-a [23], a kind gift from Dr. Michel Rabinovitch (Discipline of Parasitology, Universidade Federal de Säo Paulo - UNIFESP), was maintained in RPMI 1640 (Gibco, Carlsbad, CA), pH 6.9, containing 5% fetal bovine serum (Gibco), 40 mg/l gentamicin, and 200 nM phorbol 12-myristate 13-acetate (Sigma, St. Louis, MO) at 37°C in 5% CO2. For anchorage blockade assays, adherent melan-a cells were removed from plates by trypsin treatment (D0) and plated (105 cells/ml) on 1% agarose-coated dishes for 1 to 24 hours (D1h to D24h) in the conditions described above. In these conditions, melan-a cells do not adhere to the plastic and remain viable in suspension for at least 24 hours, as demonstrated by the Trypan blue exclusion assay (data not shown).

Measurement of Superoxide Anion (O2·-) by Flow Cytometry

Relative concentrations of intracellular O2·- were determined as described previously [24]. Control adherent cells (D0) and cells submitted to anchorage blockade for different periods of time (D1h, D3h, D5h, and D24h) were assayed for O2·- detection using dihydroethidium (DHE; Molecular Probes, Carlsbad, CA). Briefly, cells were washed in phosphate-buffered saline (PBS) and resuspended in PBS containing 10 µM DHE at 37°C for 30 minutes. After washing, cells were resuspended in PBS and analyzed (10,000 events per sample) by flow cytometry (FACScalibur; Becton Dickinson, San Juan, CA) (excitation wavelength = 480 nm; emission wavelength = 567 nm).

Glutathione Assay

Total glutathione (GSH) content was measured from cell lysates obtained during adhesion (D0) and deadhesion conditions (D1h, D5h, and D24h). Cells were mixed with the same volume of 2 M perchloric acid with 4 mM EDTA. After pH neutralization with K3PO4 and centrifugation, supernatants were collected for reaction with nicotinamide adenine dinucleotide phosphate (4 mg/ml in 0.5% NaHCO3 buffer), 5,5′-dithiobis(2-nitro-benzoic acid) (1.5 mg/ml in 0.5% NaHCO3 buffer), and GSH reductase (6 U/ml in 0.1 M KPO4, pH 7, with 1 mM EDTA). Total GSH levels were obtained spectrophotometrically at 412 nm [25] and all determinations were normalized to the protein content [26]. Total GSH contents were expressed as nanomole per milligram of protein.

Nitric Oxide Detection

The fluorescent NO indicator, diaminofluorescein-2 diacetate (DAF-2DA), was used to measure intracellular [NO] [27] in adherent (D0) and suspended cells (D1h, D3h, D5h, and D24h). DAF-2DA readily enters the cells and it is hydrolyzed by cytosolic esterases to DAF-2, which is trapped inside cells. In the presence of NO and oxygen, the relatively nonfluorescent DAF-2 is converted into the highly green fluorescent triazole form DAF-2T. Thus, increases in DAF-2T fluorescence represent elevation of [NO]. Cells were incubated with DAF-2DA (10 µM) in 0.5 ml of PBS at room temperature for 30 minutes, rinsed with PBS, and analyzed by flow cytometry in a FACScan (Becton Dickinson) (excitation wavelength = 495 nm; emission wavelength = 515 nm). Alternatively, extracellular NO levels were also determined by a gas-phase chemiluminescence reaction of NO with ozone using a NO Analyzer (NOA 280; Sievers Instruments, Inc., Boulder, CO). NO-related species (nitrite, nitrate, S-nitrosothiols, and so on) are converted to NO in the purge vessel of the analyzer. The released NO is carried by an inert gas to the detector where it reacts with ozone to produce a chemiluminescence signal proportional to the concentration. A standard curve was established with a set of serial dilutions (0.1–100 µM) of sodium nitrate. The concentrations of NO metabolites in the samples were determined by comparing with the standard curve and expressed as micromole per liter. Data collection and analysis were performed using the NOAnalysis software (version 3.21; Sievers) [28].

Lipid Peroxidation Assay

Lipid peroxidation was measured by quantifying thiobarbituric acid-reactive substances, mainly malondialdehyde (MDA), formed during incubation using the thiobarbiturate-MDA adduct formation [29]. The product of the reaction between cell lysates and thiobarbituric acid was measured spectrophotometrically at 535 nm and values were expressed as nanomole per milligram of protein.

Homocysteine and Cysteine Quantification

Intracellular homocysteine (Hcy) was measured during adhesion (D0) and deadhesion conditions (D24h) by high-performance liquid chromatography (HPLC) with fluorimetric detection and isocratic elution. This methodology was adapted from Pfeiffer et al. [30] and it involves three steps, namely reduction of thiol groups using tris(carboxyethyl)-phosphine, protein precipitation with trichloroacetic acid, and derivatization with 7-fluorobenzene-2-oxy-1,3-diazolic-4-ammonium sulfate. The HPLC system used was a Shimadzu apparatus with a SIL-10ADvp automatic sample injector and a RF-10AXL fluorescence detector (Shimadzu, Tokyo, Japan). Chromatographic separation was performed using a C18 model Shim-pack CLC-ODS column (4.6 x 150 mm2, with 5.0-µm microparticles; Shimadzu). The fluorescence was analyzed with a detector adjusted for excitation at 385 nm and emission at 515 nm. Total Hcy and cysteine (Cys) content, expressed as nanomole per milligram of protein, were calculated with a calibration curve using known Hcy, Cys, and cystamine concentrations as the internal standards.

5-Methylcytosine Content

Global DNA methylation was evaluated by staining cells with a specific monoclonal antibody against 5-methylcytosine (5-MeC; Oncogene, La Jolla, CA), as previously described [31]. Cells in adherent (D0) or nonadherent (D1h, D3h, and D24h) conditions were washed with PBS supplemented with 0.1% Tween 20 and 1% bovine serum albumin (PBS-TB), fixed with 0.25% paraformaldehyde at 37°C for 10 minutes, followed by 88% methanol at -20°C for at least 30 minutes. After washing, cells were treated with 2 N HCl at 37°C for 30 minutes, neutralized with 0.1 M sodium borate (pH 9.0), and blocked with 10% mouse serum for 20 minutes at 37°C. Then, cells were incubated with anti-5-MeC antibody at a final concentration of 1 µg/ml for 45 minutes at 37°C, followed by incubation with goat anti-mouse IgG conjugated with fluorescein (Kirkegaard & Perry Laboratories Inc. (KPL), Gaithersburg, MD) for 30 minutes at 37°C. Finally, cells were analyzed by flow cytometry in a FACScan. For nitric oxide synthase (NOS) inhibition and antioxidant assays, adhered melan-a cells were treated for 18 hours with 1 mM lG-nitro-l-arginine methyl esther (l-NAME), 5 mM N-acetyl-l-cysteine (NAC), or 1% dimethylsulphoxide (DMSO), submitted to the anchorage blockade protocol as described above in the presence of inhibitors, and analyzed for 5-MeC content. The NOS inhibitor and antioxidants were used at noncytotoxic concentrations, estimated by methyl thiazol tetrazolium (MTT) assays.

Cytotoxicity Assays

MTT assay was performed to determine noncytotoxic concentrations of the NO inhibitor l-NAME and the antioxidants. Briefly, cells were seeded at a density of 2.5 x 105 cells/ml in 96-well plates (in a final volume of 200 µl) in complete medium and replicates of three. After adhesion, cells were incubated with various concentrations of l-NAME (0.5, 1, 2, 4, and 8 mM), NAC (0.5, 1, 5, and 10 mM), catalase (5, 10, 50, and 100 U/ml), peroxidase (10, 50, 100, and 200 U/ml), and DMSO (0.5, 1, and 2%) in serum-free medium. After 24 hours of incubation, 20 µl of MTT (5 mg/ml; Sigma) was added and incubated for 1 hour at 37°C. Supernatant was then removed, and 100 µl of isopropanol was added. Culture plates were incubated for 15 minutes at room temperature to dissolve MTT crystals. Absorbance values were determined by an Multiskan MS (Labsystems, Vantaa, Finland) at a wavelength of 570 nm. Each experiment was repeated twice.

Western Blot Analysis

Protein extracts (50 µg) from adherent (D0) and suspended (D1h, D3h, D5h, and D24h) melan-a cells, treated or not with the nonspecific NOS inhibitor l-NAME (1 mM), were submitted to Western blot analysis using rabbit polyclonal antibodies against dnmt3b (Abcam, Cambridge, MA) and dnmt1 (Abcam), followed by incubation with peroxidase-conjugated anti-rabbit antibody (KPL) and developed using an enhanced chemiluminescence (ECL) detection reagent (GE Healthcare, Buckinghamshire, UK).

Reverse Transcription-Polymerase Chain Reaction

Total RNA was extracted from adherent and deadherent melan-a cells with TRIzol reagent (Invitrogen, Carlsbad, CA), according to the manufacturer's instructions. One microgram of RNA was reverse-transcribed to cDNA with Superscript III (Invitrogen). The resulting single-strand cDNAs were amplified by polymerase chain reaction (PCR) as follows: initial 5 minutes at 94°C, followed by 42 cycles of denaturing at 94°C for 30 seconds, with combined annealing at 56.5°C for 30 seconds, and extension at 72°C for 60 seconds. The β-actin mRNA was used to normalize the amounts of RNA in the cell samples, and the intensities of the resulting PCR bands were used to calculate the ratio of endothelial NOS (eNOS)/β-actin intensities. PCR fragment amplification was confirmed by agarose gel staining with ethidium bromide. PCR detection of eNOS and actin mRNA was carried out by using the primers: eNOS F 5′ CATGGAAATGTCAGGCCCG 3′; eNOS R 5′ TTCCACAGAGAGGATTGTAGC 3′; actin F 5′ CGAGGCCCAGAGCAAGAGAG 3′; actin R 5′ AGGAAGAGGATGCGGCAGTGG 3′.

Statistical Analysis

GraphPad Prism 3.03 software (San Diego, CA) was used for statistical analysis. One-way analysis of variance test was initially performed to analyze sample groups and unpaired t tests were used to compare suspended cells samples to adherent cells controls. All experiments were performed at least three times, each one in triplicates, and one representative experiment is shown.

Results

Anchorage Blockade Induces Oxidative and Nitrosative Stress

Several types of environmental stress induce ROS and reactive nitrogen species production, but few studies address the relationship of forced anchorage impediment and free radicals levels in melanocytes. To investigate the effect of anchorage blockade on ROS production, adherent (D0) and deadherent melan-a cells (D1h, D3h, D5h, and D24h) were assayed for intracellular superoxide anion (O2·-). Intracellular O2-- levels, which have been shown to be increased in human metastatic melanomas compared to normal melanocytes [32], become elevated progressively along melan-a anchorage blockade. In adherent conditions (D0), 1% of cells are positive for the O2·- marker, whereas 30% of cells maintained in suspension for 5 (D5h) to 24 hours (D24h) showed positivity (Figure 1).

Figure 1.

Figure 1

Anchorage blockade of nontumorigenic melanocytes (melan-a) induces superoxide anion (O2·-) production. Intracellular O2·- concentration were analyzed by flow cytometry in suspended (D1h, D3h, D5h, and D24h) and adherent (DO) melan-a cells using the nonfluorescent cell-permeant probe DHE, which, in contact with O2·-, becomes highly fluorescent. Light gray lines represent nonstained and black lines represent stained melan-a cells. Numbers inside graphs represent percentage of positive cells relatively to nonstained controls.

Oxidized and reduced GSH levels are commonly used as a measurement of intracellular redox state [33], and total GSH levels were investigated during exposure of melan-a cells to anchorage blockade. The ratio of intracellular GSH relative to total protein content was not significantly increased during the first hours in suspension (D1h, P = .064 and D5h, P = .159), when H2O2 levels were maximum (data not shown), but became elevated in a statistically significant manner only after 24 hours in detached cells (D24h, P = .020; Figure 2A), when H2O2 levels returned to concentrations found in adherent cells (data not shown), suggesting that increased glutathione levels could be acting in the removal of excessive H2O2 through reduction.

Figure 2.

Figure 2

Stress response to anchorage blockade induces nitric oxide production and alterations in homocysteine levels. Total cellular glutathione levels (measured by colorimetry), indicating an antioxidative response, become significantly elevated after 24 hours of anchorage blockade (A). Intracellular nitric oxide concentrations, analyzed by the NO fluorescent indicator, DAF (B), as well as one of the main lipid peroxidation products, malondialdehyde (MDA; C), also become significantly elevated along anchorage blockade. Levels of the glutathione precursor homocysteine (Hcy), but not cysteine (Cys), determined by HPLC showed a drastic reduction when maintained in suspension for 24 hours, compared to adhered control cells (D and E, respectively). Endothelial NO synthase (eNOS) mRNA expression was strongly induced after melan-a anchorage blockade (F). The murine endothelial cell line L229 was used as an eNOS expression positive control. Actin mRNA expression was used as an internal control and numbers below this figure show eNOS/actin ratio. Numbers inside flow cytrometry graphs (B) represent percentage of stained positive cells (black lines) relatively to nonstained controls (light gray lines). Asterisks indicate statistical significance levels, determined by unpaired t tests between each suspended cell sample (D1h, D3h, D5h, D8h, and D24h) compared to adhered control cells (D0). *P < .05, **P < .01, ***P < .0005.

ROS production has been associated also with that of NO, whose derivatives (N2O3, NO2-, peroxynitrite, and others) possess a strong oxidative capacity [34]. We estimated intracellular NO concentration in adherent (D0) and deadherent (D1h, D8h, and D24h) melan-a (Figures 2B and 4C); NO levels are higher in samples collected from suspended cell cultures than from adherent melan-a cells (D0), peaking around 5 hours in suspension and decreasing after 24 hours in deadherent conditions (Figure 2B). In addition, exposure of melan-a melanocytes to anchorage blockade resulted in a significant expression of eNOS (type III), different from adherent cells (D0) that did not express this enzyme (Figure 2F). Neither adherent nor suspended melan-a cells expressed neuronal NOS (nNOS) (type I) (data not shown).

Figure 4.

Figure 4

l-NAME and NAC do not inhibit NO production, but abrogate O2·- generation during melan-a anchorage blockade. Melan-a cells submitted to anchorage blockade (D3h) produced significant amounts of NO, estimated by NO analyzer, compared to adherent melan-a cells (D0). NO generation was not affected by either l-NAME (LN), NAC, or catalase (Cat) treatment (A). Intracellular O2·- levels were determined by flow cytometry (FACScan; Becton Dickinson) using DHE staining. l-NAME and NAC, but not catalase (Cat), treatment strongly inhibited O2·- generation by deadhered melan-a cells (D3h) (B). C: nontreated melan-a cells. Numbers inside graphs represent percentage of positive stained cells (black lines) relatively to control cells incubated in the absence of DHE (light gray lines). ***P < .0005.

Lipid hydroperoxides are the initial products of unsaturated fatty acid oxidation caused by peroxynitrite, the reaction product of NO with O2·- [35]. One of the major aldehyde products of lipid peroxidation isMDA and, as shown in Figure 2C, its levels increase progressively, soon after melanocyte anchorage blockade. These results clearly show that anchorage impediment in melanocytes results initially in increased levels of ROS and NO, later followed by accumulation of total glutathione.

Anchorage Blockade Induces Hcy Depletion

Approximately half of the intracellular GSH pool in cells is derived from Hcy through the transsulfuration pathway [36]. Hcy is a metabolite in the methionine cycle and has two major fates: 1) transsulfuration catalyzed by cystathionine β-synthase leading to cystathionine and 2) remethylation catalyzed by methionine synthase or by betaine Hcy methyltransferase. In the former pathway, cystathionine is subsequently converted to Cys, a precursor of GSH [37]. Cells can make the necessary Cys from methionine, or they can take it up from the surrounding fluids. Because the maintenance of intracellular GSH pool is regulated by Cys concentrations, which in vivo main source is the Hcy-dependent transsulfuration pathway, we compared Hcy concentrations in adherent (D0) and suspended (D24h) melan-a cells. Melan-a cells maintained in suspension for 24 hours show a dramatic decrease in intracellular Hcy concentrations compared to adherent melan-a cells (Figure 2D), whereas Cys levels remain stable in this condition (Figure 2E).

Anchorage Blockade Alters 5-MeC Content

In the second metabolic pathway, Hcy is remethylated to methionine, which is further converted to S-adenosylmethionine (SAM) by methionine adenosyltransferase. SAM, the universal methyl donor, is demethylated by several enzymes, such as DNA methyltransferases [38]. Alterations in Hcy levels in deadherent melan-a cells led us to investigate whether global DNA methylation was altered during melana anchorage blockade. Figure 3A (CTRL) shows that global DNA methylation is augmented in suspended melan-a cells (D1h, D3h, and D24h) when compared to adherent ones (D0, 47.3% of 5-MeC-positive cells). 5-Methylcytosine levels are elevated as soon as 1 hour (70.2% positive cells) and become progressively higher up to 24 hours after adhesion blockade (95.9% positive cells).

Figure 3.

Figure 3

Total DNA methylation levels and dnmt1 and 3b expression become elevated during forced anchorage blockade, and this response is abrogated by the l-NAME and NAC. 5-MeC content, analyzed by flow cytometry using a specific antibody (Oncogene), augments along melan-a adhesion blockade (D1 - 24h) compared to the adherent counterpart (D0) and this increase is abolished when these cells are treated with 1 mM l-NAME or with the antioxidant NAC, but not with DMSO (A). Numbers inside graphs represent percentage of positively stained cells (black lines) relative to control cells incubated in the absence of primary antibody (light gray lines). Suspended melan-a cells (D1 - 24h) present elevated expression of dnmt1 (D) and 3b (B and C) along time compared to adherent control cells (D0), as analyzed by Western blot using specific antibodies against dnmt1 and 3b (Abcam), and l-NAME treatment inhibits both dnmt1 and 3b expression in suspension condition [D3h and D24h for dnmt3b (C); D5h for dnmt1 (D)]. D0: adhered melan-a; D1h, D3h, D24h: suspended melan-a cells. -: nontreated cells, +: treated cells. Numbers below blots indicate dnmt/actin ratio.

l-NAME and NAC Abrogate DNA Hypermethylation and the Concomitant Increase in dnmt1 and 3b Expression during Anchorage Blockade

Considering that the increase in reactive species production and DNA methylation have a temporal association in this model, we tested whether these phenomena share a causal relationship. Figure 3A shows that l-NAME, a known NOS inhibitor, and the cell-permeant antioxidant NAC impair global DNA hypermethylation observed during melan-a anchorage blockade. l-NAME completely reversed 5-MeC levels increase after 3 (D3h, 10.4% positive cells) and 24 hours (D24h, 7.3% positive cells) in suspension, compared to nontreated control cells (CTRL) at the same time points (D3h, 84.6% positive cells; D24h, 95.9% positive cells). NAC was also able to exert a significant inhibitory effect over 5-MeC content elevation, at an earlier time point (D1h, 24.9% positive cells) than l-NAME and in 24 hours after anchorage blockade (D24h, 41.8% positive cells).

Other antioxidants, such as catalase (Sigma), DMSO (Sigma), and peroxidase (type II horseradish peroxidase, Sigma), were unable to exert the inhibitory effect over 5-MeC levels observed with l-NAME and NAC (Figure 3A, for DMSO; and data not shown, for catalase and peroxidase). Intriguingly, l-NAME-treated adherent cells (D0) showed a marked elevation in 5-MeC content, not detected after treatment with other compounds (NAC: Figure 3; DMSO, catalase, and peroxidase: data not shown). This observation is being further investigated in our laboratory, and may be related to Ras activation status [39].

The DNA methyltransferases implicated in establishing de novo methylation patterns are dnmt3a and 3b, whereas maintenance of DNA methylation pattern is performed by dnmt1 during DNA replication process. We analyzed protein expression by Western blot at different time points (D0, D1h, D3h, D5h, and D24h), and Figure 3B shows a marked increase in dnmt3b expression along anchorage blockade. A significant increase in dnmt1 expression was also observed after anchorage impediment (D5h), as shown in Figure 3D. Corroborating the hypothesis that oxidative stress regulates DNA methylation, l-NAME was capable of abolishing the increase both in dnmt1 and 3b expression, observed during anchorage blockade of melan-a cells (D3h and D24h, Figure 3C; D5h, Figure 3D). In addition, l-NAME-treated adherent cells (D0), which present higher levels of 5-MeC as shown above, also present a much higher expression of dnmt3b protein, but not dnmt1. Taken together, these data reinforce the proposition that oxidative stress regulates DNA methylation through DNA methyltransferase expression modifications.

l-NAME and NAC Do Not Inhibit NO Levels in Melan-a Melanocytes, But Totally Impair O2·- Production

Despite its known capacity of inhibiting NOS, l-NAME failed to reduce intracellular NO levels in nonadherent melan-a cells (Figure 4A), which, although unexpected, is in accordance with previous data showing that l-NAME was unable to inhibit NO production in different human melanoma cell lines [40], and with results indicating that l-NAME can be a source of nonenzymatically produced NO [41]. In addition, the NAC and catalase antioxidants did not modify NO levels in melan-a cells maintained in suspension (Figure 4A). Furthermore, l-NAME and NAC, but not catalase, were able to completely abrogate O2·- production in this condition (Figure 4B).

Discussion

Normal melanocytes depend on signals provided by both keratinocytes (in the epidermal melanin unit) and extracellular matrix to maintain their normal homeostasis, and their ectopic localization, as in dysplastic nevi and melanomas, is associated with morphologic and functional alterations [42,43].

Our group has recently established a melanocyte transformation model where several melanoma lineages were derived from immortalized, but nontumorigenic, melanocytes (melan-a cells) submitted to rounds of anchorage blockade followed by reattachment during normal culture conditions [21,22]. This model allows the identification of biochemical, genetic, and epigenetic alterations involved in homeostatic control loss and the carcinogenic process.

A significant increase in oxidative stress, as shown directly by elevated intracellular levels of O2·- (Figure 1) and indirectly by GSH (Figure 2A) and MDA concentrations (Figure 2C), is observed in melan-a cells submitted to anchorage blockade, beginning as soon as 1 hour. The increase in GSH levels could also indicate a response to oxidative stress [33,36] (Figure 5) because we observed a significant increase in GSH levels only 24 hours after adhesion blockade (Figure 2A), when H2O2 production returns to basal levels (data not shown). Increased ROS intracellular levels induced by anchorage blockade have been implicated as mediators of anoikis of human endothelial cells [44] and colorectal carcinoma cells [45]. However, elevated levels of O2·- have also been associated with protection from apoptotic death induced by cytotoxic agents or CD95 activation [46,47]. Nair et al. [48] showed that the decision to commit to programmed cell death during oxidative stress is, at least for neuronal murine cells, determined stochastically by each cell. This mutually exclusive decision involves either extracellular-regulated kinase or p53 activation pathways. It is probable that such life or death choice is also taken by melan-a cells maintained in forced deadherent culture conditions, and preliminary results from our laboratory demonstrate that p53 expression is increased in premalignant cell lines, but is lost in cell lines with full malignant phenotype (manuscript in preparation).

Figure 5.

Figure 5

O2·- production and its possible relation to methionine cycle. Lower levels of Hcy may result in lower levels of ADMA and higher NOS activity and/or expression. The concomitant local generation of NO and O2·- can result in peroxynitrite production, which, in turn, may lead to eNOS uncoupling and production of higher O2·- levels. Activated Ras, in the presence of high O2·- concentrations, may induce the dnmt's expression and, consequently, increase global DNA methylation. Met, methionine; SAM, S-adenosylmethionine; Cys, cysteine; GSH, glutathione; DDAH, dimethylarginine dimethylaminohydrolase; ADMA, asymmetric dimethylarginine; eNOS, endothelial NO synthase; CH3, methyl radical; NO, nitric oxide; O2·-, superoxide anion; dnmt, DNA methyltransferases. Adapted from Laurent et al. [47] and Nair et al. [48].

Oxidative stress is also commonly associated with relatively high levels of reactive nitrosative species and reactive oxygen nitrogen species [49]. NO is synthesized by a family of enzymes termed NOS. Two of them, the so-called endothelial (eNOS) and neuronal (nNOS) isoforms, are expressed constitutively and generate NO for cell signaling purposes. The inducible isoform releases NO in large amounts during inflammatory or immunologic reactions and is involved in host tissue damage responses. NO production (Figures 2B and 4A) and MDA levels (Figure 2C) are clearly amplified in deadherent melan-a cells (D1–D24h), compared to their adherent counterparts (D0). In addition, anchorage blockade induced eNOS expression by melan-a cells (Figure 2F), but not nNOS expression (data not shown).

Intracellular Hcy concentration was shown to fall drastically in melan-a submitted to anchorage blockade for 24 hours (Figure 2D). Interestingly, the concentration of Cys, a product of Hcy metabolism and a GSH precursor, did not change after anchorage blockade (Figure 2E). The observed low levels of intracellular Hcy suggest that both metabolic pathways in which it is involved (transsulfuration and remethylation) could be overly active. DNA molecules are one of the possible targets of methylation reactions [50] and elevated plasma levels of Hcy are associated with DNA hypomethylation [51]. Our results show that global DNA methylation, estimated by 5-MeC content, is clearly augmented in the first hours after melan-a detachment (Figure 3A; CTRL) when the Hcy level is significantly decreased (Figure 2D). The expression of both dnmt1 and 3b were also increased along melan-a anchorage blockade (Figure 3, B–D), providing a functional explanation for the observed rise in 5-MeC content.

Some groups have shown that both ROS and NO can affect DNA methylation status [15,52–54]. In our work, treatment of melan-a cells with l-NAME or NAC, but not with other antioxidants (DMSO, catalase, and peroxidase), resulted in inhibition of 5-MeC content (Figure 3A), as well as in dnmt1 and 3b expression increase (Figure 3C) along melan-a anchorage blockade. This effect does not seem to evolve NO production because both l-NAME and NAC were unable to inhibit NO synthesis (Figure 4A), but rather seems related to O2·- levels, whose production was abrogated by these inhibitors (Figure 4B). Absence of nitric oxide production inhibition by a fairly known NOS inhibitor l-NAME has already been described previously in melanoma cells [40], as well as in other cell types [41]. As an l-arginine analog, l-NAME itself seems to be a source of nonenzymatically produced NO [41], which could explain the observed maintenance of NO levels after l-NAME addition to culture media. Hydrogen peroxide scavenger antioxidants, such as DMSO (Figure 3A), catalase, and peroxidase (data not shown), did not alter either 5-MeC, dnmt1 and 3b expression or O2·- production. Conversely, NAC can specifically induce the expression [55] and the activity [56] of manganese superoxide dismutase (MnSOD), apart from its role as a precursor of GSH, which could explain its effects on reducing O2·- levels in melan-a cells submitted to anchorage blockade.

A very interesting feature of the NOS enzymes is that they not only generate NO but also produce O2·- themselves [57–59]. This phenomenon is referred to as the uncoupled state of NOS and has been associated with risk factors for some pathologies and considered as an abnormality of NOS function [60,61]. As mentioned above, eNOS expression was significantly induced during melan-a anchorage blockade (Figure 2F), as well as superoxide anion production (Figure 1). The exposure of eNOS to oxidants, including peroxynitrite, may cause increased enzymatic uncoupling and generation of superoxide anion [62] (Figure 5). Exogenous NOS inhibitor l-NAME can impair the transfer of electrons to molecular oxygen, inhibiting O2·- production [58], which could explain the abrogation of O2·- production in our model (Figure 5). In a similar way, asymmetric dimethylarginine (ADMA), an endogenous NOS inhibitor, can regulate the balance of NO and O2·- production from NOS. ADMA is indirectly stimulated by Hcy [63] (Figure 5) and elevated plasma levels of the latter are associated with DNA hypomethylation [51]. In this context, lower Hcy concentrations could be indirectly related to NOS uncoupling and increased O2·- production, which, in turn, might directly contribute to DNA methylation regulation through modulation of dnmt's expression (Figure 5).

In our model, Ras activation is strongly induced few hours after melan-a anchorage blockade (Machado, J. Jr., personal communication). Aberrant activation of this oncogene has been implicated in many aspects of the malignant phenotype, including uncontrolled proliferation and functional and morphologic alterations [64,65]. MacLeod et al. [66] showed that DNA methylation may be regulated by the Ras signaling pathway by activating the Jun transcription factor, which in turn transactivates the dnmt promoter by interacting with AP-1 sites. The expression of either dnmt1, 3a, or 3b has already been shown to be upregulated by activated Ras in different experimental conditions [67–69] (Figure 5). Interestingly, Sephashvili et al. [70] demonstrated that l-NAME increases the production of S-adenosylhomocysteine (SAH), leading to the reduction in SAM/SAH ratio and in methylation reactions, only in cells presenting mutated oncogenic RasH, possibly through enhancement of superoxides. Otherwise, these authors showed that l-NAME-treated wild-type Ras-expressing cells present increased SAM/SAH ratio, indicative of augmented methylation reactions. In our work, increased 5-MeC content and dnmt1 and 3b expression were abrogated by l-NAME during melan-a anchorage blockade, when Ras is activated, suggesting that this dnmt's upregulated expression may be related to Ras activation status. Curiously, l-NAME treatment of adherent melan-a cells, which present nonactivated Ras, leads to increases both in global DNA methylation and in dnmt3b, but not dnmt1 expression. This fact may be related to the experimental conditions, because dnmt1, and not dnmt3b expression, is cell cycle-dependent. In most studies, the expression of dnmts induced by Ras has been found to depend on the cell type and context [67]. The impact of Ras activation status and oxidative stress in DNA methylation is under intensive investigation in our laboratory.

Anchorage-independent growth (anoikis resistance) has traditionally been described as an acquired in vitro characteristic, which is well correlated with in vivo tumorigenic capacity [71,72] but the acquisition of this phenotype is not considered a causative event in carcinogenesis. Nevertheless, using basically the same deadhesion protocol used in our work, Rak et al. [73] obtained tumorigenic variants after enforced anchorage-independent growth of a nontumorigenic immortalized epithelial cell line. Using a similar approach, Zhu et al. [74] obtained a melanoma cell line with greater metastatic potential compared to the parental cell line. More interestingly, Seftor et al. [75] showed that adhesion of normal human melanocytes to a modified extracellular matrix could induce the expression of several genes associated with a malignant phenotype. This cancer-associated expression profile was reverted after several days in physiological adherent conditions, and the authors suggest that melanocyte phenotype is controlled by epigenetic mechanisms that include DNA methylation.

In our model of melanocyte transformation, cell-substrate adhesion blockade is the only induced modification in culture conditions, which resulted in full malignant transformed cell lines after several anchorage blockade cycles [22]. The first hours of this process, as described in this work, present a significant increase in oxidative/nitrosative stress, and this metabolic imbalance may have a causal role in modifications of DNA methylation status and dnmt1 and 3b expression, as shown by l-NAME and NAC inhibition assays. These results begin to unveil important clues about the initial events in the carcinogenic process related to microenvironmental changes.

Acknowledgements

We thank Elisa Mieko Suemitsu Higa and Margaret Gori Mouro for help with NO analyzer assays. We also thank Heraldo Possolo for his helpful advice.

Abbreviations

ADMA

asymmetric dimethylarginine

DAF-2DA

diaminofluorescein-2 diacetate

DHE

dihydroethidium

Dnmt

DNA methyltransferase

GSH

glutathione

Hcy

homocysteine

l-NAME

LG-nitro-l-arginine methyl esther

MTT

methyl thiazol tetrazolium

NAC

N-acetyl-l-cysteine

NO

nitric oxide

NOS

nitric oxide synthase

PCR

polymerase chain reaction

ROS

reactive oxygen species

SAM

S-adenosylmethionine

SAH

S-adenosylhomocysteine

Footnotes

1

This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP; grants 02/06935-7 and 06/61293-1 to M.G.J. and 97/0184-7 to V.A.) and by Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES; grant 33009015003P3 to M.G.J.).

References

  • 1.Frisch SM, Screaton RA. Anoikis mechanisms. Curr Opin Cell Biol. 2001;13:555–562. doi: 10.1016/s0955-0674(00)00251-9. [DOI] [PubMed] [Google Scholar]
  • 2.Grossmann J. Molecular mechanisms of “detachment-induced apoptosis—anoikis”. Apoptosis. 2002;7:247–260. doi: 10.1023/a:1015312119693. [DOI] [PubMed] [Google Scholar]
  • 3.Cheng TL, Symons M, Jou TS. Regulation of anoikis by Cdc42 and Rac1. Exp Cell Res. 2004;295:497–511. doi: 10.1016/j.yexcr.2004.02.002. [DOI] [PubMed] [Google Scholar]
  • 4.Kawanishi S, Hiraku Y, Oikawa S. Mechanism of guanine-specific DNA damage by oxidative stress and its role in carcinogenesis and aging. Mutat Res. 2001;488:65–76. doi: 10.1016/s1383-5742(00)00059-4. [DOI] [PubMed] [Google Scholar]
  • 5.Eu JP, Liu L, Zeng M, Stamler JS. An apoptotic model for nitrosative stress. Biochemistry. 2000;39:1040–1047. doi: 10.1021/bi992046e. [DOI] [PubMed] [Google Scholar]
  • 6.Cavelier G. Theory of malignant cell transformation by superoxide fate coupled with cytoskeletal electron-transport and electrontransfer. Med Hypotheses. 2000;54:95–98. doi: 10.1054/mehy.1998.0821. [DOI] [PubMed] [Google Scholar]
  • 7.Deng X, Gao F, May WS. Bcl2 retards G1/S cell cycle transition by regulating intracellular ROS. Blood. 2003;102:3179–3185. doi: 10.1182/blood-2003-04-1027. [DOI] [PubMed] [Google Scholar]
  • 8.Zimmerman R, Cerutti P. Active oxygen acts as a promoter of transformation in mouse embryo C3H/10T1/2/C18 fibroblasts. Proc Natl Acad Sci USA. 1984;81:2085–2087. doi: 10.1073/pnas.81.7.2085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Irani K, Xia Y, Zweier JL, Sollott SJ, Der CJ, Fearon ER, Sundaresan M, Finkel T, GoldschmidtClermont PJ. Mitogenic signaling mediated by oxidants in ras-transformed fibroblasts. Science. 1997;275:1649–1652. doi: 10.1126/science.275.5306.1649. [DOI] [PubMed] [Google Scholar]
  • 10.Behrend L, Henderson G, Zwacka RM. Reactive oxygen species in oncogenic transformation. Biochem Soc Trans. 2003;31:1441–1444. doi: 10.1042/bst0311441. [DOI] [PubMed] [Google Scholar]
  • 11.Brune B, von Knethen A, Sandau KB. Nitric oxide (NO): an effector of apoptosis. Cell Death Differ. 1999;6:969–975. doi: 10.1038/sj.cdd.4400582. [DOI] [PubMed] [Google Scholar]
  • 12.Ischiropoulos H, Beckman JS. Oxidative stress and nitration in neurodegeneration: cause, effect, or association? J Clin Invest. 2003;111:163–169. doi: 10.1172/JCI17638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Creppy EE, Traore A, Baudrimont I, Cascante M, Carratu MR. Recent advances in the study of epigenetic effects induced by the phycotoxin okadaic acid. Toxicology. 2002;181–182:433–439. doi: 10.1016/s0300-483x(02)00489-4. [DOI] [PubMed] [Google Scholar]
  • 14.Marnett LJ, Riggins JN, West JD. Endogenous generation of reactive oxidants and electrophiles and their reactions with DNA and protein. J Clin Invest. 2003;111:583–593. doi: 10.1172/JCI18022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Valinluck V, Tsai H, Rogstad DK, Burdzy A, Bird A, Sowers LC. Oxidative damage to methyl-CpG sequences inhibits the binding of the methyl-CpG binding domain (MBD) of methyl-CpG binding protein 2 (MeCP2) Nucleic Acids Res. 2004;32:4100–4108. doi: 10.1093/nar/gkh739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Gowher H, Liebert K, Hermann A, Xu G, Jeltsch A. Mechanism of stimulation of catalytic activity of Dnmt3A and Dnmt3B DNA- (cytosine-C5)-methyltransferases by Dnmt3L. J Biol Chem. 2005;280:13341–13348. doi: 10.1074/jbc.M413412200. [DOI] [PubMed] [Google Scholar]
  • 17.Suetake I, Shinozaki F, Miyagawa J, Takeshima H, Tajima S. DNMT3L stimulates the DNA methylation activity of Dnmt3a and Dnmt3b through a direct interaction. J Biol Chem. 2004;279:27816–27823. doi: 10.1074/jbc.M400181200. [DOI] [PubMed] [Google Scholar]
  • 18.Jones PA, Baylin SB. The fundamental role of epigenetic events in cancer. Nat Rev Genet. 2002;3:415–428. doi: 10.1038/nrg816. [DOI] [PubMed] [Google Scholar]
  • 19.Feinberg AP, Ohlsson R, Henikoff S. The epigenetic progenitor origin of human cancer. Nat Rev Genet. 2006;7:21–33. doi: 10.1038/nrg1748. [DOI] [PubMed] [Google Scholar]
  • 20.Wang Y, Yu Q, Cho AH, Rondeau G, Welsh J, Adamson E, Mercola D, McClelland M. Survey of differentially methylated promoters in prostate cancer cell lines. Neoplasia. 2005;7:748–760. doi: 10.1593/neo.05289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Correa M, Machado J, Jr, Carneiro CR, Pesquero JB, Bader M, Travassos LR, Chammas R, Jasiulionis MG. Transient inflammatory response induced by apoptotic cells is an important mediator of melanoma cell engraftment and growth. Int J Cancer. 2005;114:356–363. doi: 10.1002/ijc.20673. [DOI] [PubMed] [Google Scholar]
  • 22.Oba-Shinjo SM, Correa M, Ricca TI, Molognoni F, Pinhal MA, Neves IA, Marie SK, Sampaio LO, Nader HB, Chammas R, et al. Melanocyte transformation associated with substrate adhesion impediment. Neoplasia. 2006;8:231–241. doi: 10.1593/neo.05781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bennett DC, Cooper PJ, Hart IR. A line of non-tumorigenic mouse melanocytes, syngeneic with the B16 melanoma and requiring a tumour promoter for growth. Int J Cancer. 1987;39:414–418. doi: 10.1002/ijc.2910390324. [DOI] [PubMed] [Google Scholar]
  • 24.Zhao H, Kalivendi S, Zhang H, Joseph J, Nithipatikom K, Vasquez-Vivar B, Kalyanaraman B. Superoxide reacts with hydroethidine but forms a fluorescent product that is distinctly different from ethidium: potential implications in intracellular fluorescence detection of superoxide. Free Radic Biol Med. 2003;34:1359–1368. doi: 10.1016/s0891-5849(03)00142-4. [DOI] [PubMed] [Google Scholar]
  • 25.Tietze F. Enzymic method for quantitative determination of nanogram amounts of total and oxidized glutathione: applications to mammalian blood and other tissues. Anal Biochem. 1969;27:502–522. doi: 10.1016/0003-2697(69)90064-5. [DOI] [PubMed] [Google Scholar]
  • 26.Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265–275. [PubMed] [Google Scholar]
  • 27.Kojima H, Nakatsubo N, Kikuchi K, Urano Y, Higuchi T, Tanaka J, Kudo Y, Nagano T. Direct evidence of NO production in rat hippocampus and cortex using a new fluorescent indicator: DAF-2 DA. Neuroreport. 1998;9:3345–3348. doi: 10.1097/00001756-199810260-00001. [DOI] [PubMed] [Google Scholar]
  • 28.Hampl V, Waters CL, Archer SL. Determination of nitric oxide by the chemiluminescence reaction with ozone. In: Feelisch M, Stamler JS, editors. Methods in Nitric Oxide Research. Chichester: John Wiley & Sons; 1996. pp. 309–318. [Google Scholar]
  • 29.Ohkawa H, Ohishi N, Yagi K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem. 1979;95:351–358. doi: 10.1016/0003-2697(79)90738-3. [DOI] [PubMed] [Google Scholar]
  • 30.Pfeiffer CM, Huff DL, Gunter EW. Rapid and accurate HPLC assay for plasma total homocysteine and cysteine in a clinical laboratory setting. Clin Chem. 1999;45:290–292. [PubMed] [Google Scholar]
  • 31.Milutinovic S, Zhuang Q, Niveleau A, Szyf M. Epigenomic stress response. Knockdown of DNA methyltransferase 1 triggers an intra -S-phase arrest of DNA replication and induction of stress response genes. J Biol Chem. 2003;278:14985–14995. doi: 10.1074/jbc.M213219200. [DOI] [PubMed] [Google Scholar]
  • 32.Meyskens FL, Jr, McNulty SE, Buckmeier JA, Tohidian NB, Spillane TJ, Kahlon RS, Gonzalez RI. Aberrant redox regulation in human metastatic melanoma cells compared to normal melanocytes. Free Radic Biol Med. 2001;31:799–808. doi: 10.1016/s0891-5849(01)00650-5. [DOI] [PubMed] [Google Scholar]
  • 33.Tchantchou F, Graves M, Ashline D, Morin A, Pimenta A, Ortiz D, Rogers E, Shea TB. Increased transcription and activity of glutathione synthase in response to deficiencies in folate, vitamin E, and apolipoprotein E. J Neurosci Res. 2004;75:508–515. doi: 10.1002/jnr.10867. [DOI] [PubMed] [Google Scholar]
  • 34.Zorov DB, Bannikova SY, Belousov VV, Vyssokikh MY, Zorova LD, Isaev NK, Krasnikov BF, Plotnikov EY. Reactive oxygen and nitrogen species: friends or foes? Biochemistry (Mosc) 2005;70:215–221. doi: 10.1007/s10541-005-0103-6. [DOI] [PubMed] [Google Scholar]
  • 35.Warner DS, Sheng H, Batinic-Haberle I. Oxidants, antioxidants and the ischemic brain. J Exp Biol. 2004;207:3221–3231. doi: 10.1242/jeb.01022. [DOI] [PubMed] [Google Scholar]
  • 36.Mosharov E, Cranford MR, Banerjee R. The quantitatively important relationship between homocysteine metabolism and glutathione synthesis by the transsulfuration pathway and its regulation by redox changes. Biochemistry. 2000;39:13005–13011. doi: 10.1021/bi001088w. [DOI] [PubMed] [Google Scholar]
  • 37.Dimitrova KR, DeGroot K, Myers AK, Kim YD. Estrogen and homocysteine. Cardiovasc Res. 2002;53:577–588. doi: 10.1016/s0008-6363(01)00462-x. [DOI] [PubMed] [Google Scholar]
  • 38.Caudill MA, Wang JC, Melnyk S, Pogribny IP, Jernigan S, Collins MD, Santos-Guzman J, Swendseid ME, Cogger EA, James SJ. Intracellular S-adenosylhomocysteine concentrations predict global DNA hypomethylation in tissues of methyl-deficient cystathionine β-synthase heterozygous mice. J Nutr. 2001;131:2811–2818. doi: 10.1093/jn/131.11.2811. [DOI] [PubMed] [Google Scholar]
  • 39.Irani K, Xia Y, Zweier JL, Sollott SJ, Der CJ, Fearon ER, Sundaresan M, Finkel T, GoldschmidtClermont PJ. Mitogenic signaling mediated by oxidants in ras-transformed fibroblasts. Science. 1997;275:1649–1652. doi: 10.1126/science.275.5306.1649. [DOI] [PubMed] [Google Scholar]
  • 40.Salvucci O, Carsana M, Bersani H, Tragni G, Anichini A. Antiapoptotic role of endogenous nitric oxide in human melanoma cells. Cancer Res. 2001;61:318–326. [PubMed] [Google Scholar]
  • 41.Moroz LL, Norby SW, Cruz L, Sweedler JV, Gillete R, Clarkson RB. Non-enzymatic production of nitric oxide (NO) from NO synthase inhibitors. Biochem Biophys Res Commun. 1998;253:571–576. doi: 10.1006/bbrc.1998.9810. [DOI] [PubMed] [Google Scholar]
  • 42.Kincannon J, Boutzale C. The physiology of pigmented nevi. Pediatrics. 1999;104:1042–1045. [PubMed] [Google Scholar]
  • 43.Postovit LM, Seftor EA, Seftor RE, Hendrix MJ. Influence of the microenvironment on melanoma cell fate determination and phenotype. Cancer Res. 2006;66:7833–7836. doi: 10.1158/0008-5472.CAN-06-0731. [DOI] [PubMed] [Google Scholar]
  • 44.Li N, Oberley TD, Oberley LW, Zhong W. Inhibition of cell growth in NIH/3T3 fibroblasts by overexpression of manganese superoxide dismutase: mechanistic studies. J Cell Physiol. 1998;175:359–369. doi: 10.1002/(SICI)1097-4652(199806)175:3<359::AID-JCP14>3.0.CO;2-0. [DOI] [PubMed] [Google Scholar]
  • 45.Laguinge LM, Lin S, Samara RN, Salesiotis AN, Jessup JM. Nitrosative stress in rotated three-dimensional colorectal carcinoma cell cultures induces microtubule depolymerization and apoptosis. Cancer Res. 2004;64:2643–2648. doi: 10.1158/0008-5472.can-03-3663. [DOI] [PubMed] [Google Scholar]
  • 46.Pervaiz S, Cao J, Chao OS, Chin YY, Clement MV. Activation of the RacGTPase inhibits apoptosis in human tumor cells. Oncogene. 2001;20:6263–6268. doi: 10.1038/sj.onc.1204840. [DOI] [PubMed] [Google Scholar]
  • 47.Laurent A, Nicco C, Chereau C, Goulvestre C, Alexandre J, Alves A, Levy E, Goldwasser F, Panis Y, Soubrane O, et al. Controlling tumor growth by modulating endogenous production of reactive oxygen species. Cancer Res. 2005;65:948–956. [PubMed] [Google Scholar]
  • 48.Nair VD, Yuen T, Olanow CW, Sealfon SC. Early single cell bifurcation of pro- and antiapoptotic states during oxidative stress. J Biol Chem. 2004;279:27494–27501. doi: 10.1074/jbc.M312135200. [DOI] [PubMed] [Google Scholar]
  • 49.Haddad JJ. Redox and oxidant-mediated regulation of apoptosis signaling pathways: immuno-pharmaco-redox conception of oxidative siege versus cell death commitment. Int Immunopharmacol. 2004;4:475–493. doi: 10.1016/j.intimp.2004.02.002. [DOI] [PubMed] [Google Scholar]
  • 50.Ulrey CL, Liu L, Andrews LG, Tollefsbol TO. The impact of metabolism on DNA methylation. Hum Mol Genet. 2005;14 Spec No 1:R139–R147. doi: 10.1093/hmg/ddi100. [DOI] [PubMed] [Google Scholar]
  • 51.Yi P, Melnyk S, Pogribna M, Pogribny IP, Hine RJ, James SJ. Increase in plasma homocysteine associated with parallel increases in plasma S-adenosylhomocysteine and lymphocyte DNA hypomethylation. J Biol Chem. 2000;275:29318–29323. doi: 10.1074/jbc.M002725200. [DOI] [PubMed] [Google Scholar]
  • 52.Weitzman SA, Turk PW, Milkowski DH, Kozlowski K. Free radical adducts induce alterations in DNA cytosine methylation. Proc Natl Acad Sci USA. 1994;91:1261–1264. doi: 10.1073/pnas.91.4.1261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Cerda S, Weitzman SA. Influence of oxygen radical injury on DNA methylation. Mutat Res. 1997;386:141–152. doi: 10.1016/s1383-5742(96)00050-6. [DOI] [PubMed] [Google Scholar]
  • 54.Hmadcha A, Bedoya FJ, Sobrino F, Pintado E. Methylationdependent gene silencing induced by interleukin 1β via nitric oxide production. J Exp Med. 1999;190:1595–1604. doi: 10.1084/jem.190.11.1595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Nagata K, Iwasaki Y, Yamada T, Yuba T, Kono K, Hosogi S, Ohsugi S, Kuwahara H, Marunaka Y. Overexpression of manganese superoxide dismutase by N-acetylcysteine in hyperoxic lung injury. Respir Med. 2007;101:800–807. doi: 10.1016/j.rmed.2006.07.017. [DOI] [PubMed] [Google Scholar]
  • 56.Xia Z, Guo Z, Nagareddy PR, Yuen V, Yeung E, McNeill JH. Antioxidant N-acetylcysteine restores myocardial Mn-SOD activity and attenuates myocardial dysfunction in diabetic rats. Eur J Pharmacol. 2006;544:125. doi: 10.1016/j.ejphar.2006.06.033. [DOI] [PubMed] [Google Scholar]
  • 57.Rabelink TJ, Luscher TF. Endothelial nitric oxide synthase. Host defense enzyme of the endothelium? Arterioscler Thromb Vasc Biol. 2006;26:267–271. doi: 10.1161/01.ATV.0000196554.85799.77. [DOI] [PubMed] [Google Scholar]
  • 58.Cardounel AJ, Xia Y, Zweier JL. Endogenous methylarginines modulate superoxide as well as nitric oxide generation from neuronal nitric-oxide synthase. J Biol Chem. 2005;280:7540–7549. doi: 10.1074/jbc.M410241200. [DOI] [PubMed] [Google Scholar]
  • 59.Pou S, Keaton L, Surichamorn W, Rosen GM. Mechanism of superoxide generation by neuronal nitric-oxide synthase. J Biol Chem. 1999;274:9573–9580. doi: 10.1074/jbc.274.14.9573. [DOI] [PubMed] [Google Scholar]
  • 60.Meininger CJ, Cai S, Parker JL, Channon KM, Kelly KA, Becker EJ, Wood MK, Wade LA, Wu G. GTP cyclohydrolase I gene transfer reverses tetrahydrobiopterin deficiency and increases nitric oxide synthesis in endothelial cells and isolated vessels from diabetic rats. FASEB J. 2004;18:1900–1902. doi: 10.1096/fj.04-1702fje. [DOI] [PubMed] [Google Scholar]
  • 61.Stroes E, Kastelein J, Cosentino F, Erkelens W, Wever R, Koomans H, Luscher TF, Rabelink TJ. Tetrahydrobiopterin restores endothelial function in hypercholesterolemia. J Clin Invest. 1997;99:41–46. doi: 10.1172/JCI119131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Zou MH, Shi C, Cohen RA. Oxidation of the zinc-thiolate complex and uncoupling of endothelial nitric synthase by peroxynitrite. J Clin Invest. 2002;109:817–826. doi: 10.1172/JCI14442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Stuhlinger MC, Tsao PS, Her JH, Kimoto M, Balint RF, Cooke JP. Homocysteine impairs the nitric oxide synthase pathway: role of asymmetric dimethylarginine. Circulation. 2001;104:2569–2575. doi: 10.1161/hc4601.098514. [DOI] [PubMed] [Google Scholar]
  • 64.Barbacid M. Ras genes. Annu Rev Biochem. 1987;56:779–827. doi: 10.1146/annurev.bi.56.070187.004023. [DOI] [PubMed] [Google Scholar]
  • 65.Derouet M, Xou X, May L, Hoon Yoo B, Sasazuki T, Shirasawa S, Rak J, Rosen KV. Acquisition of anoikis resistance promotes the emergence of oncogenic K-ras mutations in colorectal cancer cells and stimulates their tumorigenicity in vivo. Neoplasia. 2007;9:536–545. doi: 10.1593/neo.07217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.MacLeod R, Rouleau J, Szyf M. Regulation of DNA methylation by the Ras signaling pathway. J Biol Chem. 1995;270:11327–11337. doi: 10.1074/jbc.270.19.11327. [DOI] [PubMed] [Google Scholar]
  • 67.Chang H, Cho C, Hung W. Silencing of the metastasis suppressor RECK by RAS oncogene is mediated by DNA methyltransferase 3b-induced promoter methylation. Cancer Res. 2006;66:8413–8420. doi: 10.1158/0008-5472.CAN-06-0685. [DOI] [PubMed] [Google Scholar]
  • 68.Soejima K, Fang W, Rollins BJ. DNA methyltransferase 3b contributes to oncogenic transformation induced by SV40T antigen and activated Ras. Oncogene. 2003;22:4723–4733. doi: 10.1038/sj.onc.1206510. [DOI] [PubMed] [Google Scholar]
  • 69.Pruitt K, Ulku AS, Frantz K, Rojas RJ, Muniz-Medina VM, Rangnekar VM, Der CJ, Shields JM. Ras-mediated loss of the proapoptotic response protein Par-4 is mediated by DNA hypermethylation through Raf-independent and Raf-dependent signaling cascades in epithelial cells. J Biol Chem. 2005;280:23363–23370. doi: 10.1074/jbc.M503083200. [DOI] [PubMed] [Google Scholar]
  • 70.Sephashvili M, Zhuravliova E, Barbakadze T, Khundadze M, Narmania N, Mikeladze DG. l-NAME has opposite effects on the productions of S-adenosylhomocysteine and S-adenosylmethionine in V12-H-Ras and M-CR3B-Ras pheochromocytoma cells. Neurochem Res. 2006;31:1205–1210. doi: 10.1007/s11064-006-9148-1. [DOI] [PubMed] [Google Scholar]
  • 71.Baserga R. The price of independence. Exp Cell Res. 1997;236:1–3. doi: 10.1006/excr.1997.3732. [DOI] [PubMed] [Google Scholar]
  • 72.Song J, Xie H, Lian J, Yang G, Du R, Du Y, Zou X, Jin H, Gao J, Liu J, et al. Enhanced cell survival of gastric cancer cells by a novel gene URG4. Neoplasia. 2006;8:995–1002. doi: 10.1593/neo.06592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Rak J, Mitsuhashi Y, Sheehan C, Krestow J, Florenes V, Filmus J, Kerbel R. Collateral expression of proangiogenic and tumorigenic properties in intestinal epithelial cell variants selected for resistance to anoikis. Neoplasia. 1999;1:23–30. doi: 10.1038/sj.neo.7900001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Zhu Z, Sanchez-Sweatman O, Huang X, Wiltrout R, Khokha R, Zhao Q, Gorelik E. Anoikis and metastatic potential of cloudman S91 melanoma cells. Cancer Res. 2001;61:1707–1716. [PubMed] [Google Scholar]
  • 75.Seftor EA, Brown KM, Chin L, Kirschmann DA, Wheaton WW, Protopopov A, Feng B, Balagurunathan Y, Trent JM, Nickoloff BJ, et al. Epigenetic transdifferentiation of normal melanocytes by a metastatic melanoma microenvironment. Cancer Res. 2005;65:10164–10169. doi: 10.1158/0008-5472.CAN-05-2497. [DOI] [PubMed] [Google Scholar]

Articles from Neoplasia (New York, N.Y.) are provided here courtesy of Neoplasia Press

RESOURCES