Skip to main content
NCBI home page
Genetics logoLink to Genetics
. 2007 Nov;177(3):1691–1702. doi: 10.1534/genetics.107.079517

Expression of the Drosophila melanogaster GADD45 Homolog (CG11086) Affects Egg Asymmetric Development That Is Mediated by the c-Jun N-Terminal Kinase Pathway

Gabriella Peretz 1, Anna Bakhrat 1, Uri Abdu 1,1
PMCID: PMC2147983  PMID: 18039880

Abstract

The mammalian GADD45 (growth arrest and DNA-damage inducible) gene family is composed of three highly homologous small, acidic, nuclear proteins: GADD45α, GADD45β, and GADD45γ. GADD45 proteins are involved in important processes such as regulation of DNA repair, cell cycle control, and apoptosis. Annotation of the Drosophila melanogaster genome revealed that it contains a single GADD45-like protein (CG11086; D-GADD45). We found that, as its mammalian homologs, D-GADD45 is a nuclear protein; however, D-GADD45 expression is not elevated following exposure to genotoxic and nongenotoxic agents in Schneider cells and in adult flies. We showed that the D-GADD45 transcript increased following immune response activation, consistent with previous microarray findings. Since upregulation of GADD45 proteins has been characterized as an important cellular response to genotoxic and nongenotoxic agents, we aimed to characterize the effect of D-GADD45 overexpression on D. melanogaster development. Overexpression of D-GADD45 in various tissues led to different phenotypic responses. Specifically, in the somatic follicle cells overexpression caused apoptosis, while overexpression in the germline affected the dorsal–ventral polarity of the eggshell and disrupted the localization of anterior–posterior polarity determinants. In this article we focused on the role of D-GADD45 overexpression in the germline and found that D-GADD45 caused dorsalization of the eggshell. Since mammalian GADD45 proteins are activators of the c-Jun N-terminal kinase (JNK)/p38 mitogen-activated protein kinase (MAPK) signaling pathways, we tested for a genetic interaction in D. melanogaster. We found that eggshell polarity defects caused by D-GADD45 overexpression were dominantly suppressed by mutations in the JNK pathway, suggesting that the JNK pathway has a novel, D-GADD45-mediated, function in the Drosophila germline.

THE GADD45 (growth arrest and DNA-damage inducible) gene family plays an important role in regulation of DNA repair, cell cycle control, and apoptosis, although its involvement in development is largely unknown. The GADD45 gene family is composed of three highly homologous (55–58% overall identity at the amino acid level), small, acidic, nuclear proteins: GADD45α (Fornace et al. 1989), GADD45β (MyD118, Abdollahi et al. 1991), and GADD45γ (CR6, cytokine response gene 6) (Beadling et al. 1993). In recent years, evidence has emerged that the proteins encoded by these genes play similar but not identical roles in terminal differentiation and negative growth control, including growth suppression and apoptotic cell death (Azam et al. 2001; Zhang et al. 2001; Vairapandi et al. 2002).

One of the well-described responses to genotoxic and nongenotoxic stresses is the rapid upregulation of different GADD45 proteins, which in turn affect cell-cycle regulation, cell survival, and cell death (Fornace et al. 1988, 1989; Kastan et al. 1992). It has been shown that all the GADD45 proteins mediate cell-cycle regulation through interactions with PCNA (Kelman and Hurwitz 1998; Azam et al. 2001), the cyclin-dependent kinase inhibitor p21 (Kearsey et al. 1995), and the Cdk/cyclin B complex (Zhan et al. 1999; Jin et al. 2002; Vairapandi et al. 2002). The potential role of GADD45 proteins in apoptosis emanates from the observation that GADD45 expression is enhanced during apoptosis following induction by a variety of genotoxic agents (reviewed in Sheikh et al. 2000). Several studies have shown that GADD45 proteins may play a role in apoptosis via activation of the c-Jun N-terminal kinase (JNK) and/or p38 mitogen-activated protein kinase (MAPK) signaling pathways (Takekawa and Saito 1998; Harkin et al. 1999). GADD45 proteins physically interact with the MAPKKK, MTK1 (synonym MEKK4), and the ensuing interactions result in the activation of MTK1. Activated MTK1 is thought to further activate its downstream targets JNK and p38 (Takekawa and Saito 1998). It was shown that the N-terminal of MTK1 auto-inactivates its kinase activity and binding of GADD45 proteins to MTK1 relieves this inhibition (Mita et al. 2002, Miyake et al. 2007). It was proposed that in response to genotoxic stress, p53 is activated, which causes transcriptional upregulation of GADD45α, and GADD45α interacts with MTK1 to initiate the JNK/p38-mediated apoptotic pathway.

Several model systems have been used to analyze the role of GADD45 proteins during development. GADD45α-null mice exhibit several phenotypes including genomic instability, increased radiation carcinogenesis, and a low frequency of exencephaly (Hollander et al. 1999). GADD45γ-deficient mice develop normally and are indistinguishable from their littermates, possibly due to functional redundancy among the GADD45 family members (Hoffmeyer et al. 2001). In the fish, Oryzias latipes, ectopic expression of GADD45γ leads to cell cycle arrest without inducing apoptosis. Loss of function of GADD45γ causes a significant increase in apoptosis, suggesting that GADD45γ is an important component of the molecular pathway that coordinates cell cycle vs. apoptosis decisions during vertebrate development (Candal et al. 2004). The zebrafish GADD45β genes were found to be periodically expressed as paired stripes in the anterior presomitic mesoderm. Both knockdown and overexpression of GADD45β genes caused somite defects with different consequences for marker gene expression, indicating that the regulated expression of GADD45β genes is required for somite segmentation (Kawahara et al. 2005). The possible functional redundancy among the GADD45 proteins in these model systems makes the analysis of the molecular function of GADD45 difficult. Annotation of the Drosophila melanogaster genome revealed that it contains only one GADD45-like protein (CG11086, D-GADD45).

Since upregulation of GADD45 proteins may affect cell cycle regulation, cell survival, and cell death, we aimed to study the effect of D-GADD45 overexpression on D. melanogaster oogenesis. We found that overexpression of D-GADD45 in the somatic follicle cells led to apoptosis of the entire egg chamber. On the other hand, overexpression of D-GADD45 in the germline did not cause apoptosis but affected the dorsal–ventral polarity of the eggshell. Moreover, D-GADD45 also affected anterior–posterior polarity determinants. However, anterior oocyte nuclear migration and bcd localization were unaffected. Finally, we found that mutations in the MAPK–JNK pathway dominantly suppressed the egg asymmetric defects in D-GADD45 overexpression ovaries, suggesting a novel, D-GADD45-mediated function for the JNK pathway in the germline.

MATERIALS AND METHODS

Drosophila strains:

Oregon-R was used as wild-type control. The following transgenic and mutant flies were used: CY2-Gal4 (Queenan et al. 1997); GR1-Gal4 (kindly provided by T. Schüpbach), nanos-Gal4-VP16 (Van Doren et al. 1998); Act5C-GAL4, 32B-Gal4, GMR-GAL4, Tub-Gal4, hepG0208 and hepr75 (Bloomington Stock Center), kinesin β-GAL insertion line KZ503 and the Nod-β GAL insertion line NZ143.2 (Clark et al. 1994, 1997), P[w+ lac-Z]BB142) (Schüpbach and Roth 1994), and licH6 (Suzanne et al. 1999, kindly provided by S. Noselli). Flies were cultured in standard cornmeal/agar medium at 25°. The balancer chromosomes used in this study, as well as marker mutations have been described in (Lindsley and Zimm 1992) and in FlyBase (http://flybase.bio.indiana.edu).

Transgenic flies:

To make the pUASp-GADD45 construct the entire coding sequence of D-GADD45 (CG11086) was amplified from an EST template (RH70774) by PCR using modified primers to create a KpnI restriction site at the 5′ end (GGTACCATGGTCGTCGAGGAGAACTGC) and a NotI site at the 3′ end (GCGGCCGCCTACACAGCCGGCAGC). The resulting PCR product was cut using KpnI and NotI and was cloned into pUASp. P-element-mediated germline transformation of this construct was carried out according to standard protocols (Spradling 1986). Five independent UAS-D-GADD45 lines were established.

Preparation of the eggshell for dark-field microscopy:

Freshly laid eggs were collected on apple juice plates and placed in a drop of Hoyer's mount (Nusslein-Volhard and Wieschaus 1980). After an overnight incubation at 65° the slides were examined by dark-field microscopy.

β-Galactosidase staining:

Ovaries were dissected in PBS transferred to glutaraldehyde fixative and rocked for 8 min, followed by washes (3 × 10 min) in PBST (PBS with 1% Triton X-100). The ovaries were then placed in staining buffer [0.05 m K3(Fe(CN)6), 0.05 m K4(Fe(CN)6) in PBS] with X-gal stock solution (10% in N,N-dimethylformamide) added to a final concentration of 1% and stained in the dark, overnight at 37°. The next day the ovaries were washed (3 × 10 min) in PBST and mounted on slides in 50% glycerol.

In situ hybridization and antibody staining:

RNA in situ hybridization on ovaries was performed using digoxigenin-labeled probes (Roche, Indianapolis) according to standard protocols (Roth and Schüpbach 1994). Antibody staining of ovaries was carried out as described (Queenan et al. 1999), using mouse anti-Grk ID12 1:10, rabbit anti-Oskar 1:3000 (kindly provided by P. MacDonald), mouse anti-α-tubulin 1:200 (Sigma, St. Louis), rabbit anti β-Gal 1:200 (Promega), mouse anti-BR-C 1:100 (Hybridoma Bank, University of Iowa), mouse anti-Lamin 1:50 (Hybridoma Bank, University of Iowa). Secondary antibodies used were goat α-rabbit 1:500 (Molecular Probes, Eugene, OR) and Cy3 goat α-mouse 1:100 (Jackson ImmunoResearch, West Grove, PA). Oregon green 488 and Alexa Fluor 546 phalloidin (Molecular Probes) were used at 1:500 and Hoechst was used at 1 μg/ml (Molecular Probes). Egg chambers were photographed on a Zeiss LSM510 Laser-scanning confocal microscope.

Scanning electron microscopy:

To prepare scanning electron microscopy (SEM) samples, fly heads were dehydrated through an ethanol series (25, 50, 75, and twice with 100%) for 10 min each followed by a hexamethyldisilazane (HMDS, Electron Microscopy Sciences) series (50, 75, and twice with 100%) for 2 hr each. Flies were air dried overnight under the hood, sputter coated with gold, mounted onto SEM stubs, and analyzed with a JSM-5610LV scanning electron microscope.

Yeast culture:

The entire coding sequence of CG11086 was amplified by PCR using modified primers to create a SpeI restriction site at the 5′ end (ACTAGTATGGTCGTCGAGGAGAACTGC) and a SacI site at the 3′ end (GAGCTCCTACACAGCCGGCAGCTGG). The resulting PCR product was cut using SpeI and SacI and was cloned as a GFP fusion in the pHY315–GFP yeast expression vector (kindly provided by S. Elledge). Transfection to yeast was carried out as described elsewhere (Adams et al. 1997). For DNA staining cells were incubated with DAPI at 1 μg/ml (Molecular Probes) for 30 min.

Cell culture:

Drosophila Schneider 2 (S2) and S2R+ cells were grown in Schneider cell medium (Biological Industries, Beer-Sheva, Israel) supplemented with 10% fetal calf serum and penicillin–streptomycin–amphotericin (Biological Industries). Cells were cultured at 25°. For transfection, four million cells were plated in 1 ml Schneider medium. Cells were transfected with 1 μg plasmid DNA using the ESCORT IV transfection reagent (Sigma) according to the manufacturer's protocol.

To make the UAS–GFP–GADD45 construct for the localization experiment the entire coding sequence of EGFP (Invitrogen) was amplified by PCR using modified primers to create a KpnI restriction site at the 5′ end (GGTACCATGGTGAGCAAGGGCGAGGAGC) and an XbaI site at the 3′ end (TCTAGACTTGTACAGCTCGTCCATGCCG). The resulting PCR product was cloned into pBluescript. D-GADD45 (CG11086) was amplified by PCR using modified primers to create an XbaI restriction site at the 5′ end (TCTAGAATGGTCGTCGAGGAGAACTGC) and a NotI site at the 3′ end (GCGGCCGCCTACACAGCCGGCAGC). The resulting PCR product was cloned into pBluescript-GFP. The sequence composed of D-GADD45 and GFP was cut using KpnI and NotI and cloned into pUASp as a GFP fusion. For immunostaining, S2 cells were fixed with 4% formaldehyde for 15 min. After permeabilization with 0.2% Triton-X100, cells were incubated with mouse anti Lamin antibody 1:10 (Hybridoma Bank, University of Iowa) in 0.2% FSG. Cy3 goat α-mouse 1:1000 (Jackson ImmunoResearch) was used for detection. Cells were photographed on a Zeiss LSM510 Laser-scanning confocal microscope.

Stress experiments:

To study the effect of stress on D-GADD45 transcription, different treatments were applied to S2 cells and Drosophila flies. For toxic metal stress S2 cells were left untreated or received 200 μm NaAsO2 (Sigma–Aldrich) and were harvested 2 hr later. For UV radiation, S2 cells were irradiated with UVC to a dose of 300 Jm−2 and were harvested 2 hr later. For paraquat treatment, Drosophila wild-type adult males, aged 3–4 days were starved for 2 hr and then transferred to vials containing only filter paper soaked with 20 mm paraquat in 5% sucrose solution. Control vials contained only 5% sucrose solution. RNA was extracted from flies 24 hr later. For X-ray treatment, Drosophila wild-type adult males aged 3–4 days were treated with 2500 rads in the Faxitron RX650 (Faxitron X-Ray, Wheeling, IL). RNA was extracted form flies 2 hr later. Each assay was repeated twice more.

Infection experiments:

For septic injury experiments, we used Drosophila wild-type adult males, aged 3–4 days at 25°. Septic injury was performed by pricking the thorax of the flies with a needle previously dipped into a concentrated bacterial culture of the gram-negative strain Escherichia coli and gram-positive strains Micrococcus luteus and Enterococcus faecalis (kindly provided by B. Lemaitre). Then flies were incubated at 25° and collected 2 hr after infection.

Real-time RT–PCR:

Total RNA was extracted from flies and S2 cells using the NucleoSpin RNA II kit, including DNase treatment, according to the manufacturer's instructions (Macherey-Nagel). cDNA was transcribed in 1–3 μg of total RNA using reverse transcriptase and oligo(dT) (ABgene) in a 20-μl reaction according to the manufacturer's instructions (Bio-Lab, Jerusalem). Real-time PCR was performed using the Mx3000p (Stratagene, La Jolla, CA). Reverse-transcribed total RNA (200 ng) was amplified in a 20-μl reaction containing 200 nm of each primer and 10 μl of SYBR Green PCR Master Mix (Stratagene).

Forward and reverse primer sequences were as follows: Rp49 Fwd, CCGCTTCAAGGGACAGTATCTG; Rp49 Rev, CACGTTGTGCACCAGGAACTT; GADD45 Rev, CGTAGATGTCGTTCTCGTAGC; GADD45 Fwd, CATCAACGTGCTCTCCAAGTC; Drosomycin Fwd, TCAAGTACTTGTTCGCCCTC; and Drosomycin Rev, ATCCTTCGCACCAGCACTTC.

The amount of gene product in each sample was determined by the comparative quantification method using the MxPro software (Stratagene). Ribosomal protein 49 was used in all experiments to normalize for differences in total cDNA between samples. All quantitative PCR analyses were performed in triplicate.

RESULTS

The CG11086 gene encodes the Drosophila GADD45 homolog that is localized to the cell nucleus:

On the basis of BLAST results it was found that the D. melanogaster gene CG11086 is related to the mammalian growth arrest and DNA damage inducible (GADD45) gene family. This Drosophila GADD45-like protein (D-GADD45) shows strongest amino acid sequence identity with human GADD45γ (31%). D-GADD45 corresponds to a single exon with an ORF encoding a 163-amino acid protein. Protein features include a ribosomal protein domain that starts at position 33 and ends at position 134 (Koonin 1997).

As a first step we wanted to assess whether D-GADD45 localizes to the nucleus as its mammalian homologs (Azam et al. 2001; Zhang et al. 2001; Vairapandi et al. 2002). For this purpose the green fluorescent protein (GFP) tag was fused to the N terminus of D-GADD45 and we tested the localization of the fused protein in two cell systems, the yeast Saccharomyces cerevisiae and in the Drosophila embryo-derived Schneider S2 cell line. In both S2 and yeast, the protein showed a distinct localized distribution within the cell nucleus, demonstrating conservation of this property (Figure 1, A–E).

Figure 1.—

Figure 1.—

Open in a new tab

D-GADD45 is a nuclear protein. (A–C) Expression of D-GADD45 in Saccharomyces cerevisiae. (A) DNA staining; (B) GFP-tagged D-GADD45 expression; (C) merged pictures. (D and E) Expression in D. melanogaster embryo-derived Schneider S2 cells, Lamin in red. (D) GFP expression; (E) GFP-tagged D-GADD45 expression. D-GADD45 expression in both yeast and S2 cells revealed that the protein is distinctly localized within the cell nucleus.

D-GADD45 is not upregulated following different stress stimuli:

One of the well described responses to genotoxic and nongenotoxic stresses is the rapid upregulation of GADD45 proteins, which in turn affect cell cycle regulation, cell survival, and cell death (Fornace et al. 1988, 1989; Kastan et al. 1992). To examine D-GADD45 gene expression in response to exposure to different stressful agents, we used real-time PCR. We tested the response in both S2 cells and in the whole fly using a wide range of stressful conditions.

In mice, GADD45α was identified as a gene whose expression is increased following arsenic-induced stress (Liu et al. 2001). To study the effect of this stress on D-GADD45 transcription, we treated S2 cells with the toxic metal, arsenite. We found that treatment did not lead to D-GADD45 induction (Figure 2A). GADD45α was identified as a gene whose expression is induced following treatment with UV radiation (Fornace et al. 1988). S2 cells were therefore also treated with UV radiation. D-GADD45 mRNA levels in UV treated cells were similar to those found in the control (Figure 2A). GADD45α was also found to be rapidly and strongly induced in human lymphoblast cell lines following X-ray irradiation (Papathanasiou et al. 1991). For this reason, we treated flies with X rays, which causes DNA breaks. In this experiment we also found that the mRNA level of D-GADD45 in irradiated flies was similar to that found in nonirradiated flies (Figure 2B).

Figure 2.—

Figure 2.—

Open in a new tab

Quantitative RT–PCR on Schneider S2 cells and D. melanogaster flies. Total RNA was isolated, and quantitative RT–PCR was carried out to determine the expression of D-GADD45. Data shown are the mean from three independent experiments. (A) S2 cells were untreated, treated with arsenite, or irradiated with UVC. (B) Wild-type flies were untreated, received X-ray treatment, were fed paraquat, or were pricked with a needle previously dipped in a mixture of bacteria, causing septic injury.

All three GADD45 isoforms displayed a significant increase in expression in young mice following injection of paraquat (Edwards et al. 2003). This is why we chose to feed flies with paraquat and examine the level of D-GADD45 mRNA. We found that the mRNA levels of D-GADD45 did not differ significantly between treated and untreated extracts (Figure 2B).

D-GADD45 is upregulated upon activation of the immune response:

In a genomewide microarray analysis D-GADD45 was identified as a gene whose expression is induced following microbial infection (De Gregorio et al. 2001). In another study aimed to identify clusters of high-affinity Dorsal binding sites in the Drosophila genome, a cluster of three optimal Dorsal binding sites was identified 3 kb upstream to the D-GADD45 transcription start site (Markstein et al. 2002). Dorsal is an NF-B-like transcription factor belonging to the Toll pathway that is activated mainly by gram-positive bacteria and fungi infections (Hoffmann and Reichhart 2002; Tzou et al. 2002).

To strengthen the possible role for D-GADD45 in the immune response we conducted septic injury experiments in which wild-type flies were pricked in the thorax with a needle previously dipped into a concentrated gram-positive (Micrococcus luteus and Enterococcus faecalis) and gram-negative (Escherichia coli) bacterial culture. We analyzed the change in mRNA levels of D-GADD45 by real-time PCR. As a positive control we also checked the mRNA level of Drosomycin, which is a known AMP that is induced by septic injury. Following septic injury the level of D-GADD45 mRNA was significantly increased as compared with uninfected flies (Figure 2B). The mRNA level of our positive control, Drosomycin, also increased significantly, in accordance with previous results of others (data not shown).

D-GADD45 overexpression in somatic cells causes apoptosis:

To study the effect of overexpression of D-GADD45 in vivo we used the UAS-Gal4 binary system (Brand and Perrimon 1993) in which ubiquitous or tissue-specific expression can be induced. We cloned the full length D. melanogaster GADD45-like protein (CG11086) into the pUASp vector allowing expression in both somatic and germline tissues (Rorth 1998). Five transgenic lines harboring the construct were generated. Several Gal4 driver lines were used to express D-GADD45 at various times and in different somatic tissues. We found that the ubiquitous overexpression using Act and Tub Gal4 lines caused lethality in all the transgenic lines.

Next, we studied the effects of overexpression of D-GADD45 in the somatic follicle cells surrounding the egg chamber using CY2-Gal4 (Figure 3, A–D) and GR1-Gal4 (data not shown) drivers. Overexpression of D-GADD45 causes apoptosis of the egg chamber as revealed by DNA staining, which shows condensation and fragmentation of nurse cell DNA followed by apoptosis of the entire egg chamber (Figure 3D). This pattern of apoptosis of follicle cells that is followed by germline degeneration was previously reported by Chao and Nagoshi (1999). Since we found that overexpression of D-GADD45 in the somatic follicle cells led to apoptosis, we tested whether this is general to somatic cells or rather a tissue-specific response. For this purpose, D-GADD45 was overexpressed in other somatic tissues. No apoptosis was observed in somatic tissues such as the compound eye (Figure 3, E and F) and wing imaginal discs (data not shown).

Figure 3.—

Figure 3.—

Open in a new tab

D-GADD45 overexpression in the follicle cells causes apoptosis of the egg chamber D-GADD45 overexpression in the follicle cells and in the eye. (A–D) Hoechst DNA staining in blue. (A and C) Wild type and (B and D) D-GADD45 follicle cell overexpression using CY2-Gal4. Overexpression of D-GADD45 in the follicle cells caused apoptosis of the egg chamber, as seen from the typical condensation and breaking up of DNA content in both the nurse and follicle cells (B and D). (E and F) SEM images. (E) Control GMR-Gal4 line. (F) D-GADD45 eye overexpression using GMR-Gal4. No gross morphological changes were observed.

D-GADD45 overexpression in germline affects the dorsal–ventral patterning of the eggshell:

To assess the potential role of D-GADD45 during D. melanogaster oogenesis, we overexpressed D-GADD45 in the germline. Overexpression in the germline using nanos-Gal4 promoter leads to the production of a broad range of abnormal eggshell phenotypes, ranging from normal morphology to dorsalized (Figure 3; Table 1). The eggshell phenotypes vary from being wild-type like, bearing two dorsal appendages (Figure 4A), to weakly dorsalized eggs that have two broadened dorsal appendages (Figure 4B), and moderately dorsalized with one broadened dorsal appendage on the dorsal midline (Figure 4C). This observation suggests that overexpression of D-GADD45 in the germline affects the dorsal–ventral (D/V) polarity of the oocyte. Relatively lower percentages of the eggshell showed an additional phenotype, where the eggs had a more posteriorly located patch of dorsal appendage material (Figure 4D). This phenotype could arise from defects in dorsal–ventral pattering but were harder to classify. We analyzed the severity of dorsalized phenotypic class among the five different transgenic lines (Table 1).

TABLE 1.

Dorsalized eggshell phenotypes of different transgenic lines with D-GADD45 overexpression in the germline using nanos-GAL4

Genotype Wild-type-like eggshell (%) Weakly dorsalized (%) Moderately dorsalized (%) n
D-GADD45#1/nanos-Gal4 9 26 65 118
D-GADD45#3/nanos-Gal4 14 35 51 115
D-GADD45#4/nanos-Gal4 3 3 94 154
D-GADD45#6/nanos-Gal4 10 37 53 102
D-GADD45#8/nanos-Gal4 41 17 42 145
Open in a new tab

Classification of eggshells on the basis of the dorsal–ventral polarity was performed according to the following criteria: wild type, two distinct dorsal appendages; weakly dorsalized eggshells, two broadened dorsal appendages; moderately dorsalized, with one broadened dorsal appendage on the dorsal midline.

Figure 4.—

Figure 4.—

Open in a new tab

Eggshell dorsal–ventral defects in flies with D-GADD45 overexpression in the germline. D-GADD45 overexpression in the germline using nanos-Gal4. Overexpression affected the dorsal–ventral polarity of the oocyte and led to the production of a broad range of abnormal eggshell phenotypes, ranging from normal morphology to dorsalized: (A) eggs resembling wild-type eggs bearing two dorsal appendages, (B) slightly dorsalized eggs with two short and broadened dorsal appendages, (C) eggshells with one broadened dorsal appendage on the dorsal midline, and (D) eggs that had a more posteriorly located patch of dorsal appendage material. This type of egg may also be due to a dorso–ventral problem of the oocyte, but is harder to classify.

D-GADD45 overexpression in germline affects grk RNA localization:

Since overexpression of D-GADD45 in the germ cells affects the dorsal–ventral polarity of the oocyte (Figure 4, Table 1) we decided to check whether the overexpression has an effect on factors involved in the establishment of this embryonic axis.

The anterior–posterior (A/P) and dorsal–ventral (D/V) axes of the D. melanogaster embryo are established during oogenesis by a communication between the oocyte and the surrounding follicle cells (Schüpbach 1987; Ruohola-Baker et al. 1994). This communication is mediated by a single signaling system involving gurken (grk) and Epidermal growth factor receptor (Egfr) genes (González-Reyes et al. 1995; Roth et al. 1995). grk encodes a TGF-α-like protein that is expressed in the germline and is secreted from the oocyte (Neuman-Silberberg and Schüpbach 1993, 1996). Egfr is expressed throughout the follicular epithelium (Kammermeyer and Wadsworth 1987; Sapir et al. 1998), where it acts as a receptor for Gurken.

D-GADD45 overexpression in the germline affects asymmetric development during oogenesis, with phenotypic consequences on D/V patterning of the eggshell suggesting that it might affect the grk–Egfr pathway. Therefore we examined the localization of grk RNA and protein. In wild-type ovaries, grk RNA accumulates in the oocyte during early stages of oogenesis. At mid-oogenesis, it is localized within the oocyte, first transiently in an anterior–cortical ring, and then to a dorsal–anterior domain in the cytoplasm directly overlying the oocyte nucleus (Figure 5A). Grk protein is restricted to the oocyte and in mid-oogenesis, is localized to the dorsal–anterior corner of the oocyte, similar to the RNA (Neuman-Silberberg and Schüpbach 1996; Figure 5C).

Figure 5.—

Figure 5.—

Open in a new tab

gurken mRNA is mislocalized in flies with D-GADD45 overexpression in the germline. grk mRNA and Grk protein localization in wild-type and in D-GADD45 overexpression ovaries. (A and B) grk RNA in situ localization in stage-9 egg chambers. (A) Wild-type egg chamber. (B) D-GADD45 germline overexpression egg chamber. In most egg chambers grk RNA abnormally accumulates as a circular ring around the anterior of the oocyte. (C and D) Grk protein expression in stage-9 egg chambers, Grk in red. (C) Wild-type egg chamber. (D) D-GADD45 overexpression egg chamber. No difference in Grk protein localization was observed.

At stage 9, 57% of D-GADD45 overexpression egg chambers display a mislocalized grk RNA pattern. grk mRNA is detected as a circular ring along the anterior cortex (Figure 5B, arrows). Thus, it seems that overexpression of D-GADD45 affects the proper localization of grk mRNA to the dorsal–anterior region of the oocyte. To determine if the mislocalized RNA in these ovaries is translated, we analyzed Grk protein expression by whole-mount antibody staining. We did not observe egg chambers where Grk was mislocalized (Figure 5D), possibly due to insensitivity of this assay.

D-GADD45 overexpression in germline affects Grk activity:

To gain further insight into the effect overexpression of D-GADD45 has on the grk–Egfr pathway we tested grk activity using the kekon (kek)-lacZ enhancer trap line and BR-C patterning. The kek gene is a target of the Egfr in the follicle cells and thus serves as an indirect and sensitive assay to measure grk activity in the oocyte. In wild-type egg chambers, kek is expressed in a characteristic graded dorsal–anterior pattern reflecting both the intensity and localization of the underlying grk signal (Figure 6A; Musacchio and Perrimon 1996; Sapir et al. 1998; Suzanne et al. 1999). Overexpression of D-GADD45 disrupts the kek-lacZ graded pattern. In 72% of the egg chambers kek signal is significantly expanded throughout the follicle cells that span the oocyte, losing its high point in the dorsal–anterior corner (Figure 6B). This result suggests an increase of grk activity consistent with the dorsalization of the chorion.

Figure 6.—

Figure 6.—

Open in a new tab

D-GADD45 overexpression in germline affects Grk activity as seen by staining of the kek-lacZ enhancer trap line and BR-C antibody staining. kek-lacZ enhancer trap line and BR-C antibody staining in wild-type and in D-GADD45 overexpression egg chambers. (A and B) β-Gal staining of the kek-lacZ enhancer trap line. (A) Wild-type egg chamber; (B) D-GADD45 overexpression egg chamber. The normal dorsal–anterior graded expression of kek-lacZ is disrupted. In 72% of the egg chambers the kek signal is significantly expanded throughout the follicle cells that span the oocyte, losing its high point in the dorsal–anterior corner. (C–F) BR-C protein expression in egg chambers, BR-C in red. (C and E) Wild-type egg chamber, (D and F) D-GADD45 overexpression egg chamber. In 87% of stage-11 egg chambers BR-C is laterally expanded with a complete loss of the dorsal–anterior gap. Stage-13 egg chambers also have no detectable dorsal gap.

An additional marker, Broad-Complex (BR-C), belongs to a family of transcription factors that are expressed in the follicle cells in a dynamic pattern, the late pattern being defined by two groups of dorsal–anterior follicle cells at stage 10B of oogenesis. BR-C was also shown to be involved in dorsal appendage morphogenesis. The dorsal–anterior expression pattern is specified by the Grk–Egfr and decapentaplegic (DPP) signaling pathways and can therefore serve as an additional marker for Grk–Egfr signaling (Deng and Bownes 1997). Using an antibody for BR-C we can examine the distribution pattern of BR-C. In a wild-type stage-11 egg chamber two groups of lateral–dorsal–anterior follicle cells are heavily stained (Figure 6C, arrows), while the posterior and the ventral follicle cells are weakly stained. Expression of D-GADD45 disrupts the BR-C and leads to a range of patterns. Stage-11 egg chambers display a complete loss of the dorsal–anterior gap between the two groups of the lateral–dorsal cells (Figure 6D). Eighty-seven percent of the egg chambers showed a laterally expanded staining (Figure 6D, bracket). In late stages of oogenesis, wild-type stage-13 egg chamber expression is detectable only in the dorsal appendage-associated follicle cells (Figure 6E, arrows). Once again with germline D-GADD45 overexpression there is no detectable dorsal gap (Figure 6F), which may correspond with the broadened, fused, dorsal appendages described previously. In fact, there is in general a very good correspondence between our observations of kek or BR-C expansion and loss of dorsal gap during oogenesis and the high percentage of dorsalized eggshells produced by the females (Table 1).

D-GADD45 overexpression in germline affects anterior–posterior polarity determinants:

The localization of bicoid (bcd) and oskar (osk) mRNA to the anterior and posterior poles of the oocyte define the A/P axis of the embryo. osk mRNA, at the posterior pole, directs assembly of the pole plasm, containing determinants of the abdomen and germline (Ephrussi and Lehmann 1992; Reichmann and Ephrussi 2001). Since osk is fundamental for oocyte polarization, we decided to check the localization of osk RNA and protein in egg chambers of flies overexpressing D-GADD45 in the germline.

In situ hybridization of D-GADD45 overexpression egg chambers revealed that the osk RNA transcript is mislocalized. In stage-9 egg chambers osk mRNA was found along the anterior cortex and in a more diffused pattern at the posterior pole (data not shown). The majority of stage-10 egg chambers were also missing the tightly localized crescent (Figure 7B) seen in wild-type egg chambers (Figure 7A). Immunofluorescent staining of stage-10 egg chambers with anti-Oskar antibody revealed that Osk protein was localized to the posterior pole of the oocyte but was not restricted to a cortical crescent (Figure 7D) as in wild-type egg chambers of this stage (Figure 7C).

Figure 7.—

Figure 7.—

Open in a new tab

Posterior end markers are mislocalized in flies with D-GADD45 overexpression in the germline. osk mRNA, Osk protein, and Kin:β-gal localization in wild-type and in D-GADD45 overexpression ovaries are shown. (A and B) osk RNA in situ localization in stage-10 egg chambers. (A) Wild-type egg chamber; (B) D-GADD45 overexpression egg chamber. osk RNA transcript is mislocalized and can be detected in a more diffuse pattern at the posterior pole. (C and D) Osk protein expression in stage-10 egg chambers, Osk in green. (C) Wild-type egg chamber; (D) D-GADD45 overexpression egg chamber. Osk is not restricted to a cortical crescent at the posterior pole similarly to the mislocalized RNA pattern. (E and F) Kin:β-gal localization in stage-9 egg chambers with Kin:β-gal in green. (E) Wild-type egg chamber; (F) D-GADD45 overexpression egg chamber. Kin:β-gal appears less compact and at a more central region of the oocyte.

Next we examined the localization of bcd mRNA, which is localized at the anterior pole and later on is translated after fertilization to produce a morphogen gradient that patterns the anterior region of the embryo (Driever 1993). We found that bcd mRNA is correctly localized along the anterior cortex of egg chambers with D-GADD45 overexpression (data not shown).

Since the localization of osk and grk RNA's are dependent on cytoskeleton organization in the oocyte, we asked whether the actin and/or the microtubule network are altered during oogenesis. To investigate the polarity and transport to the posterior pole of the oocyte, we used the plus-end microtubule-associated motor protein, kinesin, fused to the bacterial β-galactosidase enzyme (Kin:β-gal) as a reporter (Clark et al. 1994, 1997). Immunofluorescence assay with anti-β-Gal demonstrated a less compact staining at a more central region of the oocyte in egg chambers with D-GADD45 overexpression in the germline (Figure 7F) as compared to wild-type ovaries (Figure 7E).

To analyze transport to the anterior pole, we used the microtubule minus-end marker Nod: β-gal (Clark et al. 1997). We found that Nod:β-gal localization in flies with D-GADD45 overexpression in the germline is similar to that observed in wild-type stage-9 egg chambers, the fusion protein is concentrated along the anterior cortex of the oocyte (data not shown). These results are consistent with the proper localization of bcd mRNA as described above. We were also able to observe normal oocyte nucleus migration to the anterodorsal position at stage 8 of oogenesis in these egg chambers (González-Reyes et al. 1995; Roth et al. 1995; data not shown).

Next, we asked whether the actin and/or the microtubule network are altered during oogenesis. To analyze the organization of the microtubule network in egg chambers with D-GADD45 overexpression in the germline, we used α-tubulin staining. Using this tool, we were unable to detect any defect in the microtubule network (data not shown). Also, to examine the actin network, ovaries were stained with Rhodamine-conjugated phalloidin; however, no obvious defects in the organization of the actin network and ring canal structure were found in the transgenic flies' ovaries.

D-GADD45 overexpression in germline affects the MAPK pathway:

In eukaryotes from yeasts to mammals, various cellular stresses generate intracellular signals that converge on the MAPK pathways (Mita et al. 2002). Three main MAPK families are the extracellular signal-regulated kinase (ERK), p38, and JNK. Several studies have shown that the GADD45 proteins may play a role in the JNK and/or p38 MAPK signaling pathways (Takekawa and Saito 1998; Harkin et al. 1999). The genome of the fruit fly D. melanogaster possesses all MAPK families present in the mammalian genome, but represented, typically, by fewer genes (Ryabinina et al. 2006). Therefore, D. melanogaster makes an excellent, simple model system for studying signaling in evolutionary conserved pathways.

Human GADD45 proteins were shown to physically interact with the MAPKKK, MTK1 (synonym MEKK4), resulting in the activation of MTK1 which further activates both JNK and p38 (Takekawa and Saito 1998). Since GADD45 proteins were shown to activate the JNK and/or p38 MAPK signaling pathways, we searched for a genetic interaction between the D-GADD45 and p38/JNK kinases. It was previously shown that flies mutant for licorne (lic, synonym D-MKK3), the D. melanogaster p38 MAPKK, display a ventralized eggshell phenotype (Suzanne et al. 1999). Loss of function of lic in the germline leads to reduced Egfr activity in the follicle cells due to a reduction of Grk protein in the oocyte. Lic is also required for maintenance of osk mRNA localization during midoogenesis. In stage-9 lic germ-line clones osk mRNA is mislocalized, diffusing through the whole oocyte in a gradient from the posterior to the anterior pole. Suzanne et al. (1999) proposed that the patterning of the egg relies on activation of the p38 MAPK pathway. We hypothesized that D-GADD45 overexpression, which caused dorsalization of the eggshell, could be an effect mediated through interactions of D-GADD45 with the MAPK protein(s).

To elucidate the nature of D-GADD45 regulation of the MAPK pathway, we generated flies with D-GADD45 overexpression in a partially deficient p38 and JNK background. The fly stock used was doubly mutant for both lic and hemipterous (hep), the D. melanogaster JNKK gene (Suzanne et al. 1999). We found that reducing the level of both lic and hep significantly suppressed the dorsalized eggshell phenotype (Table 2). Next, we analyzed whether reducing the level of p38 and JNK kinases also affects the mislocalization of Osk protein in D-GADD45 overexpression ovaries. We found that the defects in Osk protein localization were also considerably reduced from 84 to only 33% in these flies.

TABLE 2.

Suppression of the dorsalized eggshell phenotypes of D-GADD45 overexpression in a partially deficient JNK background

Genotype Wild-type-like eggshell (%) Dorsalized eggshell (%) n
FM7; D-GADD45#1/nanos-Gal4 20 80 280
Df{hep,lic}; D-GADD45#1/nanos-Gal4 71 29 269
hepG0208; D-GADD45#1/nanos-Gal4 60 40 589
hepr75; D-GADD45#1/nanos-Gal4 81 19 439
Open in a new tab

Next we intended to pinpoint the dominant suppression to either the p38 or the JNK pathway. Since there are no flies singly mutant for lic, we examined the effect of D-GADD45 overexpression in a single hep deficient background. To our surprise we found, using two different hep mutant alleles, that the dorsal–ventral patterning defects caused by D-GADD45 overexpression were dominantly suppressed (Table 2). The level of suppression was similar to that of the heterozygous deficiency that uncovers both hep and lic, suggesting that hep is the main D-GADD45 activator in the germline.

DISCUSSION

In this article we characterized the gene CG11086, which has been identified as the D. melanogaster GADD45 homolog. We showed that D-GADD45 preserves the nuclear localization property, but unlike its mammalian homologs its expression is not elevated following exposure to different stress stimuli. This result is supported by the D. melanogaster whole genome microarray analysis which did not identify D-GADD45 as a gene whose expression is increased following various genotoxic and nongenotoxic treatments (Brodsky et al. 2004; Girardot et al. 2004; Qin et al. 2005; Terashima and Bownes 2005). Although we tried a number of stress treatments, it is possible that D-GADD45 expression would rise only following exposure to other stressful conditions.

D-GADD45 was identified as a gene whose expression is induced following microbial infection (De Gregorio et al. 2001). It was also shown that D-GADD45 expression may be regulated by the NF-B-like transcription factor, Dorsal, which has an optimal binding site 3 kb upstream to D-GADD45 transcription start site (Markstein et al. 2002). Our results are consistent with those found by De Gregorio et al (2001) and further strengthen a possible function for D-GADD45 in the immune response. Given that Drosophila is devoid of an adaptive immune system and relies only on innate immune reactions for its defense, D-GADD45 may play an important role during infection.

We found that ubiquitous overexpression of D-GADD45 was lethal, most likely due to apoptosis, as we directly demonstrated in the follicle cells. However, our results suggest that apoptosis induced by overexpression of D-GADD45 is tissue specific since overexpression of D-GADD45 in other somatic tissues, such as the eye and wing, did not lead to apoptosis. Also, overexpression in the germline did not cause cell death; rather, it affected egg chamber asymmetric development. The apparent phenotypic differences in overexpression of D-GADD45 in the germline as opposed to somatic derived tissues probably reflect the complexity of the biological functions of GADD45, which may be subject to tissue- and/or signal-specific regulation that ultimately dictate their output. Similarly, it has been shown that individual members of the GADD45 family play critical roles in negative growth control in some tissues while in others they are associated with uncontrolled cell growth and tumor development. GADD45α was identified as an important mediator of tumor suppression in human ovarian cancer cells (Jiang et al. 2003). While in pancreatic ductal adenocarcinoma GADD45α was found to be overexpressed at the mRNA and protein level. Downregulation of GADD45α by means of RNAi reduced proliferation and induced apoptosis in pancreatic cancer cells implying that GADD45α contributes to pancreatic cancer cell proliferation and viability (Schneider et al. 2006).

We found that overexpression of D-GADD45 in the germline resulted in dorsalization of the chorion due to defects in grk localization and translation. We also showed that the posterior markers osk and Kin:β-gal were mislocalized during mid-oogenesis. On the other hand, D-GADD45 overexpression did not affect the localization of anterior end markers such as bcd and Nod:β-gal and also the anterior oocyte nuclear migration is unaffected. Similar results were reported in mutants of squid (sqd) which encodes a heterogeneous nuclear ribonucleoprotein (hnRNP). In these mutants grk mRNA is mislocalized along the anterior ring, leading to dorsalization of the eggshell (Kelley 1993; Neuman-Silberberg and Schüpbach 1993, 1996; Matunis et al. 1994). Furthermore, loss of sqd function causes an aberrant localization of osk and Kin:β-gal, but does not affect bcd localization and oocyte nucleus migration (Norvell et al. 2005; Steinhauer and Kalderon 2005). It was shown that in sqd mutant oocytes short microtubules (MTs) around the entire oocyte cortex are retained, including at the posterior pole, unlike wild-type MTs which emanate mostly from the anterior. It was suggested that the primary MT defect in sqd mutants is the failure to eliminate cortical sites of MT nucleation beyond stage 7 (Steinhauer and Kalderon 2005). It is possible that D-GADD45 overexpression also affects MT organization in the oocyte. This possibility is further supported by the finding that GADD45α interacts with elongation factor 1α (EF-1α), a microtubule-severing protein that plays an important role in maintaining microtubule cytoskeletal stability (Tong et al. 2005). To test whether D-GADD45 affects MT organization, we stained the ovaries with anti-tubulin. Using this tool, we were unable to detect any gross morphological changes in the MT network. Given that the patterning defect seen in D-GADD45 overexpression is weaker than that in sqd mutants, it could be that this kind of staining is not sensitive enough to identify the MT network alterations in D-GADD45 overexpression flies.

We found a genetic interaction between D-GADD45 and proteins of the MAPK–JNK pathway. Mutations in the JNKK, hemipterous, dominantly suppressed the dorsalized eggshell phenotype. This genetic interaction is supported by the finding that in human cells GADD45 proteins act as initiators of JNK/p38 signaling via their interaction with the MAPKKK, MTK1 (Takekawa and Saito 1998). It was shown that the N-terminal of MTK1 inhibits its C-terminal kinase domain by preventing the kinase domain from interacting with its substrate, MKK6, and binding of GADD45 proteins relieves this auto-inhibition (Mita et al. 2002; Miyake et al. 2007).

Up until now the only roles attributed to the JNK pathway during oogenesis were in the follicle cells and included morphogenesis of the dorsal appendages and the micropyle (Suzanne et al. 2001). It was also reported that the JNK pathway is involved in the morphogenetic process of dorsal closure during embryogenesis (Ip and Davis 1998; Noselli 1998; Agnès et al. 1999; Noselli and Agnès 1999). To our surprise, we found that eggshell patterning defects caused by D-GADD45 overexpression are dominantly suppressed in a hep deficient background suggesting an additional role for the JNK pathway in the germline. This novel function may have gone unnoticed in the past while studying JNK loss-of-function alleles due to redundancy with some other pathway. In our study overexpression of the JNK activator, D-GADD45, may have unmasked this new role during oogenesis.

Acknowledgments

We thank Paul MacDonald, Stéphane Noselli, Stephen Elledge, Bruno Lemaitre, Trudi Schüpbach, and the Bloomington stock center for generously providing fly strains and reagents. We also thank Trudi Schüpbach for comments on the manuscript and Natalie Denef for the help with the transgenic flies. This work was supported by the Research Career Development Award from the Israel Cancer Research Fund to U.A.

References

  1. Abdollahi, A., K. A. Lord, B. Hoffmann-Liebermann and D. Liebermann, 1991. Sequence and expression of a cDNA encoding MyD118: a novel myeloid differentiation primary response gene induced by multiple cytokines. Oncogene 6: 165–167. [PubMed] [Google Scholar]
  2. Adams, A., D. E. Gottshling, C. A. Kaiser and T. Stearns, 1997. Methods in Yeast Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  3. Agnès, F., M. Suzanne and S. Noselli, 1999. The Drosophila JNK pathway controls the morphogenesis of imaginal disc during metamorphosis. Development 126: 5453–5462. [DOI] [PubMed] [Google Scholar]
  4. Azam, N., M. Vairapandi, W. Zhang, B. Hoffman and D. A. Liebermann, 2001. Interaction of CR6 (GADD45γ) with proliferating cell nuclear antigen impedes negative growth control. J. Biol. Chem. 276: 2766–2774. [DOI] [PubMed] [Google Scholar]
  5. Beadling, C., K. W. Johnson and K. A. Smith, 1993. Isolation of interleukin 2-induced immediate-early genes. Proc. Natl. Acad. Sci. USA 90: 2719–2723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Brand, A. H., and N. Perrimon, 1993. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118: 401–415. [DOI] [PubMed] [Google Scholar]
  7. Brodsky, M. H., B. T. Weinert, G. Tsang, Y. S. Rong, N. M. McGinnis et al., 2004. Drosophila melanogaster MNK/Chk2 and p53 regulate multiple DNA repair and apoptotic pathways following DNA damage. Mol. Cell. Biol. 24(3): 1219–1231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Candal, E., V. Thermes, J. S. Joly and F. Bourrat, 2004. Medaka as a model system for the characterisation of cell cycle regulators: a functional analysis of Ol-Gadd45γ during early embryogenesis. Mech. Dev. 121: 945–958. [DOI] [PubMed] [Google Scholar]
  9. Chao, S. H., and R. N. Nagoshi, 1999. Induction of apoptosis in the germline and follicle layer of Drosophila egg chambers. Mech. Dev. 88: 159–172. [DOI] [PubMed] [Google Scholar]
  10. Clark, I., E. Giniger, H. Ruohola-Baker, L. Y. Jan and Y. N. Jan, 1994. Transient posterior localization of a kinesin fusion protein reflects anteroposterior polarity of the Drosophila oocyte. Curr. Biol. 4: 289–300. [DOI] [PubMed] [Google Scholar]
  11. Clark, I. E., L. Y. Jan and Y. N. Jan, 1997. Reciprocal localization of Nod and kinesin fusion proteins indicates microtubule polarity in the Drosophila oocyte, epithelium, neuron and muscle. Development 124: 461–470. [DOI] [PubMed] [Google Scholar]
  12. De Gregorio, E., P. T. Spellman, G. M. Rubin and B. Lemaitre, 2001. Genome-wide analysis of the Drosophila immune response by using oligonucleotide microarrays. Proc. Natl. Acad. Sci. USA 98(22): 12590–12595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Deng, W. M., and M. Bownes, 1997. Two signalling pathways specify localised expression of the Broad-Complex in Drosophila eggshell patterning and morphogenesis. Development 124(22): 4639–4647. [DOI] [PubMed] [Google Scholar]
  14. Driever, W., 1993. Maternal control of anterior development in the Drosophila embryo, pp. 301–324 in The Development of Drosophila melanogaster, Vol. I, edited by M. Bate and A. Martinez-Arias. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  15. Edwards, M. G., D. Sarkar, R. Klopp, J. D. Morrow, R. Weindruch et al., 2003. Age-related impairment of the transcriptional responses to oxidative stress in the mouse heart. Physiol. Genomics 13: 119–127. [DOI] [PubMed] [Google Scholar]
  16. Ephrussi, A., and R. Lehmann, 1992. Induction of germ cell formation by oskar. Nature 358: 387–392. [DOI] [PubMed] [Google Scholar]
  17. Fornace, Jr., A. J., D. W. Nebert, M. C. Hollander, J. D. Luethy, M. Papathanasiou et al., 1989. Mammalian genes coordinately regulated by growth arrest signals and DNA-damaging agents. Mol. Cell. Biol. 9: 4196–4203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Fornace, Jr., A. J., I. Alamo, Jr. and M. C. Hollander, 1988. DNA damage inducible transcripts in mammalian cells. Proc. Natl. Acad. Sci. USA 85: 8800–8804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Girardot, F., V. Monnier and H. Tricoire, 2004. Genome wide analysis of common and specific stress responses in adult Drosophila melanogaster. BMC Genomics 5(1): 74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. González-Reyes, A., H. Elliott and D. St Johnston, 1995. Polarization of both major body axes in Drosophila by gurken-torpedo signalling. Nature 375: 654–658. [DOI] [PubMed] [Google Scholar]
  21. Harkin, D. P., J. M. Bean, D. Miklos, Y. H. Song, V. B. Truong et al., 1999. Induction of GADD45 and JNK/SAPK-dependent apoptosis following inducible expression of BRCA1. Cell 97: 575–586. [DOI] [PubMed] [Google Scholar]
  22. Hoffmann, J. A., and J. M. Reichhart, 2002. Drosophila innate immunity: an evolutionary perspective. Nat. Immunol. 3: 121–126. [DOI] [PubMed] [Google Scholar]
  23. Hoffmeyer, A., R. Piekorz, R. Moriggl and J. N. Ihle, 2001. Gadd45gamma is dispensable for normal mouse development and T-cell proliferation. Mol. Cell. Biol. 9: 3137–3143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hollander, M. C., M. S. Sheikh, D. V. Bulavin, K. Lundgren, L. Augeri-Henmueller et al., 1999. Genomic instability in Gadd45a-deficient mice. Nat. Genet. 23: 176–184. [DOI] [PubMed] [Google Scholar]
  25. Ip, Y. T., and R. J. Davis, 1998. Signal transduction by the c-Jun N-terminal kinase (JNK)–from inflammation to development. Curr. Opin. Cell Biol. 10: 205–219. [DOI] [PubMed] [Google Scholar]
  26. Jiang, F., P. Li, A. J. Fornace, Jr., S. V. Nicosia and W. Bai, 2003. G2/M arrest by 1,25-dihydroxyvitamin D3 in ovarian cancer cells mediated through the induction of GADD45 via an exonic enhancer. J. Biol. Chem. 278: 48030–48040. [DOI] [PubMed] [Google Scholar]
  27. Jin, S., T. Tong, W. Fan, F. Fan, M. J. Antinore et al., 2002. GADD45-induced cell cycle G2-M arrest associates with altered subcellular distribution of cyclin B1 and is independent of p38 kinase activity. Oncogene 21: 8696–8704. [DOI] [PubMed] [Google Scholar]
  28. Kammermeyer, K. L., and S. C. Wadsworth, 1987. Expression of Drosophila epidermal growth factor receptor homologue in mitotic cell populations. Development 100: 201–210. [DOI] [PubMed] [Google Scholar]
  29. Kastan, M. B., Q. Zhan, W. S. El-Deiry, F. Carrier, T. Jacks et al., 1992. A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell 71: 587–597. [DOI] [PubMed] [Google Scholar]
  30. Kawahara, A., Y. S. Che, R. Hanaoka, H. Takeda and I. B. Dawid, 2005. Zebrafish GADD45β genes are involved in somite segmentation. Proc. Natl. Acad. Sci. USA 102(2): 361–366. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kearsey, J. M., P. J. Coates, A. R. Prescott, E. Warbrick and P. A. Hall, 1995. Gadd45 is a nuclear cell cycle regulated protein which interacts with p21Cip1. Oncogene 9: 1675–1683. [PubMed] [Google Scholar]
  32. Kelley, R. L., 1993. Initial organization of the Drosophila dorsoventral axis depends on an RNA-binding protein encoded by the squid gene. Genes Dev. 7(6): 948–960. [DOI] [PubMed] [Google Scholar]
  33. Kelman, Z., and J. Hurwitz, 1998. Protein-PCNA interactions: a DNA-scanning mechanism? Trends Biochem. Sci. 23: 236–238. [DOI] [PubMed] [Google Scholar]
  34. Koonin, E. V., 1997. Cell cycle and apoptosis: possible roles of Gadd45 and MyD118 proteins inferred from their homology to ribosomal proteins. J. Mol. Med. 75: 236–238. [PubMed] [Google Scholar]
  35. Lindsley, D. L., and G. G. Zimm, 1992. The Genome of Drosophila melanogaster. Academic Press, New York.
  36. Liu, J., M. B. Kadiiska, Y. Liu, T. Lu, W. Qu et al., 2001. Stress-related gene expression in mice treated with inorganic arsenicals. Toxicol. Sci. 61(2): 314–320. [DOI] [PubMed] [Google Scholar]
  37. Markstein, M., P. Markstein, V. Markstein and M. S. Levine, 2002. Genome-wide analysis of clustered Dorsal binding sites identifies putative target genes in the Drosophila embryo. Proc. Natl. Acad. Sci. USA 99: 763–768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Matunis, E. L., R. Kelley and G. Dreyfuss, 1994. Essential role for a heterogeneous nuclear ribonucleoprotein (hnRNP) in oogenesis: hrp40 is absent from the germ line in the dorsoventral mutant squid. Proc. Natl. Acad. Sci. USA 91(7): 2781–2784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Mita, H., J. Tsutsui, M. Takekawa, E. A. Witten and H. Saito, 2002. Regulation of MTK1/MEKK4 kinase activity by its N-terminal autoinhibitory domain and GADD45 binding. Mol. Cell. Biol. 22: 4544–4555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Miyake, Z., M. Takekawa, Q. Ge and H. Saito, 2007. Activation of MTK1/MEKK4 by GADD45 through induced N-C dissociation and dimerization-mediated trans autophosphorylation of the MTK1 kinase domain. Mol. Cell. Biol. 27(7): 2765–2776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Musacchio, M., and N. Perrimon, 1996. The Drosophila kekkon genes: novel members of both the leucine-rich repeat and immunoglobulin superfamilies expressed in the CNS. Dev. Biol. 178: 63–76. [DOI] [PubMed] [Google Scholar]
  42. Neuman-Silberberg, F. S., and T. Schüpbach, 1993. The Drosophila dorsoventral patterning gene gurken produces a dorsally localized RNA and encodes a TGF alpha-like protein. Cell 75: 165–174. [PubMed] [Google Scholar]
  43. Neuman-Silberberg, F. S., and T. Schüpbach, 1996. The Drosophila TGF-alpha-like protein Gurken: expression and cellular localization during Drosophila oogenesis. Mech. Dev. 59: 105–113. [DOI] [PubMed] [Google Scholar]
  44. Norvell, A., A. Debec, D. Finch, L. Gibson and B. Thoma, 2005. Squid is required for efficient posterior localization of oskar mRNA during Drosophila oogenesis. Dev. Genes Evol. 215(7): 340–349. [DOI] [PubMed] [Google Scholar]
  45. Noselli, S., 1998. JNK signaling and morphogenesis in Drosophila. Trends Genet. 14: 33–38. [DOI] [PubMed] [Google Scholar]
  46. Noselli, S., and F. Agnès, 1999. Roles of the JNK signaling pathway in Drosophila morphogenesis. Curr. Opin. Genet. Dev. 9: 466–472. [DOI] [PubMed] [Google Scholar]
  47. Nusslein-Volhard, C., and E. Wieschaus, 1980. Mutations affecting segment number and polarity in Drosophila. Nature 287(5785): 795–801. [DOI] [PubMed] [Google Scholar]
  48. Papathanasiou, M. A., N. C. Kerr, J. H. Robbins, O. W. McBride, I. Alamo, Jr. et al., 1991. Induction by ionizing radiation of the gadd45 gene in cultured human cells: lack of mediation by protein kinase C. Mol. Cell. Biol. 11(2): 1009–1016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Qin, W., S. J. Neal, R. M. Robertson, J. T. Westwood and V. K. Walker, 2005. Cold hardening and transcriptional change in Drosophila melanogaster. Insect Mol. Biol. M(6): 607–613. [DOI] [PubMed]
  50. Queenan, A. M., A. Ghabrial and T. Schüpbach, 1997. Ectopic activation of torpedo/Egfr, a Drosophila receptor tyrosine kinase, dorsalizes both the eggshell and the embryo. Development 124(19): 3871–3880. [DOI] [PubMed] [Google Scholar]
  51. Queenan, A. M., G. Barcelo, C. Van Buskirk and T. Schüpbach, 1999. The transmembrane region of Gurken is not required for biological activity, but is necessary for transport to the oocyte membrane in Drosophila. Mech. Dev. 89: 35–42. [DOI] [PubMed] [Google Scholar]
  52. Reichmann, V., and A. Ephrussi, 2001. Axis formation during Drosophila oogenesis. Curr. Opin. Genet. Dev. 11: 374–383. [DOI] [PubMed] [Google Scholar]
  53. Rorth, P., 1998. Gal4 in the Drosophila female germline. Mech. Dev. 78: 113–118. [DOI] [PubMed] [Google Scholar]
  54. Roth, S., and T. Schüpbach, 1994. The relationship between ovarian and embryonic dorsoventral patterning in Drosophila. Development 120(8): 2245–2257. [DOI] [PubMed] [Google Scholar]
  55. Roth, S., F. S. Neuman-Silberberg, G. Barcelo and T. Schüpbach, 1995. Cornichon and the EGF receptor signaling process are necessary for both anterior-posterior and dorsal-ventral pattern formation in Drosophila. Cell 81: 967–978. [DOI] [PubMed] [Google Scholar]
  56. Ruohola-Baker, H., L. Y. Jan and Y. N. Jan, 1994. The role of gene cassettes in axis formation during Drosophila oogenesis. Trends Genet. 10: 89–94. [DOI] [PubMed] [Google Scholar]
  57. Ryabinina, O. P., E. Subbian and M. S. Iordanov, 2006. D-MEKK1, the Drosophila orthologue of mammalian MEKK4/MTK1, and Hemipterous/D-MKK7 mediate the activation of D-JNK by cadmium and arsenite in Schneider cells. BMC Cell Biol. 7: 7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Sapir, A., R. Schweitzer and B. Z. Shilo, 1998. Sequential activation of the EGF receptor pathway during Drosophila oogenesis establishes the dorsoventral axis. Development 125: 191–200. [DOI] [PubMed] [Google Scholar]
  59. Schneider, G., A. Weber, U. Zechner, F. Oswald, H. M. Friess et al., 2006. GADD45a is highly expressed in pancreatic ductal adenocarcinoma cells and required for tumor cell viability. Int. J. Cancer 118: 2405–2411. [DOI] [PubMed] [Google Scholar]
  60. Schüpbach, T., 1987. Germ line and soma cooperate during oogenesis to establish the dorsoventral pattern of egg shell and embryo in Drosophila melanogaster. Cell 49(5): 699–707. [DOI] [PubMed] [Google Scholar]
  61. Schüpbach, T., and S. Roth, 1994. Dorsoventral patterning in Drosophila oogenesis. Curr. Opin. Genet. Dev. 4(4): 502–507. [DOI] [PubMed] [Google Scholar]
  62. Sheikh, M. S., M. C. Hollander and A. J. Fornace, Jr., 2000. Role of Gadd45 in Apoptosis. Biochem. Pharmacol. 59: 43–45. [DOI] [PubMed] [Google Scholar]
  63. Spradling, A. C., 1986. P element-mediated transformation, pp. 175–197 in Drosophila—A Practical Approach, edited by D. B. Roberts. IRL, Oxford.
  64. Steinhauer, J., and D. Kalderon, 2005. The RNA-binding protein Squid is required for the establishment of anteroposterior polarity in the Drosophila oocyte. Development 132(24): 5515–5525. [DOI] [PubMed] [Google Scholar]
  65. Suzanne, M., I. Kenji, G. Bruno, A. Francois, M. Eiji et al., 1999. The Drosophila p38 MAPK pathway is required during oogenesis for egg asymmetric development. Genes Dev. 13: 1464–1474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Suzanne, M., N. Perrimon and S. Noselli, 2001. The Drosophila JNK pathway controls the morphogenesis of the egg dorsal appendages and micropyle. Dev. Biol. 237: 282–294. [DOI] [PubMed] [Google Scholar]
  67. Takekawa, M., and H. Saito, 1998. A family of stress-inducible GADD45-like proteins mediate activation of the stress-responsive MTK1/MEKK4 MAPKKK. Cell 95: 521–530. [DOI] [PubMed] [Google Scholar]
  68. Terashima, J., and M. A. Bownes, 2005. A microarray analysis of genes involved in relating egg production to nutritional intake in Drosophila melanogaster. Cell Death Differ. 12(5): 429–440. [DOI] [PubMed] [Google Scholar]
  69. Tong, T., J. Ji, S. Jin, X. Li, W. Fan et al., 2005. Gadd45a expression induces Bim dissociation from the cytoskeleton and translocation to mitochondria. Mol. Cell. Biol. 25(11): 4488–4500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Tzou, P., E. De Gregorio and B. Lemaitre, 2002. How Drosophila combats microbial infection: a model to study innate immunity and host–pathogen interactions. Curr. Opin. Microbiol. 5: 102–110. [DOI] [PubMed] [Google Scholar]
  71. Vairapandi, M., A. G. Balliet, B. Hoffman and D. A. Liebermann, 2002. GADD45b and GADD45g Are cdc2/CyclinB1 kinase inhibitors with a role in S and G2/M cell cycle checkpoints induced by genotoxic stress. J. Cell. Physiol. 192: 327–338. [DOI] [PubMed] [Google Scholar]
  72. Van Doren, M., A. L. Williamson and R. Lehmann, 1998. Regulation of zygotic gene expression in Drosophila primordial germ cells. Curr. Biol. 8: 243–246. [DOI] [PubMed] [Google Scholar]
  73. Zhan, Q., M. J. Antinore, X. W. Wang, F. Carrier, M. L. Smith et al., 1999. Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene 18: 2892–2900. [DOI] [PubMed] [Google Scholar]
  74. Zhang, W., B. Hoffman and D. A. Liebermann, 2001. Ectopic expression of MyD118/Gadd45/CR6 (Gadd45beta/alpha/gamma) sensitizes neoplastic cells to genotoxic stress-induced apoptosis. Int. J. Oncol. 18: 749–757. [PubMed] [Google Scholar]

Articles from Genetics are provided here courtesy of Oxford University Press

RESOURCES