Abstract
(1) Objective
The chronic myeloproliferative disorders (MPD), polycythemia vera (PV), essential thrombocytosis (ET) and idiopathic myelofibrosis (IMF), are characterized by a spectrum of clinical features and linked by common genetic lesions in JAK2 and MPL. However, the clinical phenotypes in genetically undefined MPD patients are similar to those patients with JAK2 and MPL lesions. We, therefore, sought to determine whether there were JAK2 or MPL lesions in a well-defined, JAK2 V617F-negative MPD cohort, and to determine if clinical associations could be identified based on variations identified in these genes.
(2) Methods
We examined the JAK2 and MPL genes in JAK2 V617F-negative PV, IMF and idiopathic erythrocytosis (ERT) patients for sequence variations.
(3) Results
We identified two previously unrecognized JAK2 mutations and three previously unrecognized MPL mutations in JAK2 V617F-negative PV, erythrocytosis and IMF patients. We identified JAK2 exon 12 lesions in 30% of JAK2 V617F-negative PV patients, and either JAK2 V617F or JAK2 exon 12 lesions in 9% of ERT patients In IMF, in addition to the MPL gene mutation, W515K, we identified three additional mutations: 204P and 2 intervening sequence transitions: IVS 11/12 and 10/11.
(4) Conclusions
While the clinical phenotype of JAK2 exon 12 lesions in the MPD was predominantly erythroid, there was significant disease spectrum overlap between JAK2 V617F and JAK2 exon 12 mutations. By contrast, MPL gene mutations were not associated with erythrocytosis, but segregated primarily with the phenotypes of thrombocytosis, extramedullary disease, myelofibrosis and osteosclerosis.
Introduction
Polycythemia vera (PV), idiopathic myelofibrosis (IMF) and essential thrombocytosis (ET) are clonal myeloproliferative disorders whose shared features include origin in a multipotent hematopoietic progenitor cell(1), cytogenetic abnormalities of chromosomes 1,8,9,13 and 20(2), growth factor-independent in vitro hematopoietic colony formation(3) and epigenetic abnormalities, such as increased granulocyte PRV-1 mRNA expression(4) and impaired megakaryocyte and platelet thrombopoietin receptor protein (Mpl) expression(5). Taken together, these shared phenotypic and genotypic features suggest that PV, IMF and ET are pathogenetically related. The discovery that the same JAK2 activating mutation (V617F) was common to all three disorders supported this contention(6-9).
However, up to 10% of patients meeting the clinical criteria for PV do not express JAK2 V617F(6). Recently, a few of these patients were found to have mutations in JAK2 exon 12(10) and the majority primarily had an erythrocytosis phenotype in contrast to the panmyelopathy that is characteristic of JAK2 V617F-positive PV patients. Importantly, in a few JAK2 V617F-negative IMF patients, new activating MPL gene mutations have been found(11-13), although the molecular basis of the bulk of these patients remains unknown.
To investigate these issues further, we examined the JAK2 gene in 157 PV patients and 44 erythrocytosis patients and sequenced the MPL gene in 32 JAK2 V617F-negative IMF patients. We report here two previously unrecognized JAK2 exon 12 mutations and 3 unrecognized MPL gene mutations together with an analysis of the corresponding genotype-phenotype correlations.
Methods
The study was approved by our Institutional Review Board, and written informed consent was obtained from all patients. The diagnosis of PV was based on the criteria of the Polycythemia Vera Study Group and included an elevated red cell mass(14). The diagnosis of IMF was based on the Italian Consensus Conference clinical criteria(15). Acquired idiopathic erythrocytosis was defined by the presence of an increased red cell mass and a low or normal serum erythropoietin level in the absence of a definable stimulus. The patients recruited to this study were evaluated in the Johns Hopkins Center for the Chronic Myeloproliferative Disorders; all blood samples were obtained between 2005 and 2007. Clinical data including cell counts, family history and spleen size were extracted from the medical record at the time blood was collected for analysis.
JAK2 sequence analysis
Genomic DNA was prepared from density gradient purified granulocytes using the Puregene Cell kit (Gentra Systems, Minneapolis). Quantitative JAK2 V617F allele percentage was performed as previously described on granulocyte genomic DNA using an allele-specific, quantitative real-time PCR assay sensitive to 10% of either the wild-type or mutant JAK2 allele(16). Exon 12 of the JAK2 gene was amplified with the following primers (Forward: 5′– CTCCTCTTTGGAGCAATTCA -3′; Reverse: 5′– AACATCTAACACAAGGTTGGCATA -3′) using Qiagen Taq PCR Master Mix Kit (Qiagen, Santa Clarita CA) under the following conditions: 35 cycles of denaturation at 94º C for 1 minute, annealing at 58º C for 1 minute and extension at 72º C for 1.5 minutes. PCR products were cloned using the TOPO TA Cloning Kit for Sequencing (Invitrogen, Carlsbad, CA). Mutations identified from abnormal electropherograms from directly sequenced PCR products were verified by cloning and plasmid sequence analysis. Sequence analysis was performed using the fluorescent dideoxy terminator method of cycle sequencing on an Applied Biosystems Division 3700 DNA analyzer.
MPL sequence analysis
MPL genomic DNA was amplified with the primers shown in Table 1 using the conditions described above. PCR products were purified from the reaction mixture using the QIAquick PCR purification kit (Qiagen, Santa Clarita CA) and sequenced as above.
Table 1.
Primer pairs to amplify MPL regions
| Target Exon | Forward (5′ to 3′) | Reverse (5′ to 3′) |
|---|---|---|
| 5′ flank B | AGCCATCTCCAATCTGAGCA | GAGATGAGGAAACGGAGATACA |
| 5′ flan A | CAGCAGATTAGCCTCCCAAG | CATCTTCTCCGCCACTGTGT |
| 1-3 | CTGAAGGGAGGATGGGCTA | GTGACAGGAGGATGGCTCTT |
| 4 | AGTCCAGAGGCTGAGCCATA | AGGTCTGGAATCCCCAAAGT |
| 5-6 | CCACAGAGATGCTGTGCAAAT | TTCTGCAAGATTGTGGCTCA |
| 7-8 | AGGCCATCGTTCTTGTAGGA | TCCCAAAGACAAAGGGAAGA |
| 9-10 | GGATTTGGGTCAAACAGACG | GCGGTATAGTGGGCGTGTTA |
| 11-12 | CCATGGCTCAGTCTGCTTCT | ACTGGGAGTGAGGAGCCTGT |
Statistical Analysis
We used the t-test for continuous variables and the chi-square test for categorical variables as appropriate. P-values less than 0.05 were considered significant. Statistical calculations were performed using SigmaStat.
Results
JAK2 lesions in a JAK2 V617F-negative PV cohort
In a group of 157 subjects fulfilling the diagnostic criteria of PV, 147 (94%) were JAK2 V617F-positive. Table 2 compares the clinical features of the 10 JAK2 V617F-negative PV patients with the 147 JAK2 V617F-positive subjects. There were no significant differences in median age at presentation, disease duration, family history of an MPD, gender, antecedent history of ET, or prevalence of splenomegaly between JAK2 V617F-positive and -negative PV patients. However, in keeping with previous reports(17), both leukocyte and platelet counts were higher in the JAK2 V617F-positive patients, although only the difference in white cell count reached statistical significance in this cohort. We sequenced exon 12 of the JAK2 gene in these 10 JAK2 V617F-negative PV patients and identified two new JAK2 lesions, R541-E543delinsK and H538-K539delinsL (Figure 2), in three of them. Clinical data from these three patients are presented in Table 3A. Erythrocytosis and splenomegaly were the common denominators for clinical phenotype in this small group of patients.
Table 2.
Clinical features of JAK2 V617F-positive and –negative PV patients.
| JAK2 V617F-positive
N= 147 |
JAK2 V617F-negative
N= 10 |
|
|---|---|---|
| % female | 61% | 60% |
| Median age at diagnosis (range) | 49 (18-74) | 50 (18-67) |
| Median disease duration (years, range) | 8 (1-28) | 6 (3-54) |
| Antecedent ET history | 21% | 20% |
| Family MPD history | 8% | 20% |
| Palpable splenomegaly | 43% | 50% |
| White cell count (K/cu mm) | 11.9 (3.6-98.4)* | 8.1 (4.5-20.2)* |
| Platelet count (K/cu mm) | 507 (18-1320)** | 427 (87-682)** |
p <0.001
NS
Figure 2.
MPL sequence variation associated with the chronic myeloproliferative disorders, K39N(25), S505N(26), W515K/L(11;12) as previously described.
Table 3.
Clinical features of patients with JAK2 mutations
| A. Subjects classified as PV | ||||||
|---|---|---|---|---|---|---|
| Patient | JAK2 lesion | Age at diagnosis/Gender | Disease duration (years) | White cell count (K/cu mm) | Platelet count (K/cu mm) | Palpable splenomegaly |
|
| ||||||
| PV1 | R541-E543delinsK | 61/M | 1 | 6.7 | 579 | 1 cm |
| PV2 | R541-E543delinsK | 50/F | 5 | 7.8 | 303 | 2 cm |
| PV3 | H538-K539delinsL | 18/M | 54 | 11.0 | 60 | massive |
|
| ||||||
| B. Subjects classified as idiopathic erythrocytosis | ||||||
| Patient | JAK2 lesion | Age at diagnosis/Gender | Disease duration (years) | White cell count (K/cu mm) | Platelet count (K/cu mm) | Palpable splenomegaly |
|
| ||||||
| ERT1 | N542-E543del | 54/F | 15 | 8.5 | 257 | none |
| ERT2 | R541-E543delinsK | 15/M | 1 | 5.8 | 291 | none |
| ERT3 | JAK2 V617F | 41/F | 1 | 5.7 | 227 | none |
| ERT4 | JAK2 V617F | 82/F | 10 | 6.9 | 111 | none |
JAK2 lesions in an idiopathic erythrocytosis cohort
Since the phenotype of the patients with JAK2 exon 12 lesions in this JAK2 V617F-negative PV cohort and those previously described(10) appeared to be primarily erythrocytosis, we screened 44 subjects with idiopathic erythrocytosis for both JAK2 V617F and JAK2 exon 12 lesions. We found 4 subjects harboring JAK2 mutations: 2 with JAK2 V617F (quantitative JAK2 V617F allele percentages of 34 and 59%), one with JAK2 N542-E543del and one with JAK2 R541-E543delinsK. Clinical data from these three patients are presented in Table 3B. None had any hematological abnormality except erythrocytosis.
Given the small numbers of patients identified with JAK2 exon 12 lesions, we pooled all reported patient clinical data from JAK2 exon 12 lesion subjects(10) with the clinical data from this cohort for comparison with JAK2-lesion negative erythrocytosis patients (ERT) (Table 4A) or JAK2 V617F-positive PV or erythrocytosis patients (Table 4B). Aside from a female predominance in the JAK2 lesion-positive erythrocytosis group, there were no significant differences in platelet count, white cell count, splenomegaly prevalence or age at diagnosis in the JAK2 exon 12 lesion-positive subjects from the combined cohort compared with the 40 JAK2 lesion-negative erythrocytosis patients (Table 4A). We then compared the clinical features of all the reported JAK2 exon 12 lesion patients, whether classified as PV or erythrocytosis, to all of our JAK2 V617F-positive PV or erythrocytosis patients, and found that the JAK2 V617F-positive subjects had significantly higher white cell and platelet counts compared to the JAK2 exon 12-positive subjects (Table 4B).
Table 4.
Clinical features of patients with erythrocytosis
| A. Subjects classified as idiopathic erythrocytosis | ||
|---|---|---|
| JAK2 lesion-negative ERT
N= 40 |
JAK2 lesion-positive ERT
N= 8* |
|
|
| ||
| % female | 35% | 75% |
| Median age at diagnosis (range) | 49 (18-74) | 41(15-82) |
| Palpable splenomegaly | 0% | 0% |
| White cell count (K/cu mm) | 6.9 (4.2-14.7) | 6.4 (5.1-8.6) |
| Platelet count (K/cu mm) | 227 (109-753) | 285 (111-308) |
|
| ||
| B. Subjects with erythrocytosis and a JAK2 lesion | ||
| JAK2 V617F-positive PV or ERT
N= 149 |
JAK2 exon12 lesions PV or ERT
N= 15* |
|
|
| ||
| % female | 61% | 53% |
| Median age at diagnosis (range) | 49 (18-74) | 50 (15-62) |
| Palpable splenomegaly | 43% | 40% |
| White cell count (K/cu mm) | 11.9 (3.6-98.4)§ | 7.8 (6.7-12.1)§ |
| Platelet count (K/cu mm) | 507 (18-1320)# | 298 (60-579) # |
Clinical phenotype in a JAK2 V617F-negative IMF cohort
In a group of 32 subjects fulfilling the diagnostic criteria of IMF, 15 (47%) were JAK2 V617F-positive. Table 5 compares the clinical features of the 17 JAK2 V617F-negative IMF patients to the 15 JAK2 V617F-positive IMF patients. There were no significant differences in median age at presentation, disease duration, family history of an MPD, gender or prevalence of splenomegaly between JAK2 V617F-positive and -negative IMF patients. In both groups there was a male predominance, and there was a higher incidence of antecedent ET in the JAK2 V617F-negative group, and a significantly higher white cell count in the JAK2 V617F-positive group (p = 0.010).
Table 5.
Clinical features of JAK2 V617F-positive and –negative IMF patients.
| JAK2 V617F-positive
N= 15 |
JAK2 V617F-negative
N= 17 |
|
|---|---|---|
| % male | 60% | 71% |
| Median age at diagnosis (range) | 59 (38-74) | 56 (26-71) |
| Median disease duration (years, range) | 8 (0-20) | 5 (1-28) |
| Antecedent ET history | 20% | 41% |
| Family MPD history | 8% | 0% |
| Palpable splenomegaly | 100% | 94% |
| White cell count (K/cu mm) | 15.3 (4.17-93.2)* | 7.4 (1.7-51.9)* |
| Hemoglobin (g/dl) | 11.7 (6.9-14.0) | 10.2 (6.8-13.2) |
| Platelet count (K/cu mm) | 198 (167-402)** | 260 (3-1074)** |
p = 0.010
NS
MPL sequence variation in a JAK2 V617F-negative IMF cohort
We sequenced all the exons, the flanking intervening sequences and the 5′-proximal untranslated region of the MPL gene in the 17 JAK2 V617F-negative IMF patients presented in Table 5. In one IMF patient, we identified a two base substitution (TG11534-5AA; Genbank accession number GI:89161185) in exon 10 the MPL gene which results in a tryptophan to lysine substitution at amino acid 515 (W515K); the wild-type sequence was not identified from either peripheral blood CD34+ cells or neutrophils isolated from this patient. In a second IMF patient, we identified a nucleotide transition (T1686C), which results in a serine to proline substitution at amino acid 240 (S204P). In two other IMF patients, we identified heterozygous nucleotide transitions in intervening sequences of the splice recognition sites of exons 10 (C11561T) and 11 (G14503A); these transitions were not identified in the public SNP databases. We directly sequenced exon 4, exon 10 and the intervening sequences of exon 10 and 11 in an additional 13 JAK2V617F-positive IMF patients and in 9 of the 10 JAK2 V617F-negative PV patients listed in Table 2; no other sequence variation was identified. Clinical data from the four IMF patients with MPL sequence variation identified is presented in Table 6 and locations of MPL sequence variation in the MPD are presented in Figure 2. Although patient numbers are small, no distinct clinical differences were characterized the JAK2 V617f-negative patients with MPL gene mutations.
Table 6.
Clinical features of IMF patients with MPL sequence variation
| Patient | MPL lesion | Age at diagnosis/Gender | Disease duration (years) | White cell count (K/cu mm) | Hemoglobin (g/dl) | Platelet count (K/cu mm) | Bone marrow | Palpable splenomegaly |
|---|---|---|---|---|---|---|---|---|
| IMF1 | W515K | 26/M | 23 | 8.6* | 12.1 | 209 | osteosclerosis | Massive |
| IMF2 | S204P | 42/M | 1 | 11.1* | 12.8 | 368 | osteosclerosis | Moderate |
| IMF3 | IVS 11/12 | 71/F | 3 | 51.9* | 8.8 | 24 | osteosclerosis | Massive |
| IMF4 | IVS 10/11 | 35/M | 31 | 2.8* | 6.8 | 47 | osteosclerosis | Massive |
White cell differential left-shifted to the myelocyte stage
Discussion
The World Health Organization (WHO) currently classifies PV, IMF and ET together with chronic myelogenous leukemia, chronic eosinophilic leukemia, chronic neutrophilic leukemia, the hypereosinophilic syndrome and unclassifiable chronic myeloproliferative disease under the rubric of the chronic myeloproliferative disorders(18). However, PV, IMF and ET have more in common phenotypically with each other than with these other disorders and this was confirmed genotypically by the discovery of the JAK2 V617F mutation(6), the expression of which is largely confined to PV, IMF and ET (19).
Extensive studies of JAK2 V617F have indicated that its frequency within PV, IMF and ET is variable, being most common in PV. The relationship of JAK2 V617F and erythrocytosis, the defining feature of PV, is supported by the observation of heightened erythropoietin sensitivity of homozygous V617F clones compared to heterozygous V617F clones(20), by higher hemoglobin concentrations in JAK2 V617F positive compared to JAK2 V617F-negative ET patients(21), by mouse gene transfection experiments(8) and more recently by the identification of JAK2 exon 12 lesions, which associate primarily with an erythrocytosis phenotype in both man and the mouse(10).
The data presented here and more extensive studies of MPL 515K/L mutations(12;13) place patients with the JAK2 exon12, and MPL 515K/L/S204P lesions together with JAK2 V617F in the spectrum of the chronic myeloproliferative disorders. While some patients with JAK2 V617F and JAK2 exon 12 lesions are clinically similar, on average the JAK2 exon 12 patients have significantly lower white cell and platelet counts than JAK2 V617F patients. In addition, JAK2 V617F, but not JAK2 exon 12 mutations, are associated with either thrombocytosis or myelofibrosis phenotypes that are clinically indistinguishable from those associated with MPL515K/L. To date, JAK2 exon 12 lesions do not appear to associate with the ET phenotype, and in only rare, longstanding cases (patient PV3, Table 3A), do they associate with significant extramedullary disease. Thus, although the number of patients currently identified with these mutations is small, so far the phenotypes generated by MPL and JAK2 exon 12 lesions do not appear to intersect, while JAK2 V617F, MPL gene mutations and Mpl epigenetic lesions do (Figure 3). When possible, a meta-analysis of larger groups of patients with JAK2 and MPL mutant alleles will be instrumental in further defining the associated clinical phenotypes.
Figure 3.
Spectrum of MPD phenotypes associated with JAK2 and MPL lesions
We propose that the phenotypic variability associated with JAK2 V617F, extending from erythrocytosis alone as described here and previously(22) to idiopathic myelofibrosis, can be explained to some extent by variable JAK2 V617F allele burdens in MPD patients(16;23;24). The JAK2 V617F allele burden alone, however, cannot entirely account for the overlap of phenotypes associated with JAK2 V617F. Beyond the JAK2 V617F clonal burden, the data suggest that other genetic or epigenetic changes in MPL and other genes are probably important modifiers of JAK2 V617F-associated disease, and MPD generating in and of themselves.
Figure 1.
Somatic mutations of JAK2 exon 12 identified in JAK2 V617F-negative PV and idiopathic erythrocytosis patients. Unique mutations identified from this cohort are indicated by the asterisks. Mutations not described in this study are from Scott et al(10).
Acknowledgments
We thank Linda M. Scott, Ph.D. (Cambridge, U. K.) for sharing data on JAK2 exon 12 mutations. This work was supported by NIH research grants NHLBI RO1- HL082995 and NCI P01CA108671, a Department of Defense grant, MPO48019, and the Myeloproliferative Disorders Foundation.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Reference List
- 1.Adamson JW, Fialkow PJ, Murphy S, Prchal JF, Steinmann L. Polycythemia vera: stem-cell and probable clonal origin of the disease. N Engl J Med. 1976 October 21;295(17):913–6. doi: 10.1056/NEJM197610212951702. [DOI] [PubMed] [Google Scholar]
- 2.Najfeld V, Montella L, Scalise A, Fruchtman S. Exploring polycythaemia vera with fluorescence in situ hybridization: additional cryptic 9p is the most frequent abnormality detected. Br J Haematol. 2002 November;119(2):558–66. doi: 10.1046/j.1365-2141.2002.03763.x. [DOI] [PubMed] [Google Scholar]
- 3.Prchal JF, Axelrad AA. Letter: Bone-marrow responses in polycythemia vera. N Engl J Med. 1974 June 13;290(24):1382. doi: 10.1056/nejm197406132902419. [DOI] [PubMed] [Google Scholar]
- 4.Temerinac S, Klippel S, Strunck E, Roder S, Lubbert M, Lange W, Azemar M, Meinhardt G, Schaefer HE, Pahl HL. Cloning of PRV-1, a novel member of the uPAR receptor superfamily, which is overexpressed in polycythemia rubra vera. Blood. 2000 April 15;95(8):2569–76. [PubMed] [Google Scholar]
- 5.Moliterno AR, Hankins WD, Spivak JL. Impaired expression of the thrombopoietin receptor by platelets from patients with polycythemia vera. N Engl J Med. 1998 February 26;338(9):572–80. doi: 10.1056/NEJM199802263380903. [DOI] [PubMed] [Google Scholar]
- 6.Baxter EJ, Scott LM, Campbell PJ, East C, Fourouclas N, Swanton S, Vassiliou GS, Bench AJ, Boyd EM, Curtin N, Scott MA, Erber WN, Green AR. Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative disorders. Lancet. 2005 March 19;365(9464):1054–61. doi: 10.1016/S0140-6736(05)71142-9. [DOI] [PubMed] [Google Scholar]
- 7.Levine RL, Wadleigh M, Cools J, Ebert BL, Wernig G, Huntly BJ, Boggon TJ, Wlodarska I, Clark JJ, Moore S, Adelsperger J, Koo S, Lee JC, Gabriel S, Mercher T, D'Andrea A, Frohling S, Dohner K, Marynen P, Vandenberghe P, Mesa RA, Tefferi A, Griffin JD, Eck MJ, Sellers WR, et al. Activating mutation in the tyrosine kinase JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis. Cancer Cell. 2005 April;7(4):387–97. doi: 10.1016/j.ccr.2005.03.023. [DOI] [PubMed] [Google Scholar]
- 8.James C, Ugo V, Le Couedic JP, Staerk J, Delhommeau F, Lacout C, Garcon L, Raslova H, Berger R, naceur-Griscelli A, Villeval JL, Constantinescu SN, Casadevall N, Vainchenker W. A unique clonal JAK2 mutation leading to constitutive signalling causes polycythaemia vera. Nature. 2005 April 28;434(7037):1144–8. doi: 10.1038/nature03546. [DOI] [PubMed] [Google Scholar]
- 9.Kralovics R, Passamonti F, Buser AS, Teo SS, Tiedt R, Passweg JR, Tichelli A, Cazzola M, Skoda RC. A gain-of-function mutation of JAK2 in myeloproliferative disorders. N Engl J Med. 2005 April 28;352(17):1779–90. doi: 10.1056/NEJMoa051113. [DOI] [PubMed] [Google Scholar]
- 10.Scott LM, Tong W, Levine RL, Scott MA, Beer PA, Stratton MR, Futreal PA, Erber WN, McMullin MF, Harrison CN, Warren AJ, Gilliland DG, Lodish HF, Green AR. JAK2 exon 12 mutations in polycythemia vera and idiopathic erythrocytosis. N Engl J Med. 2007 February 1;356(5):459–68. doi: 10.1056/NEJMoa065202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Pikman Y, Lee BH, Mercher T, McDowell E, Ebert BL, Gozo M, Cuker A, Wernig G, Moore S, Galinsky I, DeAngelo DJ, Clark JJ, Lee SJ, Golub TR, Wadleigh M, Gilliland DG, Levine RL. MPLW515L is a novel somatic activating mutation in myelofibrosis with myeloid metaplasia. PLoS Med. 2006 July;3(7):e270. doi: 10.1371/journal.pmed.0030270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Pardanani AD, Levine RL, Lasho T, Pikman Y, Mesa RA, Wadleigh M, Steensma DP, Elliott MA, Wolanskyj AP, Hogan WJ, McClure RF, Litzow MR, Gilliland DG, Tefferi A. MPL515 mutations in myeloproliferative and other myeloid disorders: a study of 1182 patients. Blood. 2006 November 15;108(10):3472–6. doi: 10.1182/blood-2006-04-018879. [DOI] [PubMed] [Google Scholar]
- 13.Guglielmelli P, Pancrazzi A, Bergamaschi G, Rosti V, Villani L, Antonioli E, Bosi A, Barosi G, Vannucchi AM. Anaemia characterises patients with myelofibrosis harbouring Mpl mutation. Br J Haematol. 2007 May;137(3):244–7. doi: 10.1111/j.1365-2141.2007.06565.x. [DOI] [PubMed] [Google Scholar]
- 14.Berk PD, Goldberg JD, Donovan PB, Fruchtman SM, Berlin NI, Wasserman LR. Therapeutic recommendations in polycythemia vera based on Polycythemia Vera Study Group protocols. Semin Hematol. 1986 April;23(2):132–43. [PubMed] [Google Scholar]
- 15.Barosi G. Myelofibrosis with myeloid metaplasia: diagnostic definition and prognostic classification for clinical studies and treatment guidelines. J Clin Oncol. 1999 September;17(9):2954–70. doi: 10.1200/JCO.1999.17.9.2954. [DOI] [PubMed] [Google Scholar]
- 16.Moliterno AR, Williams DM, Rogers O, Spivak JL. Molecular mimicry in the chronic myeloproliferative disorders: reciprocity between quantitative JAK2 V617F and Mpl expression. Blood. 2006 December 1;108(12):3913–5. doi: 10.1182/blood-2006-03-008805. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Tefferi A, Lasho TL, Schwager SM, Strand JS, Elliott M, Mesa R, Li CY, Wadleigh M, Lee SJ, Gilliland DG. The clinical phenotype of wild-type, heterozygous, and homozygous JAK2V617F in polycythemia vera. Cancer. 2006 February 1;106(3):631–5. doi: 10.1002/cncr.21645. [DOI] [PubMed] [Google Scholar]
- 18.Vardiman JW, Harris NL, Brunning RD. The World Health Organization (WHO) classification of the myeloid neoplasms. Blood. 2002 October 1;100(7):2292–302. doi: 10.1182/blood-2002-04-1199. [DOI] [PubMed] [Google Scholar]
- 19.Jones AV, Kreil S, Zoi K, Waghorn K, Curtis C, Zhang L, Score J, Seear R, Chase AJ, Grand FH, White H, Zoi C, Loukopoulos D, Terpos E, Vervessou EC, Schultheis B, Emig M, Ernst T, Lengfelder E, Hehlmann R, Hochhaus A, Oscier D, Silver RT, Reiter A, Cross NC. Widespread occurrence of the JAK2 V617F mutation in chronic myeloproliferative disorders. Blood. 2005 September 15;106(6):2162–8. doi: 10.1182/blood-2005-03-1320. [DOI] [PubMed] [Google Scholar]
- 20.Dupont S, Masse A, James C, Teyssandier I, Lecluse Y, Larbret F, Ugo V, Saulnier P, Koscielny S, Le Couedic JP, Casadevall N, Vainchenker W, Delhommeau F. The JAK2 V617F mutation triggers erythropoietin hypersensitivity and terminal erythroid amplification in primary cells from patients with polycythemia vera. Blood. 2007 March 27; doi: 10.1182/blood-2006-10-054940. [DOI] [PubMed] [Google Scholar]
- 21.Campbell PJ, Scott LM, Buck G, Wheatley K, East CL, Marsden JT, Duffy A, Boyd EM, Bench AJ, Scott MA, Vassiliou GS, Milligan DW, Smith SR, Erber WN, Bareford D, Wilkins BS, Reilly JT, Harrison CN, Green AR. Definition of subtypes of essential thrombocythaemia and relation to polycythaemia vera based on JAK2 V617F mutation status: a prospective study. Lancet. 2005 December 3;366(9501):1945–53. doi: 10.1016/S0140-6736(05)67785-9. [DOI] [PubMed] [Google Scholar]
- 22.Percy MJ, Jones FG, Green AR, Reilly JT, McMullin MF. The incidence of the JAK2 V617F mutation in patients with idiopathic erythrocytosis. Haematologica. 2006 March;91(3):413–4. [PubMed] [Google Scholar]
- 23.Passamonti F, Vanelli L, Malabarba L, Rumi E, Pungolino E, Malcovati L, Pascutto C, Morra E, Lazzarino M, Cazzola M. Clinical utility of the absolute number of circulating CD34-positive cells in patients with chronic myeloproliferative disorders. Haematologica. 2003 October;88(10):1123–9. [PubMed] [Google Scholar]
- 24.Vannucchi AM, Antonioli E, Guglielmelli P, Rambaldi A, Barosi G, Marchioli R, Marfisi RM, Finazzi G, Guerini V, Fabris F, Randi ML, De S V, Caberlon S, Tafuri A, Ruggeri M, Specchia G, Liso V, Rossi E, Pogliani E, Gugliotta L, Bosi A, Barbui T. Clinical profile of homozygous JAK2V617F mutation in patients with polycythemia vera or essential thrombocythemia. Blood. 2007 March 22; doi: 10.1182/blood-2006-12-064287. [DOI] [PubMed] [Google Scholar]
- 25.Moliterno AR, Williams DM, Gutierrez-Alamillo LI, Salvatori R, Ingersoll RG, Spivak JL. Mpl Baltimore: A Thrombopoietin Receptor Polymorphism Associated with Thrombocytosis. Proc Natl Acad Sci U S A. 2004 doi: 10.1073/pnas.0404241101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ding J, Komatsu H, Wakita A, Kato-Uranishi M, Ito M, Satoh A, Tsuboi K, Nitta M, Miyazaki H, Iida S, Ueda R. Familial essential thrombocythemia associated with a dominant-positive activating mutation of the c-MPL gene, which encodes for the receptor for thrombopoietin. Blood. 2004 June 1;103(11):4198–200. doi: 10.1182/blood-2003-10-3471. [DOI] [PubMed] [Google Scholar]