Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 1983 Oct;156(1):327–337. doi: 10.1128/jb.156.1.327-337.1983

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

H Yamazaki, K Ohmura, A Nakayama, Y Takeichi, K Otozai, M Yamasaki, G Tamura, K Yamane
PMCID: PMC215086  PMID: 6413492

Abstract

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.

Full text

PDF
327

Images in this article

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Blobel G., Dobberstein B. Transfer of proteins across membranes. I. Presence of proteolytically processed and unprocessed nascent immunoglobulin light chains on membrane-bound ribosomes of murine myeloma. J Cell Biol. 1975 Dec;67(3):835–851. doi: 10.1083/jcb.67.3.835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Chang S., Cohen S. N. High frequency transformation of Bacillus subtilis protoplasts by plasmid DNA. Mol Gen Genet. 1979 Jan 5;168(1):111–115. doi: 10.1007/BF00267940. [DOI] [PubMed] [Google Scholar]
  3. Kawamura F., Saito H., Ikeda Y. A method for construction of specialized transducing phage rho 11 of Bacillus subtilis. Gene. 1979 Feb;5(2):87–91. doi: 10.1016/0378-1119(79)90095-7. [DOI] [PubMed] [Google Scholar]
  4. Kreil G. Transfer of proteins across membranes. Annu Rev Biochem. 1981;50:317–348. doi: 10.1146/annurev.bi.50.070181.001533. [DOI] [PubMed] [Google Scholar]
  5. Maxam A. M., Gilbert W. Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 1980;65(1):499–560. doi: 10.1016/s0076-6879(80)65059-9. [DOI] [PubMed] [Google Scholar]
  6. McLaughlin J. R., Murray C. L., Rabinowitz J. C. Unique features in the ribosome binding site sequence of the gram-positive Staphylococcus aureus beta-lactamase gene. J Biol Chem. 1981 Nov 10;256(21):11283–11291. [PubMed] [Google Scholar]
  7. Moran C. P., Jr, Lang N., LeGrice S. F., Lee G., Stephens M., Sonenshein A. L., Pero J., Losick R. Nucleotide sequences that signal the initiation of transcription and translation in Bacillus subtilis. Mol Gen Genet. 1982;186(3):339–346. doi: 10.1007/BF00729452. [DOI] [PubMed] [Google Scholar]
  8. Mäntsälä P., Zalkin H. Membrane-bound and soluble extracellular alpha-amylase from Bacillus subtilis. J Biol Chem. 1979 Sep 10;254(17):8540–8547. [PubMed] [Google Scholar]
  9. Neugebauer K., Sprengel R., Schaller H. Penicillinase from Bacillus licheniformis: nucleotide sequence of the gene and implications for the biosynthesis of a secretory protein in a Gram-positive bacterium. Nucleic Acids Res. 1981 Jun 11;9(11):2577–2588. doi: 10.1093/nar/9.11.2577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Nielsen J. B., Lampen J. O. Membrane-bound penicillinases in Gram-positive bacteria. J Biol Chem. 1982 Apr 25;257(8):4490–4495. [PubMed] [Google Scholar]
  11. Nomura S., Yamane K., Sasaki T., Yamasaki M., Tamura G., Maruo B. Tunicamycin-resistant mutants and chromosomal locations of mutational sites in Bacillus subtilis. J Bacteriol. 1978 Nov;136(2):818–821. doi: 10.1128/jb.136.2.818-821.1978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Ohmura K., Yamazaki H., Takeichi Y., Nakayama A., Otozai K., Yamane K., Yamasaki M., Tamura G. Nucleotide sequence of the promoter and NH2-terminal signal peptide region of Bacillus subtilis alpha-amylase gene cloned in pUB110. Biochem Biophys Res Commun. 1983 Apr 29;112(2):678–683. doi: 10.1016/0006-291x(83)91516-4. [DOI] [PubMed] [Google Scholar]
  13. Palva I., Pettersson R. F., Kalkkinen N., Lehtovaara P., Sarvas M., Söderlund H., Takkinen K., Käriäinen L. Nucleotide sequence of the promoter and NH2-terminal signal peptide region of the alpha-amylase gene from Bacillus amyloliquefaciens. Gene. 1981 Oct;15(1):43–51. doi: 10.1016/0378-1119(81)90103-7. [DOI] [PubMed] [Google Scholar]
  14. Sutcliffe J. G. Complete nucleotide sequence of the Escherichia coli plasmid pBR322. Cold Spring Harb Symp Quant Biol. 1979;43(Pt 1):77–90. doi: 10.1101/sqb.1979.043.01.013. [DOI] [PubMed] [Google Scholar]
  15. Szybalski E. H., Szybalski W. A comprehensive molecular map of bacteriophage lambda. Gene. 1979 Nov;7(3-4):217–270. doi: 10.1016/0378-1119(79)90047-7. [DOI] [PubMed] [Google Scholar]
  16. Tabak H. F., Flavell R. A. A method for the recovery of DNA from agarose gels. Nucleic Acids Res. 1978 Jul;5(7):2321–2332. doi: 10.1093/nar/5.7.2321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Takkinen K., Pettersson R. F., Kalkkinen N., Palva I., Söderlund H., Käriäinen L. Amino acid sequence of alpha-amylase from Bacillus amyloliquefaciens deduced from the nucleotide sequence of the cloned gene. J Biol Chem. 1983 Jan 25;258(2):1007–1013. [PubMed] [Google Scholar]
  18. Wilson G. A., Bott K. F. Nutritional factors influencing the development of competence in the Bacillus subtilis transformation system. J Bacteriol. 1968 Apr;95(4):1439–1449. doi: 10.1128/jb.95.4.1439-1449.1968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Yang M., Galizzi A., Henner D. Nucleotide sequence of the amylase gene from Bacillus subtilis. Nucleic Acids Res. 1983 Jan 25;11(2):237–249. doi: 10.1093/nar/11.2.237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Yoneda Y., Yamane K., Maruo B. Membrane mutation related to the production of extracellular -amylase and protease in bacillus subtilis. Biochem Biophys Res Commun. 1973 Feb 5;50(3):765–770. doi: 10.1016/0006-291x(73)91310-7. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES