Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2007 Oct 19;73(24):7826–7836. doi: 10.1128/AEM.01586-07

CpxRA Regulates Mutualism and Pathogenesis in Xenorhabdus nematophila▿

Erin E Herbert 1, Kimberly N Cowles 1,†, Heidi Goodrich-Blair 1,*
PMCID: PMC2168154  PMID: 17951441

Abstract

The CpxRA signal transduction system, which in Escherichia coli regulates surface structure assembly and envelope maintenance, is involved in the pathogenic and mutualistic interactions of the entomopathogenic bacterium Xenorhabdus nematophila. When ΔcpxR1 cells were injected into Manduca sexta insects, the time required to kill 50% of the insects was twofold longer than the time observed for wild-type cells and the ΔcpxR1 cells ultimately killed 16% fewer insects than wild-type cells killed. During mutualistic colonization of Steinernema carpocapsae nematodes, the ΔcpxR1 mutant achieved colonization levels that were only 38% of the wild-type levels. ΔcpxR1 cells exhibited an extended lag phase when they were grown in liquid LB or hemolymph, formed irregular colonies on solid medium, and had a filamentous cell morphology. A mutant with a cpxRp-lacZ fusion had peaks of expression in the log and stationary phases that were conversely influenced by CpxR; the ΔcpxR1 mutant produced 130 and 17% of the wild-type β-galactosidase activity in the log and stationary phases, respectively. CpxR positively influences motility and secreted lipase activity, as well as transcription of genes necessary for mutualistic colonization of nematodes. CpxR negatively influences the production of secreted hemolysin, protease, and antibiotic activities, as well as the expression of mrxA, encoding the pilin subunit. Thus, X. nematophila CpxRA controls expression of envelope-localized and secreted products, and its activity is necessary for both mutualistic and pathogenic functions.


The gram-negative bacterium Xenorhabdus nematophila is both a mutualistic symbiont of the soil-dwelling nematode Steinernema carpocapsae and a pathogen of diverse insects (25-27). Inside its nematode host, X. nematophila colonizes and grows within a receptacle located proximal to the intestine (6, 44). A colonized nematode vectors X. nematophila into an insect, where X. nematophila and S. carpocapsae dissociate and cause disease and death of the insect host (26, 70). Reassociation of X. nematophila and S. carpocapsae occurs in response to an unknown signal, presumably depletion of nutrients or space inside the dead insect (60). After reassociation, colonized nematodes emerge from the carcass in search of new insects, continuing the life cycle. Thus, during its natural life cycle, X. nematophila oscillates between pathogenic and mutualistic behaviors. Functions necessary for each of these behaviors, as well as the transition between them, are likely subject to tight and coordinated control.

Several regulators necessary for X. nematophila-host interactions have been identified, including the stationary-phase sigma factor RpoS, which is essential for X. nematophila mutualistic colonization of S. carpocapsae nematodes (34, 77), and LrhA, a member of the LysR family of transcriptional regulators, which is necessary for full virulence in Manduca sexta insects (G. Richards, E. Herbert, and H. Goodrich-Blair, unpublished data). LrhA positively regulates flagella, motility, and secreted lipase activity through FlhDC (30, 55), the transcription factor controlling flagellar synthesis (47), which also has a demonstrated role in insect virulence (30). In addition to regulating flagellar motility and secreted lipase activity encoded by xlpA (55), FlhDC regulates a number of potential virulence effectors, including the secreted and cell-associated hemolysins encoded by xaxAB and xhlA, respectively (13, 74).

Currently, only one regulator, Lrp (the leucine responsive regulatory protein), is known to be necessary for both the pathogenic and mutualistic interactions of X. nematophila (12). An lrp mutant has attenuated virulence for M. sexta insects and does not support the development of S. carpocapae nematodes or colonize the infective stage as well as the wild type. Lrp is a global regulator with pleiotropic effects. It positively regulates multiple X. nematophila hemolysins, including those encoded by xaxAB and xhlA, and negatively regulates the nematode colonization genes nilA, nilB, and nilC (10, 12, 13).

One proposed role of X. nematophila Lrp in host interactions is coordinating adaptation to fluctuating nutrient availability, and as such, Lrp would serve as a sensor of intracellular metabolic status (12, 33). Sensing and responding to changes in the external environment are also expected to be important in successful host-microbe interactions. One signaling pathway that may serve as an external sensor and subsequent regulator of host interactions is the CpxRA two-component system (64). In Escherichia coli, this system is involved in maintenance of the bacterial envelope (15, 16, 39, 48, 59) and surface structures, such as pili (37), which can facilitate interactions with a host (69).

The Cpx system of E. coli consists of three proteins, CpxA, CpxR, and CpxP (64). The sensor histidine kinase, CpxA, can function as an autokinase, a CpxR kinase, or a CpxR phosphatase (64) depending on the growth conditions. Kinase activity is triggered in response to aggregated and misfolded proteins in the cell envelope (20) and changes in the external environment; it is activated by adhesion to abiotic surfaces (54) and by external changes in pH (50, 52), osmolarity (40, 42), and certain metals (79).

Upon recognition of the signal, CpxA phosphorylates CpxR, activating this response regulator by relieving N-terminal inhibition of the C-terminal DNA binding region of the protein (73). Relief of CpxR inhibition may increase CpxR binding affinity for specific DNA sequences found upstream of genes activated by CpxR (59, 63, 64). CpxP, a periplasmic inhibitor of CpxRA (62) and a CpxR regulon member (14), is the third component of the Cpx system.

The E. coli Cpx regulon is predicted to contain more than 100 members based on genome-wide screens for genes downstream of a putative CpxR binding sequence (19). In E. coli and other organisms, members of the Cpx regulon function in protein folding and degradation (15, 17, 59, 66), motility and chemotaxis (18), biofilm formation (21), adherence and invasion of host cells (36, 42), pilus formation (37), and type III secretion (49). Furthermore, the Cpx system regulates genes required for virulence in Legionella pneumophila (22, 28, 75), Shigella sonnei (51, 52), Yersinia enterocolitica (35), Salmonella enterica serovar Typhimurium (36), and S. enterica serovar Typhi (42). In this study, we examined the role of CpxR in the physiology and host interactions of X. nematophila.

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions.

Table 1 lists strains and plasmids used in this study. Cultures were grown in LB broth at 30°C. For growth of X. nematophila plates were supplemented with 0.1% pyruvate and liquid media were kept in the dark (78). Where appropriate, the following antibiotic concentrations were used: ampicillin, 150 μg ml−1; chloramphenicol, 30 μg ml−1; erythromycin, 200 μg ml−1; and streptomycin, 25 μg ml−1 for E. coli and 12.5 μg ml−1 for X. nematophila. For conjugation E. coli donor strains S17-1(λpir) and SM10 (for Strr plasmids) were used as described previously (4, 77).

TABLE 1.

Strains and plasmids used in this study

Strain or plasmid Description Reference or source
X. nematophila strains
    HGB800 X. nematophila ATCC 19061, wild type American Type Culture Collection
    HGB1227 HGB800 (Tn7) This study
    HGB1228 HGB800 (Tn7/cpxRA) This study
    HGB1230 HGB800 ΔcpxR1 This study
    HGB1231 HGB800 ΔcpxR1 (Tn7) This study
    HGB1232 HGB800 ΔcpxR1 (Tn7/cpxRA) This study
    HGB1236 HGB800 (Tn7/cpxRp-lacZ) This study
    HGB1237 HGB800 ΔcpxR1 (Tn7/cpxRp-lacZ) This study
    HGB1117 HGB800 (Tn7/nilA-lacZ) 11
    HGB1121 HGB800 (Tn7/nilAB-lacZ) 11
    HGB1101 HGB800 (Tn7/nilC-lacZ) 10
    HGB1239 HGB800 ΔcpxR1 (Tn7/nilA-lacZ) This study
    HGB1240 HGB800 ΔcpxR1 (Tn7/nilAB-lacZ) This study
    HGB1241 HGB800 ΔcpxR1 (Tn7/nilC-lacZ) This study
E. coli strains
    S17-1(λpir) Donor strain for conjugations 72
    SM10 Donor strain for conjugations of Strr plasmids 72
Plasmids
    pCR2.1-TOPO Cloning vector, Ampr Kanr Invitrogen (Carlsbad, CA)
    pKR100 oriR6K, mobRP4 suicide vector, Cmr K. Visick, Loyola University
    pKJN102 Source of aad (Strr) gene K. Cowles, University of Wisconsin—Madison
    pKRcpxRup pKR100 plus 1,058-bp cpxR 5′ flanking region This study
    pKRcpxRupStr pKRcpxRup plus aad (Strr) gene This study
    pKRcpxRStr pKRcpxRupStr plus 1,288-bp cpxR 3′ flanking region This study
    pEVS107 Tn7 transposon delivery vector, oriR6K, mobRP4, Ermr Kanr 46
    pEVSCm Derivative of pEVS107; Tn7 transposon vector, Ermr Cmr E. Martens, University of Wisconsin—Madison
    pEVSCmKan Derivative of pEVS107; Tn7 transposon vector, Cmr Kanr E. Martens, University of Wisconsin—Madison
    pUX-BF13 Triparental mating helper plasmid expressing Tn7 transposase, Ampr 4
    pTn7/nilA-lacZ pEVS107 plus nilA 5′ flanking region fused to lacZ, Ermr Kanr 11
    pTn7/nilAB-lacZ pEVS107 plus nilB 5′ flanking region fused to lacZ, Ermr Kanr 11
    pTn7/nilC-lacZ pEVS107 plus nilC 5′ flanking region fused to lacZ, Ermr Kanr 10
    pTOPOcpxRAcomp pCR2.1-TOPO plus cpxRA, including 152 bp of 5′ region This study
    pTn7cpxRAcomp pEVSCm plus cpxRA and 152 bp of cpxRA 5′ region This study
    pKV124 Source of promoterless lacZ for mini-Tn7 fusions, Cmr 76
    pTOPOcpxRp pCR2.1-TOPO plus 152 bp of cpxR 5′ flanking region This study
    pKVTOPOcpxRp pKV124 fused to pTOPOcpxRp, placing ′lacZ downstream of cpxRp This study
    pTn7/cpxRp-lacZ pEVSCmKan plus cpxRp-lacZ fragment This study

Molecular biological methods.

Standard molecular biological methods were used in this study (68). Restriction enzymes (Promega, Madison, WI) and plasmid purification, gel extraction, and PCR purification kits (Qiagen, Valencia, CA) were used according to the manufacturers' recommendations. Constructs were sequenced at the UW—Madison Biotechnology Center using ABI Big Dye, version 3.1 (Applied Biosystems, Foster City, CA). PCR products for cloning were amplified using Pfx polymerase (Invitrogen, Carlsbad, CA). All other DNA PCR amplification was performed using ExTaq according to the manufacturer's directions (Takara, Otsu, Shiga, Japan). Reactions were performed using 0.2 μM of each appropriate primer; the primers used in this study (Integrated DNA Technologies, Coralville, IA; UW—Madison Biotechnology Center, Madison, WI) are described in Table 2.

TABLE 2.

Primers used in this study

Primer Sequence (5′ to 3′)a Use
EH079 NNNGTCGACGAGTGATCTACTTGGATG ΔcpxR1 mutant construction
EH078 NNNTCTAGAGCATTAATTCTTCCTCCAAG ΔcpxR1 mutant construction; creation of cpxRp-lacZ fusion
EH080 NNNGAGCTCGTAAAATGATCAATAGCC ΔcpxR1 mutant construction
EH081 NNNCCCGGGCGTTTCAACAATCGCTAATC ΔcpxR1 mutant construction
EH146 TAAATTTCTCCGCTTTCTCGAATAGC ΔcpxR1 mutant complementation; creation of cpxRp-lacZ fusion
EH121 GTCTAGAAATTTGGCTTATCCTCTTAG ΔcpxR1 mutant complementation
EH145 ACGCTTAACACCGTTTGATCG RT-PCR for cpxRA cotranscription
EH013 CATTAAATATCCACGACCACG RT-PCR for cpxRA cotranscription
EH014 TTCTGGACAGTGAGTATCAGC RT-PCR for cpxRA cotranscription
EH015 CACTGGTAACAAGGAGTAAGC RT-PCR for cpxRA cotranscription
recAminFor TGTCCGTTTGGATATCCGCC qPCR (recA)
recAminRev CCCAGAGTATTAATACCTTCCCCA qPCR (recA)
EH102 CGCAGATGACTATCTCCCTAAACC qPCR (cpxR)
EH025 CCGTCAAAACTGGCCTCC qPCR (cpxR)
EH014 TTCTGGACAGTGAGTATCAGC qPCR (cpxA)
EH015 CACTGGTAACAAGGAGTAAGC qPCR (cpxA)
EH147 GCCAGCAGATGTGGGATTTAG qPCR (cpxP)
EH103 CTCAAGTTGCAGCCGAACC qPCR (cpxP)
lrhAintCF CGCTGGAAACGCTGGATAT qPCR (lrhA)
lrhAintCR GGCAGACGTGGTAATCCTT qPCR (lrhA)
xlpAintF CGCTGCATTGGCAACAGGAAA qPCR (xlpA)
xlpAintR GCCAATCGTGCTGAACGGTAT qPCR (xlpA)
EH035 GCGGAGCACTATAGTTAAATGTG qPCR (flgE)
EH036 CAACGGCGAAATTCAGATAGGC qPCR (flgE)
flhDintF GCGATGTTCCGTTTAGGTA qPCR (flhD)
flhDintR GCGATTCCTTCGTTAACTG qPCR (flhD)
fliAintF GGCACGAAATTCACGGTGAA qPCR (fliA)
fliAintR CCGTTCAGGCAATGACTCAA qPCR (fliA)
fliCintF GCGAACGTTAAAGGCCTGACT qPCR (fliC)
fliCintR GCCGTTGAACTGAGTTTGTGT qPCR (fliC)
prot 1 TCTTGGTCTGATGTTGCC qPCR (prtA)
prot 2 ACCCTGAGGCAGATTTGC qPCR (prtA)
xhlBquant1 GCTAAAGGCTATATTACGGCG qPCR (xhlB)
xhlBquant2 GCTGATTCAGGTTGAGTGGCT qPCR (xhlB)
EH124 CTGATAAGCAGCTGGCTG qPCR (xaxA)
EH125 CCATCTGATAACTCACCGCC qPCR (xaxA)
EH068 CTATGCCAGGCTTATTAGCGC qPCR (mrxA)
EH069 CGATGGCGGTAAATTCACCC qPCR (mrxA)
a

Engineered restiction enzyme sites are underlined. N = G, A, T, or C.

Mutation of cpxR.

A ΔcpxR1 deletion mutant was constructed by amplifying fragments upstream and downstream of cpxR using primers EH079, EH078, EH080, and EH081, which contain engineered restriction enzyme sites. The upstream fragment was cloned into the pKR100 suicide vector using SalI and XbaI sites, creating pKRcpxRup. The aad streptomycin resistance cassette was cut out of pKJN102 using XbaI and SacI sites and cloned immediately downstream of the upstream fragment in pKRcpxRup using the same sites, creating pKRcpxRupStr. The downstream fragment was cloned into pKRcpxRupStr immediately downstream of the streptomycin resistance cassette using SacI and SmaI sites, creating pKRcpxRStr. pKRcpxRStr was used to delete cpxR from the X. nematophila chromosome by allelic exchange. The successful deletion mutant was verified by Southern hybridization.

Complementation of the ΔcpxR1 mutant.

A cpxR complementation fragment was constructed by amplifying cpxRA and the 152-bp cpxP-cpxR intergenic region using primers EH146 and EH121. This fragment was cloned using a TOPO TA cloning kit (Invitrogen, Carlsbad, CA), creating pTOPOcpxRAcomp. Using ApaI and SpeI restriction sites, the complementing fragment was subcloned into the Tn7 transposon delivery vector pEVSCm, creating pTn7cpxRAcomp.

Virulence assays.

M. sexta (tobacco hornworm) larvae were raised from eggs (North Carolina State University Insectary, Raleigh) on an artificial diet (gypsy moth wheat germ diet; MP Biomedicals, Aurora, OH) with a photoperiod of 16 h. Bacterial strains were grown overnight, subcultured 1:500, grown to an optical density at 600 nm (OD600) of ∼0.8, and then resuspended in sterile phosphate-buffered saline (PBS). Prior to injection, fourth-instar insects were kept briefly on ice. Ten microliters of a diluted culture was injected into the first proleg of each of 10 insects using a 30-gauge syringe (Hamilton, Reno, NV). Insect survival was monitored for 96 h after injection. The number of bacterial CFU injected was determined by dilution plating.

Nematode colonization assays.

Fresh overnight bacterial cultures were subcultured 1:100 and grown for 24 h. Cell density was then normalized using OD600 in sterile PBS, and cultures were plated on five replicate lipid agar plates per strain per experiment. The plates were incubated in the dark at 30°C for 24 h. The colonization of nematodes on these lawns was assayed as previously described (10). In each experiment, the average wild-type value was defined as 100% colonization. All values were normalized to the designated wild-type value.

Bacterial survival assays.

To monitor bacterial survival on lipid agar, fresh overnight cultures of strains were subcultured 1:100 and grown for 24 h. The number of bacterial cells was normalized using OD600 in sterile PBS, and equal numbers of cells of strains were placed on 0.45-μm filter disks (Millipore, Bedford, MA) on lipid agar plates. The plates were incubated at 30°C in the dark for 5 days, and then the filter disks were removed, placed into 1 ml sterile PBS, and vortexed vigorously for 30 s before dilution plating.

The sensitivities of bacterial strains to sonication, which was used to release bacteria from nematodes in the colonization assay, were determined. The number of bacterial cells was normalized in sterile PBS (using OD600), and then cells were resuspended in LB and sonicated for 1 min as described above for the colonization assay. Cultures were dilution plated before and after sonication to determine the percentage of surviving cells for each strain.

Phenotypic analyses.

For all phenotypic assays, fresh overnight cultures of X. nematophila strains were subcultured 1:100 and then grown for 24 h. Cultures were normalized using OD600 to obtain approximately equivalent cell densities in sterile PBS, and 2 μl of each strain was spotted on each plate. For hemolysis, protease, and antibiotic assays, the area of a halo was calculated and normalized to the colony area using the formula: [π(halo radius)2]/[π(colony radius)2]. The plates for hemolysin, protease, and lipase assays contained 5% animal blood (Colorado Serum Company, Denver, CO), 3% milk (7), and 1% Tween 20 (71), respectively. For lipase assays, the precipitate was measured by determining the spot density using an AlphaImager IS-2200 gel imaging system (Alpha Innotech Corporation, San Leandro, CA). The values represented the average pixel density [(sum of all pixel values − background value)/area measured]. For motility assays, the plates contained 0.25% agar, and motility was measured by determining the diameter of growth. For antibiotic assays, strains were plated on tryptic soy agar containing 0.1% pyruvate and grown for 24 h. X. nematophila cultures were then exposed to chloroform vapor for 30 min before a 6-ml overlay of 0.75% agar containing 100 μl of a Bacillus subtilis overnight culture was poured over the tryptic soy agar plate and incubated at 30°C for 24 h (1).

Creation of lacZ fusion strains.

To create a transcriptional lacZ fusion to the cpxR promoter, a 152-bp fragment 5′ of cpxR was amplified using primers EH146 and EH078 and cloned using a TOPO TA cloning kit (Invitrogen, Carlsbad, CA), creating plasmid pTOPOcpxRp. pTOPOcpxRp was cloned into pKV124 immediately upstream of a promoterless lacZ gene using the NotI restriction site, creating plasmid pKVTOPOcpxRp. The cpxRp-lacZ fragment was cut out of pKVTOPOcpxRp using the flanking KpnI sites and cloned into the Tn7 delivery vector pEVSCmKan using the same sites, creating plasmid pTn7cpxRp-lacZ. The cpxR promoter fusion was delivered into the X. nematophila chromosome attTn7 site by triparental mating, as described previously (4).

nilA-lacZ, nilB-lacZ, and nilC-lacZ fusions were introduced into the ΔcpxR1 mutant by triparental mating of pTn7/nilA-lacZ, pTn7/nilAB-lacZ, and pTn7/nilC-lacZ (10, 11).

RNA extraction and RT-PCR analyses.

RNA extraction and quantitative reverse transcription (RT)-PCR analyses were performed as previously described (13). The primers used are listed in Table 2. To monitor cotranscription by RT-PCR, DNase-treated RNA was used in reactions with primers designed to amplify a 120-bp region within cpxR (primers EH145 and EH013) and a 158-bp fragment within cpxA (primers EH014 and EH015). Primers EH145 and EH015 were used to amplify a 402-bp fragment encompassing the 3′ end of cpxR and the 5′ end of cpxA. RT-PCR was performed using the Access RT-PCR system (Promega, Madison, WI) according to the kit instructions. For each primer pair, the RT-PCRs included a DNA control, a reaction with no reverse transcriptase to check for DNA contamination, and a reaction including reverse transcriptase.

Microscopy.

Electron microscopy was performed by R. Massey at the University of Wisconsin Medical School Electron Microscope Facility. Phase-contrast microscopy was performed using a Nikon Eclipse TE300 inverted microscope, and images were recorded using an ORCA digital camera (model C4742-95-10R; Hamamatsu, Hamamatsu City, Japan) and Metamorph version 4.5r6 software (Universal Imaging Corporation, West Chester, PA).

Statistics.

Nematode colonization data, phenotype data, and quantitative PCR (qPCR) cycle number values were analyzed by one-way analysis of variance using Tukey's posttest with a 95% confidence interval, using GraphPad Prism version 3.0 software. The Mantel-Haenszel log rank test was used to compare insect survival curves; these data analyses were conducted in the statistical language R (67).

Nucleotide sequence accession numbers.

The GenBank accession numbers relevant to this study are as follows: cpxPRA, EF219019; flgE, EF221768; flhD, EF221766; fliA and fliC, EF221767; lrhA, EF219056; mrxA, AF525420; prtA, AAX15945; xhlBA, AY640584; xaxAB, DQ249320; xlpA, EF123201; and recA, AF127333.

RESULTS

Mutation of the cpx genes and complementation of mutants.

In X. nematophila, cpxR and cpxA are oriented in tandem and overlap by four nucleotides, whereas cpxP is divergently encoded 152 nucleotides upstream of cpxRA. RT-PCR analysis of total X. nematophila RNA extracted from log- and stationary-phase cells revealed that cpxRA is cotranscribed as an operon (data not shown).

All but the last four nucleotides of cpxR were deleted from the X. nematophila chromosome and replaced with the aad adenylyltransferase gene conferring streptomycin resistance, and the resulting strain was designated the ΔcpxR1 mutant. As expected, the cpxR transcript was not present in ΔcpxR1 cells. In addition, cpxA and cpxP transcripts were undetectable in the ΔcpxR1 mutant, as determined by qPCR analysis (Fig. 1A).

FIG. 1.

FIG. 1.

CpxR shows inverse growth phase-dependent control of cpxR expression. (A) Transcript levels of cpxR, cpxA, and cpxP analyzed by qPCR in early log phase in the WT (Tn7) (normalized to 1.0 [not shown]), ΔcpxR1 (Tn7) (open bars, not visible), ΔcpxR1 (Tn7/cpxRA) (striped bars), and WT (Tn7/cpxRA) (gray bars) strains. qPCR was performed using the primers indicated in Table 2. The bars indicate averages of three or more replicates. An asterisk indicates a value significantly different from the WT (Tn7) transcript level. Fold-WT, fold increase compared with the wild type. (B) cpxR promoter activity in wild-type X. nematophila (□) and the ΔcpxR1 mutant (○), both carrying a cpxRp-lacZ fusion, measured by the β-galactosidase assay. Growth of the wild type (▪) and the ΔcpxR1 mutant (•) in LB broth is also shown. The symbols indicate the averages for three replicates. The error bars indicate standard errors.

By supplying cpxRA in trans to the ΔcpxR1 mutant via a Tn7 transposon [ΔcpxR1 (Tn7/cpxRA) mutant], the cpxR and cpxA transcripts were restored to levels equal to or greater than those of a wild-type strain carrying an empty Tn7 vector [strain WT (Tn7)] (the levels of expression were 2.3- and 2.4-fold greater than wild-type expression, respectively) in early log phase. cpxP transcript levels were partially restored (57% of the wild-type level) in the ΔcpxR1 (Tn7/cpxRA) strain (Fig. 1A).

CpxRA is involved in mutualism and pathogenesis in X. nematophila.

The ΔcpxR1 mutant was tested to determine its ability to infect and kill a model insect host, the tobacco hornworm (M. sexta) (Fig. 2A). The virulence of the ΔcpxR1 mutant carrying an empty Tn7 transposon [ΔcpxR1 (Tn7)] was compared to that of strain WT (Tn7), the ΔcpxR1 (Tn7/cpxRA) mutant, and a wild-type strain carrying an extra copy of cpxRA [strain WT (Tn7/cpxRA)]. When strain WT (Tn7) was injected into insects, the time required to kill 50% of the insects (LT50) was ∼26 h, and 91% ± 7% of the insects were killed by the end of the experiment (96 h postinjection). In contrast, the ΔcpxR1 (Tn7) mutant killed only 75% ± 8% of the insects (P < 0.001) and killed more slowly, with an LT50 of ∼44 h (Fig. 2A). Supplying cpxRA in trans restored the virulence to the wild-type levels; the ΔcpxR1 (Tn7/cpxRA) mutant killed an average of 95% ± 3% of the insects (P = 0.05) injected and had an LT50 of ∼23 h. In contrast to the ΔcpxR1 mutant, the WT (Tn7/cpxRA) strain killed at levels slightly higher than the wild-type levels (average mortality, 96% ± 3% [P = 0.002]; LT50, ∼20 h). The same pattern of killing was observed when stationary-phase cells were injected (data not shown).

FIG. 2.

FIG. 2.

ΔcpxR1 mutant is attenuated in virulence for M. sexta insects and mutualistic nematode colonization. (A) Fourth-instar M. sexta larvae were injected with log-phase X. nematophila cells, and insect survival was monitored over time. The strains included in this analysis were the WT (Tn7) (□), WT (Tn7/cpxRA) (⋄), ΔcpxR1 (Tn7) (○), and ΔcpxR1 (Tn7/cpxRA) (•) strains. The symbols indicate the averages of six to eight experiments (10 insects per experiment). The error bars indicate standard errors. The letters b and c indicate values significantly different from the WT (Tn7) strain value (a). (B) X. nematophila bacteria were isolated from colonized S. carpocapsae nematodes, and the average number of CFU/infective juvenile (IJ) for each strain was normalized to wild-type values, which were defined as 100%. Nematodes were colonized with the strains indicated at the bottom. The values are averages of three or more experiments. An asterisk indicates the number of CFU/infective juvenile is statistically different from the wild-type value (WT) (P < 0.01).

The ability of the ΔcpxR1 mutant to mutualistically colonize S. carpocapsae nematodes was assessed (Fig. 2B). The WT (Tn7) and WT (Tn7/cpxRA) strains colonized nematodes at levels not significantly different from the wild-type strain level (98% ± 14% and 120% ± 19% of the wild-type colonization level, respectively) (P > 0.05). However, colonization by the ΔcpxR1 and ΔcpxR1 (Tn7) mutants was significantly reduced (P < 0.01) compared to the colonization by the wild type (colonization levels, 38% ± 5% and 44% ± 5% of the wild-type levels, respectively). The level of colonization by the ΔcpxR1 (Tn7/cpxRA) mutant was 75% ± 11%, a level not significantly different from the wild-type level (P > 0.05).

In vitro colonization assays require bacterial survival on lipid agar plates for several days during nematode development and colonization. Survival of the ΔcpxR1 mutant was monitored to determine if its colonization defect was due to the availability of fewer viable cells during the colonization process. After 5 days, the ΔcpxR1 mutant showed no significant defect in survival on lipid agar plates compared to the wild type (data not shown). The ΔcpxR1 mutant also withstood the sonication process used to release bacterial cells from nematodes as well as the wild type withstood this process (data not shown), indicating that the colonization deficiency was not due to an inability of the ΔcpxR1 mutant to survive during the colonization assay.

ΔcpxR1 mutant displays altered colony and cell morphology.

The ΔcpxR1 mutant produced colonies whose shape was irregular compared to wild-type colonies (Fig. 3A). As determined by light and electron microscopy, ΔcpxR1 mutant cells appeared to be larger, longer, and more frequently filamentous than wild-type cells (Fig. 3A and data not shown).

FIG. 3.

FIG. 3.

ΔcpxR1 mutant has altered morphology and phenotypic properties. (A) Wild-type X. nematophila (WT) and ΔcpxR1 mutant colony and cell morphologies. Images were obtained using phase-contrast microscopy at magnifications of ×100 (colony morphology) and ×1,000 (cell morphology). Cell and colony morphologies were analyzed using X. nematophila strains grown in plates containing liquid LB and LB with 0.1% pyruvate, respectively. The scale bars indicate 5 and 100 μm in the cell and colony morphology images, respectively. (B) Phenotypes inhibited (antibiotics, hemolysin, and protease) and activated (lipase and motility) by CpxR. The values under the antibiotic, hemolysin, and protease images indicate the halo area/colony area (averages ± standard errors). The values under the lipase images indicate the precipitate density, and the values under the motility images are growth diameters. An asterisk indicates a value that is significantly different (P < 0.01) from the WT (Tn7) strain value.

In LB broth, the ΔcpxR1 mutant showed a slightly different growth pattern than wild-type cells, taking longer to begin logarithmic growth (Fig. 1B). However, during exponential growth, the ΔcpxR1 mutant had a doubling time not significantly different from that of the wild type [1.66 ± 0.11 doublings/h for the WT (Tn7) strain versus 1.69 ± 0.03 doublings/h for the ΔcpxR1 (Tn7) mutant] (P > 0.05). Additionally, the ΔcpxR1 mutant reached a cell density equal to that of the wild type by stationary phase, as determined by OD600 (Fig. 1B). Similar differences in growth patterns between the wild type and the ΔcpxR1 mutant were observed when strains were grown in hemolymph (insect blood) (data not shown).

cpxR promoter has two peaks of activity.

In E. coli, cpxR expression is autoregulated (18, 63), and phosphorylated CpxR protein binds to a specific promoter sequence upstream of the cpxR gene and other genes that it regulates (28, 51, 59). In E. coli, Shigella species, and L. pneumophila, CpxR consensus sequences have been reported to occur 57, 67, and 87 bp upstream of the regulated gene's translational start site, respectively (28, 51, 59). In E. coli and Shigella, the consensus sequence is 5′-GTAAN(6-7)GTAA-3′ and sometimes includes an additional 5′-GTAA-3′ (59). In X. nematophila we identified a similar sequence, 5′-GTAAA-GAAC-GTAAA-3′, 53 bp upstream of the putative cpxR translational start that may be the CpxR binding sequence, although this possibility has not been tested yet.

To determine if X. nematophila cpxR expression is autoregulated, we created a transcriptional lacZ reporter fusion to the predicted cpxR promoter region (cpxRp-lacZ) and analyzed its activity in the presence (wild type) and absence (ΔcpxR1 mutant) of CpxR protein (Fig. 1B). (Note that the absence of a qPCR-detectable cpxR transcript in the ΔcpxR1 mutant does not constitute evidence of autoregulation since the lack of transcript simply reflects the absence of the cpxR gene in this strain.) In wild-type X. nematophila, cpxR expression was driven by a weak promoter, with a maximum expression of ∼3.29 Miller units (Fig. 1B). The promoter had two peaks of activity, one in logarithmic phase at an OD600 of ∼0.15 to 0.2 (∼3 h after subculturing) and the other in late stationary phase at an OD600 of ∼7.0 to 10.0 (∼48 h after subculturing) (Fig. 1B). The ΔcpxR1 mutant displayed higher reporter activity than the wild type for the first peak (P < 0.001), but in stationary phase the ΔcpxR1 mutant showed lower activity and a shorter peak than the wild type (P < 0.001).

CpxRA negatively regulates secreted activities.

In many organisms, the CpxRA system regulates cell envelope components and associated structures, as well as secretion (61). Therefore, we tested the X. nematophila ΔcpxR1 mutant for differences in production of known surface structures and extracellular activities and found that several of these factors are negatively regulated by CpxRA. The ΔcpxR1 (Tn7) mutant strain showed significant increases in antibiotic activity against B. subtilis and hemolysin activity against sheep red blood cells (P < 0.01) (Fig. 3B). Qualitatively, the ΔcpxR1 mutant showed increased hemolytic activity against rabbit blood cells, but no differences were observed in the ΔcpxR1 mutant's ability to lyse horse red blood cells (data not shown). A qualitative increase in protease activity against milk protein was observed in the ΔcpxR1 mutant, but the measured values were not significantly different from the wild-type values (P > 0.05), presumably due to the qualitative nature of phenotypic plate assays. ΔcpxR1 mutant colonies also displayed a color change on milk agar plates, having a lighter-color center than wild-type colonies. The presence of Tn7/cpxRA restored the wild-type colony color, as well as antibiotic, hemolysin, and protease activities, to the ΔcpxR1 mutant (Fig. 3B).

Based on these phenotypes, we compiled a list of putative CpxR-regulated genes and analyzed their expression by qPCR (Table 3). Consistent with the observation that CpxR negatively regulates in vitro hemolytic activity, xaxA, which is responsible for the hemolytic activity with sheep erythrocytes (74), showed a ∼7-fold-higher transcript level in the ΔcpxR1 mutant than in the wild type in mid-log phase. The transcript levels of xhlBA, encoding a hemolysin and its transport protein (13), were not significantly affected in the ΔcpxR1 mutant. The prtA transcript, encoding a protease responsible for the clearing seen on milk agar plates (C. Lipke and H. Goodrich-Blair, unpublished data), was present at threefold-higher levels (P < 0.001) in the ΔcpxR1 mutant in mid-log phase. The transcript levels of xaxA and prtA did not vary significantly from the wild-type levels in stationary-phase cells (Table 3).

TABLE 3.

Relative expression of potential CpxR-regulated genes in the ΔcpxR1 mutant

Class Gene Transcript level in ΔcpxR (fold increase compared with the wild type)a
OD600, ∼0.5 OD600, ∼0.8 OD600, ∼5.0 Plate
Hemolysin related xaxA 6.96 (5)b 0.38 (3) 1.17 (4) ND
xhlB 1.71 (9) 1.72 (2) 0.41 (7) ND
Protease related prtA 3.05 (5)d ND 0.58 (7) ND
Lipase related lrhA 0.60 (9) 0.29 (7)c 0.77 (5) ND
xlpA 1.06 (8) 0.75 (5) 1.05 (4) ND
Flagellum related fliA 1.06 (3) 1.51 (3) ND ND
flhD 1.57 (8) 0.84 (6) 0.77 (3) ND
flgE 1.05 (9) 1.21 (6) 0.84 (6) ND
fliC 1.06 (9) 1.46 (6) 0.61 (3) ND
Pilus related mrxA ND ND ND 3.36 (5)b
a

The numbers in parentheses are the numbers of replicates. ND, not determined.

b

The value is significantly different from the wild-type value, which was defined as 1.0 (P < 0.01).

c

The value is significantly different from the wild-type value, which was defined as 1.0 (P < 0.05).

d

The value is significantly different from the wild-type value, which was defined as 1.0 (P < 0.001).

In E. coli CpxRA regulates biogenesis of pili (61). The transcript of X. nematophila mrxA, encoding the pilin subunit protein, was analyzed in cells grown on solid LB plates, conditions under which mrxA is known to be expressed (32). The ΔcpxR1 mutant showed significantly higher (P < 0.01) mrxA levels (3.4-fold higher than the level of wild-type cells) (Table 3).

Positive regulation by CpxRA.

The ΔcpxR1 (Tn7) strain exhibited decreased motility and lipase activity (against Tween 20), although only the former activity was significantly different from the activity observed for the WT (Tn7) strain (P < 0.01) (Fig. 3B). Both motility and lipase activity defects were complemented by introduction of the Tn7/cpxRA locus.

To further assess predicted positive regulation of lipase activity and motility by CpxR, the transcript levels of genes involved in the lipase phenotype, including lrhA encoding a positive regulator of lipase activity (Richards et al., unpublished) and xlpA encoding the secreted lipase protein (55), were measured, as were the levels of several members of the flagellar regulon. Consistent with predictions, the lrhA transcript levels were significantly lower in the absence of cpxR (∼29% of the wild-type levels [P < 0.05]) at late log phase (Table 3). However, the xlpA expression was not significantly different from the wild-type expression in any growth phase examined (Table 3). The transcript levels of flagellar genes encoding transcriptional regulators (fliA and flhD), a hook protein necessary for lipase secretion (flgE), and the flagellar subunit protein (fliC) (23, 47) in the ΔcpxR1 mutant were not significantly different (P > 0.05) than the wild-type transcript levels at any time point examined (Table 3).

The nematode colonization defect of the ΔcpxR1 mutant prompted an examination of the influence of CpxRA on expression of three genes, nilA, nilB, and nilC, encoding membrane proteins necessary for colonization. nilAp-lacZ, nilBp-lacZ, and nilCp-lacZ fusions (10, 11) were introduced into the ΔcpxR1 mutant, and β-galactosidase activity was monitored in log-phase cultures (data not shown) and stationary-phase cultures (Fig. 4). In both growth phases, each nil gene was expressed at significantly lower levels (P < 0.001) in the ΔcpxR1 mutant than in the wild type.

FIG. 4.

FIG. 4.

CpxR positively regulates nilA, nilB, and nilC expression. lacZ reporter fusions were used to measure expression of nilA (A), nilB (B), and nilC (C) in the ΔcpxR1 mutant by the β-galactosidase assay. Assays were performed using stationary-phase cultures (averages of three replicates are indicated by the bars). The error bars indicate standard errors. An asterisk indicates a value significantly different from the wild-type value (WT) (P < 0.001).

DISCUSSION

Role of X. nematophila CpxR in host interactions.

In this work, we demonstrated that X. nematophila CpxRA is necessary for both mutualistic and pathogenic host interactions. The ΔcpxR1 deletion strain, in which expression of both cpxA and cpxP was also absent, showed a reduction in the number of bacterial cells recovered from colonized S. carpocapsae nematodes. The ΔcpxR1 mutant also displayed reduced virulence for M. sexta insects. Compared to wild-type cells at the same dose, ΔcpxR1 mutant cells killed fewer M. sexta insects, and the insects that succumbed to ΔcpxR1 mutant infection exhibited delayed onset of disease compared to insects infected with wild-type X. nematophila. These host interaction defects may be explained by the pleiotropy of the ΔcpxR1 mutant, particularly with respect to cell envelope and surface structures and secreted activities.

The filamentous cell morphology and extended lag phase of the X. nematophila ΔcpxR1 mutant suggest that CpxR is involved (directly or indirectly) in maintaining normal cell division and shape, which could influence X. nematophila-host interactions. For example, when injected into the insect blood system, X. nematophila encounters and suppresses insect immunity (29, 38, 41, 56-58). If the extended lag phase of the ΔcpxR1 mutant observed during laboratory growth (Fig. 1B) also occurs in insects, this could cause a delay in establishment of infection and negatively affect resistance to and suppression of immunity. However, X. nematophila oppA2 and oppB mutants, which are deficient in expression of an oligopeptide permease, exhibit similar growth defects in hemolymph but have no observable host interaction defects, either for M. sexta virulence or for colonization of S. carpocapsae (53). Therefore, altered growth alone is not sufficient to explain the delay in insect killing or the decrease in nematode colonization observed with the ΔcpxR1 mutant. Filamentation of the ΔcpxR1 mutant could be a cause of reduced nematode colonization; the S. carpocapsae nematode vesicle is a physically restricted space (6, 43, 44) in which filamentous cells may fail to pack tightly enough to achieve the normal density. If this occurs, it could explain the reduced numbers of bacterial cells recovered from nematodes colonized by the ΔcpxR1 strain. Alternatively, the filamentous ΔcpxR1 mutant simply may form fewer colonies on plates, even if the number of bacteria inside the nematode is approximately the same as the number of wild-type bacteria.

CpxR controls virulence and mutualism genes.

While the cell structure alterations caused by the ΔcpxR1 mutation likely influence host interactions, CpxR also regulates expression of virulence and nematode colonization determinants (Fig. 5). The ΔcpxR1 mutant strain has altered production of several exoenzymes with known or suspected roles in X. nematophila virulence for insects and bioconversion of the insect carcass, including increased hemolysin (8, 74) and protease (9) secreted activities, as well as increased transcripts of genes encoding these activities (Table 3). Of particular note is the finding that the ΔcpxR1 mutant exhibited an increase in expression of mrxA (Table 3) encoding a pilin subunit (32) with pore-forming toxin activity (3). MrxA is present in X. nematophila outer membrane vesicles (OMVs) that are toxic to insects. OMV production is a membrane stress response in gram-negative bacteria, and the quantity of released OMVs correlates directly with envelope protein accumulation (45). Therefore, the increase in mrxA transcripts in the ΔcpxR1 mutant may result in or be caused by increased OMV production. Premature or excessive expression of OMVs, MrxA, hemolysins, proteases, or antibiotics may trigger host immunity or prevent ΔcpxR1 mutant cells from accessing a specific host niche. Furthermore, an increase in pilus expression on the cell surface may cause inappropriate cell-cell interactions or mask cell surface adhesins necessary for host contact.

FIG. 5.

FIG. 5.

Model of CpxR regulation in X. nematophila. CpxR positively regulates motility and lipase activity and nematode colonization factors, potentially through transcriptional activation or derepression of lrhA and nilA, nilB, and nilC. No genes have been associated yet with antibiotic production in X. nematophila, but negative regulation of protease and hemolysin activities by CpxR may be attributed to transcriptional repression of prtA and xaxA. mrxA is also repressed by CpxR. The designations of genes associated with the activities are indicated. The arrows indicate positive regulation, and negative regulation is indicated by lines ending with a perpendicular line.

As discussed above, the filamentous cell morphology of the ΔcpxR1 strain may contribute to the reduced number of colonies retrieved from nematodes. However, we also have demonstrated that CpxR positively affects expression of nilA, nilB, and nilC (Fig. 4), each of which is necessary for full mutualistic colonization of the nematode host (10, 11, 34). nilA, nilB, and nilC are repressed synergistically by the transcription factors Lrp and NilR, and it is thought that derepression must occur for colonization to proceed (10-12). Therefore, CpxR may play a role in facilitating nil gene derepression, and a failure to derepress these genes in a cpxR mutant could contribute to the colonization deficiency of such a strain.

Overlap of the Cpx, RpoE, and OmpR regulons.

In E. coli the CpxR regulon overlaps the regulons of the cell envelope stress sigma factor RpoE and the two-component regulator OmpR (5, 65). A similar regulatory overlap appears to occur in X. nematophila; like the ΔcpxR1 mutant, an X. nematophila ompR mutant exhibits qualitatively increased levels of hemolysis, proteolysis, and antibiotic activity (55), while an rpoE mutant displays reduced protease and antibiotic activities and no hemolytic activity against sheep red blood cells (34). The opposing effects of X. nematophila CpxR and RpoE suggest that these factors directly regulate similar genes in opposing fashions or that one of these regulators negatively regulates the other, indirectly affecting downstream genes. An X. nematophila rpoE mutant shows almost negligible nematode colonization, although interpretation of the role of RpoE in colonization is obscured by the rpoE mutant's survival defect on plates during coculture with nematodes (34). An X. nematophila ompR mutant has a competitive nematode colonization defect (24). Thus, CpxR, RpoE, and OmpR each influence the ability of X. nematophila to colonize the nematode host, although differences in the colonization phenotypes of the corresponding mutants suggest that each of these regulators has a distinct role in the colonization process.

While the ΔcpxR mutant has a virulence defect in M. sexta insects (Fig. 2A), an ompR mutant is fully virulent (24), a difference that likely is related to variations in the OmpR and CpxR regulons. For example, CpxR and OmpR have opposing effects (positive and negative, respectively) on motility and lipase activity (55) (Fig. 3B). X. nematophila OmpR affects expression of lipase activity and motility (as well as hemolysis and proteolysis) through its negative regulation of flhDC (55). In contrast, transcript levels of several genes in the flagellar regulon were not affected significantly by the absence of cpxR. It should be noted that xaxAB, prtA, and xlpA encoding C1 hemolysin, protease, and lipase activities, respectively, are all members of the flagellar regulon. However, only one of these activities, lipase activity (which is differentially regulated by CpxR and OmpR), relies on the flagellar type III secretion pathway for export (55). Therefore, reduced motility and lipase secretion in the absence of cpxR may be caused by perturbation of flagellar type III secretion caused by physical changes in the membrane. Alternatively, CpxR may promote motility and lipase secretion through positive regulation of lrhA (Table 3). An lrhA mutant is defective in secreted lipase activity and motility but not in hemolysin, protease, or antibiotic activities, suggesting that LrhA may be necessary specifically for flagellar type III secretion. lrhA mutants display more dramatic virulence attenuation with M. sexta insects than an flhD mutant (Richards et al., unpublished). Therefore, LrhA is likely necessary for expression of virulence determinants outside the flagellar regulon. Taken together, these data indicate that the virulence, motility, and lipase activity defects of the ΔcpxR1 mutant may be attributed to the reduced expression of lrhA in this strain.

X. nematophila Cpx system.

Our data indicate that the genetics and biochemistry of the Cpx system of X. nematophila are similar to those of the E. coli system. In these two organisms the genetic structures of the cpx operon are similar, and in X. nematophila the intergenic region between cpxP and cpxRA contains a sequence similar to the E. coli CpxR consensus binding site (59). As in E. coli, in X. nematophila this region is sufficient to drive expression of cpxRA, and CpxR regulates its own expression (Fig. 1). MEME motif discovery software (2) was used to search for sequence similarities and CpxR binding sites upstream of potential CpxR-regulated genes (see above). However, no strong CpxR consensus sequences were found, which may indicate that CpxR regulation of these genes is indirect, that other proteins are involved, or that we incorrectly predicted the sequence of the X. nematophila CpxR binding site.

Although cpx gene expression occurs in E. coli during both log and stationary phases (20), a striking difference between the Cpx systems of E. coli and X. nematophila is that X. nematophila cells exhibited biphasic peaks of cpxR promoter activity that were inversely influenced by CpxR (Fig. 1B), a phenomenon not reported to occur in other organisms tested to date. The first peak of X. nematophila cpxRp-lacZ expression occurred in early log phase and was maximal in the absence of cpxR, indicating that CpxR is expressed during early log phase but that it negatively influences its own transcription (directly or indirectly).

CpxRA is the second regulator, after Lrp, demonstrated to be necessary for both pathogenic and mutualistic interactions of X. nematophila. To our knowledge, no prior studies have described a role for the Cpx system in mutualistic host-microbe interactions. We have demonstrated that X. nematophila CpxRA is integral to processes occurring at the cell surface (Fig. 5); CpxRA influences production of cell surface structures and secreted products, and it is these processes that likely are necessary for normal host interactions. This work places CpxRA in a growing hierarchy of regulators whose functions intertwine to coordinate adaptation to the internal and external environments of the cell during pathogenic and mutualistic host interactions (31).

Acknowledgments

This research was supported by an Investigators in Pathogenesis of Infectious Disease Award from the Burroughs Wellcome Foundation and by National Institutes of Health (NIH) grant GM59776. E.E.H. was supported by NIH National Research Service Award T32 AI007414. K.N.C. was supported by NIH National Research Service Award T32 G07215 from NIGMS.

We thank Murray Clayton (University of Wisconsin—Madison) for assistance with statistical analyses, Randall Massey (University of Wisconsin—Madison) for help with electron microscopy, and C. Allen, M. McFall-Ngai, E. Ruby, N. Ruiz, M. Thomas, and D. Tran for helpful discussions about experiments and the manuscript.

Footnotes

▿

Published ahead of print on 19 October 2007.

REFERENCES

  • 1.Akhurst, R. J. 1982. Antibiotic activity of Xenorhabdus spp., bacteria symbiotically associated with insect pathogenic nematodes of the families Heterorhabditidae and Steinernematidae. J. Gen. Microbiol. 128:3061-3065. [DOI] [PubMed] [Google Scholar]
  • 2.Bailey, T. L., and C. Elkan. 1994. Fitting a mixture model by expectation maximization to discover motifs in biopolymers. Proc. Int. Conf. Intell. Syst. Mol. Biol. 2:28-36. [PubMed] [Google Scholar]
  • 3.Banerjee, J., J. Singh, M. C. Joshi, S. Ghosh, and N. Banerjee. 2006. The cytotoxic fimbrial structural subunit of Xenorhabdus nematophila is a pore-forming toxin. J. Bacteriol. 188:7957-7962. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bao, Y., D. P. Lies, H. Fu, and G. P. Roberts. 1991. An improved Tn7-based system for the single-copy insertion of cloned genes into chromosomes of gram-negative bacteria. Gene 109:167-168. [DOI] [PubMed] [Google Scholar]
  • 5.Batchelor, E., D. Walthers, L. J. Kenney, and M. Goulian. 2005. The Escherichia coli CpxA-CpxR envelope stress response system regulates expression of the porins ompF and ompC. J. Bacteriol. 187:5723-5731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bird, A. F., and R. J. Akhurst. 1983. The nature of the intestinal vesicle in nematodes of the family Steinernematidae. Int. J. Parasitol. 13:599-606. [Google Scholar]
  • 7.Boemare, N., J. O. Thaler, and A. Lanois. 1997. Simple bacteriological tests for phenotypic characterization of Xenorhabdus and Photorhabdus phase variants. Symbiosis 22:167-175. [Google Scholar]
  • 8.Brillard, J., C. Ribeiro, N. Boemare, M. Brehelin, and A. Givaudan. 2001. Two distinct hemolytic activities in Xenorhabdus nematophila are active against immunocompetent insect cells. Appl. Environ. Microbiol. 67:2515-2525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Caldas, C., A. Cherqui, A. Pereira, and N. Simoes. 2002. Purification and characterization of an extracellular protease from Xenorhabdus nematophila involved in insect immunosuppression. Appl. Environ. Microbiol. 68:1297-1304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Cowles, C. E., and H. Goodrich-Blair. 2004. Characterization of a lipoprotein, NilC, required by Xenorhabdus nematophila for mutualism with its nematode host. Mol. Microbiol. 54:464-477. [DOI] [PubMed] [Google Scholar]
  • 11.Cowles, C. E., and H. Goodrich-Blair. 2006. nilR is necessary for co-ordinate repression of Xenorhabdus nematophila mutualism genes. Mol. Microbiol. 62:760-771. [DOI] [PubMed] [Google Scholar]
  • 12.Cowles, K. N., C. E. Cowles, G. R. Richards, E. C. Martens, and H. Goodrich-Blair. 2007. The global regulator Lrp contributes to mutualism, pathogenesis and phenotypic variation in the bacterium Xenorhabdus nematophila. Cell. Microbiol. 9:1311-1323. [DOI] [PubMed] [Google Scholar]
  • 13.Cowles, K. N., and H. Goodrich-Blair. 2005. Expression and activity of a Xenorhabdus nematophila haemolysin required for full virulence towards Manduca sexta insects. Cell. Microbiol. 7:209-219. [DOI] [PubMed] [Google Scholar]
  • 14.Danese, P. N., G. R. Oliver, K. Barr, G. D. Bowman, P. D. Rick, and T. J. Silhavy. 1998. Accumulation of the enterobacterial common antigen lipid II biosynthetic intermediate stimulates degP transcription in Escherichia coli. J. Bacteriol. 180:5875-5884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Danese, P. N., and T. J. Silhavy. 1997. The sigma(E) and the Cpx signal transduction systems control the synthesis of periplasmic protein-folding enzymes in Escherichia coli. Genes Dev. 11:1183-1193. [DOI] [PubMed] [Google Scholar]
  • 16.Danese, P. N., W. B. Snyder, C. L. Cosma, L. J. Davis, and T. J. Silhavy. 1995. The Cpx two-component signal transduction pathway of Escherichia coli regulates transcription of the gene specifying the stress-inducible periplasmic protease, DegP. Genes Dev. 9:387-398. [DOI] [PubMed] [Google Scholar]
  • 17.Dartigalongue, C., and S. Raina. 1998. A new heat-shock gene, ppiD, encodes a peptidyl-prolyl isomerase required for folding of outer membrane proteins in Escherichia coli. EMBO J. 17:3968-3980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.De Wulf, P., O. Kwon, and E. C. Lin. 1999. The CpxRA signal transduction system of Escherichia coli: growth-related autoactivation and control of unanticipated target operons. J. Bacteriol. 181:6772-6778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.De Wulf, P., A. M. McGuire, X. Liu, and E. C. Lin. 2002. Genome-wide profiling of promoter recognition by the two-component response regulator CpxR-P in Escherichia coli. J. Biol. Chem. 277:26652-26661. [DOI] [PubMed] [Google Scholar]
  • 20.DiGiuseppe, P. A., and T. J. Silhavy. 2003. Signal detection and target gene induction by the CpxRA two-component system. J. Bacteriol. 185:2432-2440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Dorel, C., O. Vidal, C. Prigent-Combaret, I. Vallet, and P. Lejeune. 1999. Involvement of the Cpx signal transduction pathway of E. coli in biofilm formation. FEMS Microbiol. Lett. 178:169-175. [DOI] [PubMed] [Google Scholar]
  • 22.Feldman, M., and G. Segal. 2004. A specific genomic location within the icm/dot pathogenesis region of different Legionella species encodes functionally similar but nonhomologous virulence proteins. Infect. Immun. 72:4503-4511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Fernández, L. A., and J. Berenguer. 2000. Secretion and assembly of regular surface structures in Gram-negative bacteria. FEMS Microbiol. Rev. 24:21-44. [DOI] [PubMed] [Google Scholar]
  • 24.Forst, S., and B. Boylan. 2002. Characterization of the pleiotropic phenotype of an ompR strain of Xenorhabdus nematophila. Antonie Leeuwenhoek 81:43-49. [DOI] [PubMed] [Google Scholar]
  • 25.Forst, S., and D. Clarke. 2002. Bacteria-nematode symbioses, p. 57-77. In R. Gaugler (ed.), Entomopathogenic nematology. CABI Publishing, Wallingford, United Kingdom.
  • 26.Forst, S., B. Dowds, N. Boemare, and E. Stackebrandt. 1997. Xenorhabdus and Photorhabdus spp.: bugs that kill bugs. Annu. Rev. Microbiol. 51:47-72. [DOI] [PubMed] [Google Scholar]
  • 27.Forst, S., and K. Nealson. 1996. Molecular biology of the symbiotic-pathogenic bacteria Xenorhabdus spp. and Photorhabdus spp. Microbiol. Rev. 60:21-43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Gal-Mor, O., and G. Segal. 2003. Identification of CpxR as a positive regulator of icm and dot virulence genes of Legionella pneumophila. J. Bacteriol. 185:4908-4919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Gillespie, J. P., M. R. Kanost, and T. Trenczek. 1997. Biological mediators of insect immunity. Annu. Rev. Entomol. 42:611-643. [DOI] [PubMed] [Google Scholar]
  • 30.Givaudan, A., and A. Lanois. 2000. flhDC, the flagellar master operon of Xenorhabdus nematophilus: requirement for motility, lipolysis, extracellular hemolysis, and full virulence in insects. J. Bacteriol. 182:107-115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Goodrich-Blair, H., and D. J. Clarke. 2007. Mutualism and pathogenesis in Xenorhabdus and Photorhabdus: two roads to the same destination. Mol. Microbiol. 64:260-268. [DOI] [PubMed] [Google Scholar]
  • 32.He, H., H. A. Snyder, and S. Forst. 2004. Unique organization and regulation of the mrx fimbrial operon in Xenorhabdus nematophila. Microbiology 150:1439-1446. [DOI] [PubMed] [Google Scholar]
  • 33.Herbert, E. E., and H. Goodrich-Blair. 2007. Friend and foe: the two faces of Xenorhabdus nematophila. Nat. Rev. Microbiol. 5:634-646. [DOI] [PubMed] [Google Scholar]
  • 34.Heungens, K., C. E. Cowles, and H. Goodrich-Blair. 2002. Identification of Xenorhabdus nematophila genes required for mutualistic colonization of Steinernema carpocapsae nematodes. Mol. Microbiol. 45:1337-1353. [DOI] [PubMed] [Google Scholar]
  • 35.Heusipp, G., K. M. Nelson, M. A. Schmidt, and V. L. Miller. 2004. Regulation of htrA expression in Yersinia enterocolitica. FEMS Microbiol. Lett. 231:227-235. [DOI] [PubMed] [Google Scholar]
  • 36.Humphreys, S., G. Rowley, A. Stevenson, M. F. Anjum, M. J. Woodward, S. Gilbert, J. Kormanec, and M. Roberts. 2004. Role of the two-component regulator CpxAR in the virulence of Salmonella enterica serotype Typhimurium. Infect. Immun. 72:4654-4661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hung, D. L., T. L. Raivio, C. H. Jones, T. J. Silhavy, and S. J. Hultgren. 2001. Cpx signaling pathway monitors biogenesis and affects assembly and expression of P pili. EMBO J. 20:1508-1518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Ji, D., and Y. Kim. 2004. An entomopathogenic bacterium, Xenorhabdus nematophila, inhibits the expression of an antibacterial peptide, cecropin, of the beet armyworm, Spodoptera exigua. J. Insect Physiol. 50:489-496. [DOI] [PubMed] [Google Scholar]
  • 39.Jones, C. H., P. N. Danese, J. S. Pinkner, T. J. Silhavy, and S. J. Hultgren. 1997. The chaperone-assisted membrane release and folding pathway is sensed by two signal transduction systems. EMBO J. 16:6394-6406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Jubelin, G., A. Vianney, C. Beloin, J. M. Ghigo, J. C. Lazzaroni, P. Lejeune, and C. Dorel. 2005. CpxR/OmpR interplay regulates curli gene expression in response to osmolarity in Escherichia coli. J. Bacteriol. 187:2038-2049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Kanost, M. R., H. Jiang, and X. Q. Yu. 2004. Innate immune responses of a lepidopteran insect, Manduca sexta. Immunol. Rev. 198:97-105. [DOI] [PubMed] [Google Scholar]
  • 42.Leclerc, G. J., C. Tartera, and E. S. Metcalf. 1998. Environmental regulation of Salmonella typhi invasion-defective mutants. Infect. Immun. 66:682-691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Martens, E. C., and H. Goodrich-Blair. 2005. The Steinernema carpocapsae intestinal vesicle contains a subcellular structure with which Xenorhabdus nematophila associates during colonization initiation. Cell. Microbiol. 7:1723-1735. [DOI] [PubMed] [Google Scholar]
  • 44.Martens, E. C., K. Heungens, and H. Goodrich-Blair. 2003. Early colonization events in the mutualistic association between Steinernema carpocapsae nematodes and Xenorhabdus nematophila bacteria. J. Bacteriol. 185:3147-3154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.McBroom, A. J., and M. J. Kuehn. 2007. Release of outer membrane vesicles by Gram-negative bacteria is a novel envelope stress response. Mol. Microbiol. 63:545-558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.McCann, J., E. V. Stabb, D. S. Millikan, and E. G. Ruby. 2003. Population dynamics of Vibrio fischeri during infection of Euprymna scolopes. Appl. Environ. Microbiol. 69:5928-5934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.McCarter, L. L. 2006. Regulation of flagella. Curr. Opin. Microbiol. 9:180-186. [DOI] [PubMed] [Google Scholar]
  • 48.Mileykovskaya, E., and W. Dowhan. 1997. The Cpx two-component signal transduction pathway is activated in Escherichia coli mutant strains lacking phosphatidylethanolamine. J. Bacteriol. 179:1029-1034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Mitobe, J., E. Arakawa, and H. Watanabe. 2005. A sensor of the two-component system CpxA affects expression of the type III secretion system through posttranscriptional processing of InvE. J. Bacteriol. 187:107-113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Nakayama, S., A. Kushiro, T. Asahara, R. Tanaka, L. Hu, D. J. Kopecko, and H. Watanabe. 2003. Activation of hilA expression at low pH requires the signal sensor CpxA, but not the cognate response regulator CpxR, in Salmonella enterica serovar Typhimurium. Microbiology 149:2809-2817. [DOI] [PubMed] [Google Scholar]
  • 51.Nakayama, S., and H. Watanabe. 1998. Identification of cpxR as a positive regulator essential for expression of the Shigella sonnei virF gene. J. Bacteriol. 180:3522-3528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Nakayama, S., and H. Watanabe. 1995. Involvement of cpxA, a sensor of a two-component regulatory system, in the pH-dependent regulation of expression of Shigella sonnei virF gene. J. Bacteriol. 177:5062-5069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Orchard, S. S., and H. Goodrich-Blair. 2004. Identification and functional characterization of a Xenorhabdus nematophila oligopeptide permease. Appl. Environ. Microbiol. 70:5621-5627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Otto, K., and T. J. Silhavy. 2002. Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway. Proc. Natl. Acad. Sci. USA 99:2287-2292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Park, D., and S. Forst. 2006. Co-regulation of motility, exoenzyme and antibiotic production by the EnvZ-OmpR-FlhDC-FliA pathway in Xenorhabdus nematophila. Mol. Microbiol. 61:1397-1412. [DOI] [PubMed] [Google Scholar]
  • 56.Park, Y., E. E. Herbert, C. E. Cowles, K. N. Cowles, M. L. Menard, S. S. Orchard, and H. Goodrich-Blair. 2007. Clonal variation in Xenorhabdus nematophila virulence and suppression of Manduca sexta immunity. Cell. Microbiol. 9:645-656. [DOI] [PubMed] [Google Scholar]
  • 57.Park, Y., and Y. Kim. 2000. Eicosanoids rescue Spodoptera exigua infected with Xenorhabdus nematophilus, the symbiotic bacteria to the entomopathogenic nematode Steinernema carpocapsae. J. Insect Physiol. 46:1469-1476. [DOI] [PubMed] [Google Scholar]
  • 58.Park, Y., Y. Kim, H. Tunaz, and D. W. Stanley. 2004. An entomopathogenic bacterium, Xenorhabdus nematophila, inhibits hemocytic phospholipase A2 (PLA2) in tobacco hornworms Manduca sexta. J. Invertebr. Pathol. 86:65-71. [DOI] [PubMed] [Google Scholar]
  • 59.Pogliano, J., A. S. Lynch, D. Belin, E. C. Lin, and J. Beckwith. 1997. Regulation of Escherichia coli cell envelope proteins involved in protein folding and degradation by the Cpx two-component system. Genes Dev. 11:1169-1182. [DOI] [PubMed] [Google Scholar]
  • 60.Popiel, I., D. L. Grove, and M. J. Friedman. 1989. Infective juvenile formation in the insect parasitic nematode Steinernema feltiae. Parasitology 99:77-81. [Google Scholar]
  • 61.Raivio, T. L. 2005. Envelope stress responses and Gram-negative bacterial pathogenesis. Mol. Microbiol. 56:1119-1128. [DOI] [PubMed] [Google Scholar]
  • 62.Raivio, T. L., M. W. Laird, J. C. Joly, and T. J. Silhavy. 2000. Tethering of CpxP to the inner membrane prevents spheroplast induction of the Cpx envelope stress response. Mol. Microbiol. 37:1186-1197. [DOI] [PubMed] [Google Scholar]
  • 63.Raivio, T. L., D. L. Popkin, and T. J. Silhavy. 1999. The Cpx envelope stress response is controlled by amplification and feedback inhibition. J. Bacteriol. 181:5263-5272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Raivio, T. L., and T. J. Silhavy. 2001. Periplasmic stress and ECF sigma factors. Annu. Rev. Microbiol. 55:591-624. [DOI] [PubMed] [Google Scholar]
  • 65.Raivio, T. L., and T. J. Silhavy. 1999. The σE and Cpx regulatory pathways: overlapping but distinct envelope stress responses. Curr. Opin. Microbiol. 2:159-165. [DOI] [PubMed] [Google Scholar]
  • 66.Raivio, T. L., and T. J. Silhavy. 1997. Transduction of envelope stress in Escherichia coli by the Cpx two-component system. J. Bacteriol. 179:7724-7733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.R Development Core Team. 2006. R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria.
  • 68.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • 69.Sauer, F. G., M. A. Mulvey, J. D. Schilling, J. J. Martinez, and S. J. Hultgren. 2000. Bacterial pili: molecular mechanisms of pathogenesis. Curr. Opin. Microbiol. 3:65-72. [DOI] [PubMed] [Google Scholar]
  • 70.Sicard, M., K. Brugirard-Ricaud, S. Pages, A. Lanois, N. E. Boemare, M. Brehelin, and A. Givaudan. 2004. Stages of infection during the tripartite interaction between Xenorhabdus nematophila, its nematode vector, and insect hosts. Appl. Environ. Microbiol. 70:6473-6480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Sierra, G. 1957. A simple method for the detection of lipolytic activity of micro-organisms and some observations on the influence of the contact between cells and fatty substrates. Antonie Leeuwenhoek 23:15-22. [DOI] [PubMed] [Google Scholar]
  • 72.Simon, R., U. Priefer, and A. Pühler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Bio/Technology 1:784-791. [Google Scholar]
  • 73.Tapparel, C., A. Monod, and W. L. Kelley. 2006. The DNA-binding domain of the Escherichia coli CpxR two-component response regulator is constitutively active and cannot be fully attenuated by fused adjacent heterologous regulatory domains. Microbiology 152:431-441. [DOI] [PubMed] [Google Scholar]
  • 74.Vigneux, F., R. Zumbihl, G. Jubelin, C. Ribeiro, J. Poncet, S. Baghdiguian, A. Givaudan, and M. Brehelin. 2007. The xaxAB genes encoding a new apoptotic toxin from the insect pathogen Xenorhabdus nematophila are present in plant and human pathogens. J. Biol. Chem. 282:9571-9580. [DOI] [PubMed] [Google Scholar]
  • 75.Vincent, C. D., B. A. Buscher, J. R. Friedman, L. A. Williams, P. Bardill, and J. P. Vogel. 2006. Identification of non-dot/icm suppressors of the Legionella pneumophila ΔdotL lethality phenotype. J. Bacteriol. 188:8231-8243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Visick, K. L., and L. M. Skoufos. 2001. Two-component sensor required for normal symbiotic colonization of Euprymna scolopes by Vibrio fischeri. J. Bacteriol. 183:835-842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Vivas, E. I., and H. Goodrich-Blair. 2001. Xenorhabdus nematophilus as a model for host-bacterium interactions: rpoS is necessary for mutualism with nematodes. J. Bacteriol. 183:4687-4693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Xu, J., and R. E. Hurlbert. 1990. Toxicity of irradiated media for Xenorhabdus spp. Appl. Environ. Microbiol. 56:815-818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Yamamoto, K., and A. Ishihama. 2006. Characterization of copper-inducible promoters regulated by CpxA/CpxR in Escherichia coli. Biosci. Biotechnol. Biochem. 70:1688-1695. [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES