Skip to main content
Eukaryotic Cell logoLink to Eukaryotic Cell
. 2007 Oct 26;6(12):2194–2205. doi: 10.1128/EC.00299-07

Role of DNA Mismatch Repair and Double-Strand Break Repair in Genome Stability and Antifungal Drug Resistance in Candida albicans

Melanie Legrand 1, Christine L Chan 1, Peter A Jauert 1, David T Kirkpatrick 1,*
PMCID: PMC2168241  PMID: 17965250

Abstract

Drug resistance has become a major problem in the treatment of Candida albicans infections. Genome changes, such as aneuploidy, translocations, loss of heterozygosity, or point mutations, are often observed in clinical isolates that have become resistant to antifungal drugs. To determine whether these types of alterations result when DNA repair pathways are eliminated, we constructed yeast strains bearing deletions in six genes involved in mismatch repair (MSH2 and PMS1) or double-strand break repair (MRE11, RAD50, RAD52, and YKU80). We show that the mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ mutants are slow growing and exhibit a wrinkly colony phenotype and that cultures of these mutants contain abundant elongated pseudohypha-like cells. These same mutants are susceptible to hydrogen peroxide, tetrabutyl hydrogen peroxide, UV radiation, camptothecin, ethylmethane sulfonate, and methylmethane sulfonate. The msh2Δ/msh2Δ, pms1Δ/pms1Δ, and yku80Δ/yku80Δ mutants exhibit none of these phenotypes. We observed an increase in genome instability in mre11Δ/mre11Δ and rad50Δ/rad50Δ mutants by using a GAL1/URA3 marker system to monitor the integrity of chromosome 1. We investigated the acquisition of drug resistance in the DNA repair mutants and found that deletion of mre11Δ/mre11Δ, rad50Δ/rad50Δ, or rad52Δ/rad52Δ leads to an increased susceptibility to fluconazole. Interestingly, we also observed an elevated frequency of appearance of drug-resistant colonies for both msh2Δ/msh2Δ and pms1Δ/pms1Δ (MMR mutants) and rad50Δ/rad50Δ (DSBR mutant). Our data demonstrate that defects in double-strand break repair lead to an increase in genome instability, while drug resistance arises more rapidly in C. albicans strains lacking mismatch repair proteins or proteins central to double-strand break repair.


Candida albicans is the single most important human fungal pathogen. Although C. albicans is normally a commensal, candidiasis may result when the host becomes debilitated or immunosuppressed. A 25 to 60% mortality rate associated with disseminated infection has been reported (11), due in part to the limited number of antifungal agents available and in part to increasing resistance to the most popularly used drug, fluconazole.

The three main classes of drugs used to treat Candida infections are polyenes (amphotericin B), azoles (fluconazole and related compounds), and echinocandins (caspofungin). Azoles, the most commonly used drugs, target the ERG11 gene product, which encodes a lanosterol (C-14) demethylase required for ergosterol biosynthesis (30). Unfortunately, acquired resistance to azoles is becoming a serious clinical problem.

The development of azole resistance in C. albicans has been well characterized. Acquisition of resistance has been shown to be associated with point mutations in the ERG11 gene or in the promoter region of drug transporters (17, 31). Several studies have shown that point mutations in the ERG11 gene can result in amino acid alterations that change the protein's affinity for fluconazole, while point mutations in the promoter of CDR1 result in overexpression of the pump. Other studies demonstrated that gross chromosome rearrangements, such as chromosome gain or loss or isochromosome formation (14, 25), occur in clinical isolates that have become drug resistant. However, the biological mechanisms that lead to these alterations have not been determined.

In many organisms, cells deficient in DNA mismatch repair (MMR) exhibit a mutator phenotype in which the rate of spontaneous mutation is greatly elevated (6, 10). The MMR pathway acts to remove bases that are mispaired as a result of a failure during replication, illustrated by the functional interaction of the MMR proteins with the DNA replication factor PCNA (5, 8). The MMR pathway also plays a role in maintaining the stability of certain types of repetitive DNA tracts (28). This pathway was first described in Escherichia coli, where MutS and MutL bind to the mismatch, activating the MutH endonuclease. Multiple MutS and MutL homologues have been characterized in Saccharomyces cerevisiae (13, 24). Null mutations in MSH2 (MutS homolog) or PMS1 (MutL homolog) cause an increase in base substitutions and insertion/deletion in simple sequence repeats in S. cerevisiae (23, 32).

Cells that are deficient in double-strand break (DSB) repair (DSBR) exhibit an elevated level of genome instability. DNA DSBs are the most dangerous form of DNA damage; failure to repair a DSB leads to loss of the fragment lacking a centromere, while improper repair can generate translocations, inversions, or deletions. Cells possess two major pathways for DSBR, homologous recombination (HR), which requires the presence of an intact second copy of the broken DNA, and nonhomologous end joining (NHEJ), in which the ends of the broken DNA molecules are religated (12, 15, 22). In S. cerevisiae, the RAD50 and MRE11 proteins are involved in the early steps of DSBR and are required for both HR and NHEJ (1). In contrast, the RAD52 protein plays a central role in HR but does not act during NHEJ, while the YKU80 protein is required during NHEJ but not during HR (20).

MMR and DSBR play a major role in maintaining genome fidelity and stability. Because defects in the MMR pathway lead to point mutations and instability of repetitive DNA tracts, while defects in the DSBR pathway cause gross chromosome rearrangements, we investigated MMR and DSBR involvement in genome stability and antifungal drug resistance acquisition in C. albicans. We constructed strains bearing null mutations in both copies of six genes involved in MMR or DSBR and characterized their phenotypes by testing their sensitivity to several DNA-damaging agents, monitoring the integrity of chromosome 1 by using a GAL1/URA3 marker system, and determining their ability to become resistant to antifungal drugs.

In this study, we show that the mutants defective in HR (mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ) have a slow-growth phenotype and produce wrinkled colonies with pseudohypha-like cells whereas the colonies of the msh2Δ/msh2Δ, pms1Δ/pms1Δ, and yku80Δ/yku80Δ mutants are smooth, appearing identical to wild-type colonies. We also observed that mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ strains are susceptible to hydrogen peroxide (H2O2), tetrabutyl hydrogen peroxide (TBHP), UV radiation, camptothecin, ethylmethane sulfonate (EMS), and methylmethane sulfonate (MMS), whereas the msh2Δ/msh2Δ, pms1Δ/pms1Δ, and yku80Δ/yku80Δ mutants are not. There is an increase in the rate of appearance of 2-deoxygalactose-resistant (2-DGr) and 5-fluoroorotic acid-resistant (5-FOAr) colonies in the mre11Δ/mre11Δ and rad50Δ/rad50Δ mutants, reflecting an increase in genome instability in these mutants. Using E-test strips, we found that deletion of some of the DSBR genes leads to an increased susceptibility to some antifungal drugs. Interestingly, we saw an increase in the appearance of drug-resistant colonies inside the inhibition ellipse for both msh2Δ/msh2Δ and pms1Δ/pms1Δ (MMR mutants) and rad50Δ/rad50Δ (DSBR mutant).

MATERIALS AND METHODS

Strains and media.

The yeast strains used in this study are described in Table 1. C. albicans and S. cerevisiae strains were maintained on YEPD medium (1% yeast extract, 2% peptone, 2% dextrose) supplemented with 20 mg/liter uridine (YEPD+Uri) at 30°C.

TABLE 1.

Yeast strains used in this study

Strain Source Phenotype Relevant genotypea
C. albicans
    SN76 Ura His Arg arg4/arg4 his1/his1 ura3::imm434/ura3::imm434iro1::imm434/iro1::imm434
    DKCa39 SN76 His Arg GAL1/gal1Δ::URA3
    DKCa43 DKCa39 Prototroph pms1Δ::CdHIS1/pms1Δ::CdARG4
    DKCa61 DKCa39 Prototroph pms1Δ::CdHIS1/pms1Δ::CdARG4
    DKCa33 DKCa39 Prototroph msh2Δ::CdHIS1/msh2Δ::CdARG4
    DKCa98 DKCa39 Prototroph msh2Δ::CdHIS1/msh2Δ::CdARG4
    DKCa58 DKCa39 Prototroph mre11Δ::CdHIS1/mre11Δ::CdARG4
    DKCa95 DKCa39 Prototroph mre11Δ::CdHIS1/mre11Δ::CdARG4
    DKCa67 DKCa39 Prototroph rad50Δ::CdHIS1/rad50Δ::CdARG4
    DKCa127 DKCa39 Prototroph rad50Δ::CdHIS1/rad50Δ::CdARG4
    DKCa78 DKCa39 Prototroph yku80Δ::CdHIS1/yku80Δ::CdARG4
    DKCa112 DKCa39 Prototroph yku80Δ::CdHIS1/yku80Δ::CdARG4
    DKCa96 DKCa39 Prototroph rad52Δ::CdHIS1/rad52Δ::CdARG4
    DKCa97 DKCa39 Prototroph rad52Δ::CdHIS1/rad52Δ::CdARG4
    DKCa496 DKCa43 Arg pms1Δ::CdHIS1/pms1Δ::NAT1-PMS1
    DKCa511 DKCa61 Arg pms1Δ::CdHIS1/pms1Δ::NAT1-PMS1
    DKCa780 DKCa33 Arg msh2Δ::CdHIS1/msh2Δ::NAT1-MSH2
    DKCa781 DKCa98 Arg msh2Δ::CdHIS1/msh2Δ::NAT1-MSH2
    DKCa225 DKCa58 Arg mre11Δ::CdHIS1/mre11Δ::NAT1-MRE11
    DKCa228 DKCa95 Arg mre11Δ::CdHIS1/mre11Δ::NAT1-MRE11
    DKCa456 DKCa67 Arg rad50Δ::CdHIS1/rad50Δ::NAT1-RAD50
    DKCa457 DKCa127 Arg rad50Δ::CdHIS1/rad50Δ::NAT1-RAD50
    DKCa461 DKCa78 Arg yku80Δ::CdHIS1/yku80Δ::NAT1-YKU80
    DKCa465 DKCa112 Arg yku80Δ::CdHIS1/yku80Δ::NAT1-YKU80
    DKCa255 DKCa96 His rad52Δ::NAT1-RAD52/rad52Δ::CdARG4
S. cerevisiae
    BY4743 His Leu Ura MATahis3Δ/his3Δ leu2Δ/leu2Δ lys2Δ/LYS2 MET15/met15Δ ura3Δ/ura3Δ
    YMR224C BY4743 His Leu Ura mre11Δ/mre11Δ
    YNL250W BY4743 His Leu Ura rad50Δ/rad50Δ
    YMR106C BY4743 His Leu Ura yku80Δ/yku80Δ
    YML032C BY4743 His Leu Ura rad52Δ/rad52Δ
a

Cd = C. dubliniensis gene.

DKCa39 was constructed by replacing one of the GAL1 alleles on chromosome 1 in the SN76 strain (21) with the URA3 gene. The gal1::URA3 cassette was amplified from AF14 (9) by PCR with oligonucleotides outside the GAL1 open reading frame (ORF) (CaGAL1+1756-F and CaGAL1-256-R). The PCR product was transformed into SN76, and transformants were selected on Uri plates.

Gene disruption and reintegration of C. albicans wild-type genes.

To construct homozygous mutant strains, both alleles were deleted by HR by a PCR-based cassette method (33) in strain DKCa39. The first allele was replaced with the Candida dubliniensis HIS1 marker, and the second allele was replaced with the C. dubliniensis ARG4 marker. The cassettes were amplified with the same set of primers since the HIS1 and ARG4 markers have been cloned into the same location in the same vector (21). The primers used in this work are listed in Table 2. Disruption cassettes were amplified with 100-mer oligonucleotides composed of 20 nucleotides that are homologous to the plasmid carrying the markers and 80 nucleotides with homology to the target locus. For disruption of the first allele, the HIS1 marker was amplified from plasmid pSN52. The PCR products were concentrated by ethanol precipitation; 1 ml of ethanol and 10 μl of 5 M NaCl were added to 500 μl of PCR products, and the mixture was incubated at room temperature for 15 min. The samples were centrifuged at 14,000 × g for 5 min to pellet the DNA, which was then washed with 500 μl of 70% ethanol and centrifuged at 14,000 × g for 1 min. After drying, the DNA was resuspended in 40 μl of TELiOAc (10 mM Tris HCl [pH 7.5], 1 mM EDTA [pH 8.0], 0.1 M lithium acetate) and incubated at 65°C for 1 h.

TABLE 2.

Oligonucleotides used in this work

Primer name Sequence (5′ → 3′)a
CaMSH2-KO-F CTATAAAGTGTCAACTATATAATTTATAAACTTGTTAGGCTCTTTAGCCAAGGAGTCAGCAATATTGATTTCTGGGTTGGCATCAAGCTTGGTACCGAGC
CaMSH2-KO-R ATGTCTAGTACCAAAATAGATCTCAAATTCAGTGACTTGGCTGATGAAAGACTGTATTTCAAGAAATATTCCCAACTTCCCCTCTAGATGCATGCTCGAG
CaPMS1-F disrupt TTGTATTATTAAACCAATATTTTCATTCGGCATTTCTACATGTCAATGCTCCCTTCGTCAAAGATAGATAGATGCGTCAGCATCAAGCTTGGTACCGAGC
CaPMS1-R disrupt GTCTACGTAATCACACATCAAAAATTGAAAATTTTGAAGATTTGGATCAGTTAACAACTTTGGGATTTAGAGGAGAAGCCCCTCTAGATGCATGCTCGAG
CaRAD50-KO-F ATGATCCATATTGAAAAACTATTTTCCTTTATTCTTCTCTTTATAGCCCTACCTTCCCCAGCATCTTTCATCAGAATGTGCATCAAGCTTGGTACCGAGC
CaRAD50-KO-R TTAGCCTTCTTGAATTCTACCAATAGGTAAACTATAAATTCTTGACTTACTACTTTCATCTCGTTGAATTCTGTAAAAACCCTCTAGATGCATGCTCGAG
CaMRE11-KO-F ATGCCATTGGTAGAACGTATAGAACCAGGACCTGACACAATTAGGGTTCTACTAACTACTGACAATCATGTAGGAGCATGCATCAAGCTTGGTACCGAGC
CaMRE11-KO-R TTATTTTCTTTTCCTGTTATTAAAGCTTCTGGAAAATATTCCTTTACTTTTACTGGGTGGAACATAATCATCTTCATCACCCTCTAGATGCATGCTCGAG
CaYKU80-KO-F ATGTCCAAGGAATTTACAGTCTTTGTTGTTGATGCATCCAAATATATGGGAATAGCAGACCCAAATGTCACGGATTCAGGCATCAAGCTTGGTACCGAGC
CaYKU80-KO-R TGTGCTGAGTTTTGTATTTGACATCTAGCTTCTTCTGCAACTCAATGGTGATCGTATCTGCTTTTTTAGGATCCGCTGTCCCTCTAGATGCATGCTCGAG
CaRAD52-KO-F ATGAACTCTAGACCTGCACCTCCGCAACCACGACCACCACAACAACAACCTCAGCAACCTCAGCAACCTCAACCCAACCGCATCAAGCTTGGTACCGAGC
CaRAD52-R disrupt TATTTCCTTATTTCTGGTTACTTTATTATCGAAAGATTTTATGAAGAAAGACAGATTATCAACATGTAATGGGAAAAGACCCTCTAGATGCATGCTCGAG
CaGAL1+1756-F GTATTGGATAACGCGACAAGC
CaGAL1-256-R GTTCGGTTTCCGGGGTTGGTG
CaGAL1+474-F ATAACCCTCCTCCTGTAGG
CaURA3+386-R TTCCCAGTGACACCATGAGC
Ca1322-2294-Chr1SNP-F ATGTAGTTATGGTCCCTGGGG
Ca1322-2294-Chr1SNP-R TTCCAAATCCAATACCCCGCCA
CaF12n4-Chr1SNP-F AGCATTTGGGTCATCCAATAACGAC
CaF12n4-Chr1SNP-R GTGATGAAGGTCTTACTGAAGTGC
a

Bold letters correspond to vector sequences from the plasmids containing the C. dubliniensis HIS1 and ARG4 genes.

To introduce DNA into the appropriate strain, we used a variation of the standard lithium acetate transformation protocol. Overnight cultures were inoculated into 50 ml of YEPD+Uri at an optical density at 600 nm (OD600) of ∼0.05 and incubated in a 30°C shaking incubator until the OD600 reached ∼0.5. Cells were pelleted, washed with 5 ml of sterile water, and resuspended in 500 μl of TELiOAc (10 mM Tris HCl [pH 7.5], 1 mM EDTA [pH 8], 0.1 M lithium acetate). Cells were transferred to a 1.5-ml Eppendorf tube, pelleted, and resuspended in 300 μl of TELiOAc. A 100-μl volume of this cell suspension was mixed with 5 μl of salmon sperm single-stranded DNA (10 mg/ml) and the transforming DNA and then incubated at room temperature for 30 min. A 700-μl volume of PLATE mix (10 mM Tris HCl [pH 7.5], 1 mM EDTA [pH 8], 0.1 M lithium acetate, 50% polyethylene glycol 3350) was added and mixed by pipetting slowly. The mixture was incubated at room temperature overnight and then heat shocked at 42°C for 1 h. Cells were pelleted, resuspended in 200 μl of sterile water, and plated onto the appropriate medium. Plates were incubated at 30°C for 3 days.

Transformants were first screened by colony PCR with primers positioned within the marker sequence and outside the integration site, checking one side of the integration. Positive transformants were cultured for DNA extraction, and both boundaries of the integration site were verified by PCR. For disruption of the second allele, the ARG4 marker was amplified from plasmid pSN69. Transformants were constructed and analyzed as described above. An additional PCR with oligonucleotides inside the target gene was performed on those transformants to confirm the absence of the target gene. For each gene, two independent homozygous diploid mutants were independently constructed.

Reintegration strains were constructed by targeting a wild-type copy of the appropriate gene to its endogenous locus with the NAT1-FLP cassette (26). The ORF (including the promoter region) was cloned on one side of the NAT1-FLP cassette in the pJK863 (or NAT flipper) plasmid (26), while the terminator region was introduced on the other side of the cassette. The reintegration cassettes were excised with SacII and transformed into the homozygous deletion strains. The transformed cells were first plated onto YEPD+Uri agar and incubated at 30°C overnight. The plates were then replica plated onto YEPD+Uri-nourseothricin (250 μg/ml) agar to select for transformants and incubated at 30°C overnight. Colonies were patched onto YEPD+Uri agar and then replicated on His and Arg media to screen for transformants that integrated the reintegration cassette at the appropriate locus. Positive transformants are auxotrophic for either histidine or arginine because the reintegration cassette replaces either the HIS1 or the ARG4 marker used for gene deletion. These reintegration strains were confirmed by PCR (data not shown).

Growth rate determination.

A 50-ml volume of liquid YEPD+Uri was inoculated with sufficient cells from an overnight culture to achieve an OD600 of 0.05. The OD600 was measured every hour with a spectrophotometer. Doubling times were determined in two independent experiments with the formula Doubling time = ln2 × (t/(lnb − lna), where t is the time period in hours, a is the OD600 at the beginning of the time period, and b is the OD600 at the end of the time period. The data are presented as means ± 1 standard deviation.

Chlamydospore formation.

Chlamydospore growth was induced on medium containing 1.7% cornmeal agar and 0.5% Tween 80. To induce chlamydospore formation, a single colony was streaked onto cornmeal-Tween agar. Coverslips were placed on top of the streaks, and plates were kept at room temperature in the dark. After 5 days, cells were examined under a Nikon E600 microscope to detect chlamydospore formation.

Colony and cell morphology.

To study the colony morphology of the mutants, frozen cells were streaked onto YEPD+Uri plates and incubated at 30°C for 48 h. Pictures of colonies on agar plates were taken with a Nikon CoolPIX900 camera attached to a Zeiss Stemi DRC microscope. To study the cell morphology of the mutants, cells from liquid cultures grown at 30°C overnight were examined under a Nikon E600 microscope.

Filamentation assay.

To assay C. albicans hyphal growth, cells grown overnight were transferred to 5 ml of Spider medium (1% nutrient broth, 1% mannitol, 0.2% K2HPO4) or YEPD+Uri containing 10% adult bovine serum and grown in a 37°C shaker for 1 h. Cells were then examined under a Nikon E600 microscope.

DNA-damaging agent. (i) Oxidizing agent sensitivity.

Two protocols were used to determine sensitivity to oxidizing agents. For the first, overnight cultures were diluted in water to an OD600 of 2 and 10-fold dilutions were spotted onto YEPD+Uri plates containing 4 mM H2O2, 0.1 mM menadione, or 2 mM TBHP and incubated at 30°C for 24 h. For further H2O2 susceptibility characterization, we tested wild-type and mutant strains in liquid medium. Cells were inoculated into 2 ml of YEPD+Uri and grown overnight at 30°C. The next morning, 100 μl of the overnight cultures was inoculated into 5 ml of YEPD+Uri or 5 ml of YEPD+Uri plus 4 mM H2O2. Cultures were grown at 30°C for 2 h, and then 100 μl of a 1:10,000 or a 1:100,000 dilution was plated onto YEPD+Uri plates. After incubation at 30°C for 48 h, colonies were counted and the survival percentage was calculated for each strain. The assay was repeated four times.

(ii) UV sensitivity.

Overnight cultures were diluted in water to an OD600 of 2, and 10-fold dilutions were spotted onto YEPD+Uri plates. The plates were immediately irradiated with the indicated doses of UV light, wrapped in foil, and incubated at 30°C for 24 h.

(iii) Alkylating agents.

Overnight cultures were diluted in water to an OD600 of 2, and 10-fold dilutions were spotted onto YEPD+Uri plates containing 100 μM camptothecin, 0.03% EMS, or 0.01% MMS and incubated at 30°C for 24 h.

Chromosome 1 integrity. (i) Assay I.

Cells were grown overnight in YEPD+Uri broth at 30°C. Cells were then counted with a hemacytometer, and 100,000 cells were plated onto minimal 2-DG+ and minimal 5-FOA+ plates. Dilutions were also plated onto YEPD+Uri plates to confirm cell counting. Plates were incubated at 30°C, and the number of colonies on each plate was recorded on day 2 for the YEPD+Uri plates and on day 3 for the 2-DG+ and 5-FOA+ plates.

(ii) Assay II (fluctuation analysis).

The appropriate strains were streaked onto YEPD+Uri for single colonies and incubated at 30°C for 3 days. For each strain, 20 overnight cultures were prepared by inoculating a unique single colony into 5 ml of YEPD+Uri. The next morning, the overnight cultures were diluted in water. Fifty or 100 μl of the 10−8 dilution was plated onto YEPD+Uri plates, and 100 μl of the 10−4 or 10−5 dilution was plated onto 2-DG and 5-FOA with glass beads. Plates were incubated at 30°C. Colonies were counted on YEPD+Uri plates on day 2 and on 2-DG+ and 5-FOA+ plates on day 3. The rate of appearance of 2-DGr and 5-FOAr colonies was determined as described by Spell and Jinks-Robertson (29).

Characterization of 2-DGr and 5-FOAr colonies.

For each strain, 20 2-DGr and 20 5-FOAr colonies were patched onto 2-DG+ and 5-FOA+ plates and incubated at 30°C for 2 days. Genomic DNA was extracted from these cells and screened by PCR to assess the presence or absence of the GAL1 and URA3 genes. The oligonucleotides CaGAL1+474-F, CaGAL1-256-R, and CaURA3+386-R were used in the same PCR mixture. If the GAL1 or URA3 gene was still present in 2-DGr cells or 5-FOAr cells, respectively, the PCR product was sequenced. If the GAL1 or URA3 gene was absent in 2-DGr cells or 5-FOAr cells, respectively, we used single-nucleotide polymorphism (SNP) analysis to determine the extent of the chromosomal alterations. The SNPs used (1322-2294 and F12n4) were located on chromosome 1 on both sides of the GAL1/URA3 locus, and both of the SNP sequences contained a restriction site (see Fig. 5). The regions containing the SNPs were amplified by PCR with the oligonucleotides AF-1322-2294-F/R and XU-F12n4-F/R. A 10-μl volume of the PCR product was digested with either the BccI or the HpaII enzyme, respectively, by adding 1 μl of the enzyme buffer and 0.5 μl of the enzyme. Digestion reaction mixtures were incubated at 37°C overnight and loaded onto a 2% agarose gel.

FIG. 5.

FIG. 5.

Chromosome 1 SNP locations. This diagram shows the position of SNPs (upward-pointing triangles) 1322-2294 and F12n4 relative to the GAL1 locus. SNP 1322-2294 is located in the middle of a BccI restriction site. One of the alleles (ccatca [the bold letter represents the SNP]) contains the BccI site, while the other (ccctca) does not. SNP F12n4 is located in the middle of an HpaII restriction site. One of the alleles (atccgg) has the HpaII site, while the other (atctgg) lacks it.

Drug resistance.

Cells grown overnight were diluted to an OD600 of 0.02 in 0.85% NaCl. To distribute the inoculum evenly, a sterile cotton-tipped applicator was soaked in the dilution and used to streak the entire agar surfaces of Casitone+Uri agar plates (0.5% yeast extract, 1% sodium citrate, 0.9% Bacto Casitone, 2% glucose, 2% agar, 20 mg/liter uridine). After the plates were allowed to dry, E-test strips were applied. Plates were incubated at 35°C for a week, and pictures were taken daily.

RESULTS

Sequence analysis.

To determine if the C. albicans genome contains orthologs of MSH2, PMS1, RAD50, MRE11, RAD52, or YKU80, BLAST searches (TBLASTN) of the C. albicans database (http://www.candidagenome.org/cgi-bin/nph-BLAST) were performed with the S. cerevisiae DNA repair protein sequences as queries. A single homologue for each of the genes was detected. In pairwise BLAST comparisons, the matches have e values that vary from 1.5e−12 to 3.3e−230 (Table 3). These results suggest that the C. albicans genes are likely to be orthologs of the S. cerevisiae DNA repair genes. The ORF number, chromosome location, gene size, and sequence identity are presented in Table 3. Each gene is named for its S. cerevisiae ortholog.

TABLE 3.

Characteristics of C. albicans DNA repair genes

Repair pathway Gene ORF Chromosome Size (nt) Sequence deleteda E valueb % Identityc
MMR MSH2 orf19.3093 4 2,622 80-2543 3.9e−183 41
MMR PMS1 orf19.1605 3 2,331 −94-2606 1.8e−131 32
DSBR MRE11 orf19.6915 7 2,049 80-1970 6.7e−138 42
DSBR RAD50 orf19.1648 3 3,999 80-3920 1.7e−230 36
NHEJ YKU80 orf19.2383 R 1,830 80-1647 7.8e−13 17
HR RAD52 orf19.4208 6 1,695 80-1857 1.4e−58 26
a

Base 1 corresponds to the A of the ATG codon.

b

With TBLASTN with S. cerevisiae homolog.

c

Percent amino acid identity with S. cerevisiae homolog.

Gene disruption.

To determine the role of DNA repair in the biology of C. albicans, we constructed disruptions in genes known to be involved in MMR and DSBR in S. cerevisiae. Because C. albicans is a diploid organism, both alleles of each gene must be deleted to generate null mutants. Gene disruptions in strain DKCa39 were carried out as described in Materials and Methods. When the gene of interest was closely flanked by an adjacent gene, the disruption included most of the ORF but left 79 bp at the 5′ end and the 3′ end in order to avoid changes in the expression of the flanking genes. When the gene of interest was not directly flanked by ORFs, the deletion included the entire ORF. The extent of each deletion is given in Table 3. A HIS1 disruption cassette was constructed and transformed into DKCa39 to generate heterozygotes. Two heterozygotes were retransformed with the ARG4 disruption cassette to generate null mutants. Two nulls, one from each heterozygote, were subsequently used for phenotypic analysis. Null mutants and heterozygotes were confirmed by PCR and Southern blot analysis (data not shown). Deletion of the second copy of each MMR and DSBR gene was readily accomplished, indicating that none of the genes examined are essential for the growth of C. albicans under standard laboratory conditions.

Reintegration strains were constructed to confirm the phenotypes observed in the DNA repair mutants. A wild-type copy of the appropriate gene was reinserted at its endogenous locus by NAT1-FLP technology (26). All of the phenotypes we observed in the mutants were rescued in the reintegration strains (data not shown).

Phenotypic analysis.

We initially characterized the growth rates of the null mutant strains. The mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ mutants exhibit a slow-growth phenotype compared to the wild type, while the msh2Δ/msh2Δ, pms1Δ/pms1Δ, and yku80Δ/yku80Δ mutants have a doubling time similar to that of the parental strain. The doubling times are presented in Table 4.

TABLE 4.

Doubling times of C. albicans DNA repair mutants

Strain Repair pathway Genotype Mean doubling time (h) ± SD
DKCa39 Wild type 1.09 ± 0.13
DKCa33 MMR msh2Δ/msh2Δ 1.17 ± 0.13
DKCa98 msh2Δ/msh2Δ 1.25 ± 0.11
DKCa43 pms1Δ/pms1Δ 1.35 ± 0.08
DKCa61 pms1Δ/pms1Δ 1.28 ± 0.23
DKCa58 DSBR (both HR and NHEJ) mre11Δ/mre11Δ 2.03 ± 0.77
DKCa95 mre11Δ/mre11Δ 1.79 ± 0.44
DKCa67 rad50Δ/rad50Δ 1.65 ± 0.2
DKCa127 rad50Δ/rad50Δ 1.46 ± 0.13
DKCa96 DSBR (HR only) rad52Δ/rad52Δ 1.78 ± 0.27
DKCa97 rad52Δ/rad52Δ 1.94 ± 0.15
DKCa78 DSBR (NHEJ only) yku80Δ/yku80Δ 1.22 ± 0.08
DKCa112 yku80Δ/yku80Δ 1.13 ± 0.13

We also observed that the colony morphologies of the HR null mutants differ significantly from that of the wild type. The mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ colonies exhibit a wrinkly phenotype on YEPD+Uri agar at 30°C, whereas colonies of the msh2Δ/msh2Δ, pms1Δ/pms1Δ, and yku80Δ/yku80Δ mutants are smooth, identical to the wild-type colonies (Fig. 1 top). In YEPD+Uri broth, the msh2Δ/msh2Δ, pms1Δ/pms1Δ, and yku80Δ/yku80Δ cultures contain only yeast cells, similar to the parental strain, whereas the mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ cultures contain yeast cells but also abundant elongated pseudohypha-like cells (Fig. 1, bottom). The diameter-to-length ratio of the pseudohypha-like cells varied between the strains, with the mre11Δ/mre11Δ mutant exhibiting the largest ratio, followed by the rad50Δ/rad50Δ mutant and then the rad52Δ/rad52Δ strain.

FIG. 1.

FIG. 1.

Colony and cellular morphology of parental strain DKCa39 and DSBR mutants. (Top) Cells were streaked onto YEPD+Uri plates and incubated at 30°C for 48 h. Pictures of colonies were taken with a Nikon CoolPIX900 camera attached to a Zeiss Stemi DRC microscope. The parental strain and the yku80Δ/yku80Δ strain have a normal colony morphology; the other DSBR mutants exhibit a rough colony morphology. (Bottom) Cells from an overnight liquid YEPD+Uri culture at 30°C were examined under a Nikon E600 microscope. The majority of the mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ cells have an abnormal elongated pseudohypha-like cell shape. The mre11Δ/mre11Δ cells are extremely swollen, while the rad52Δ/rad52Δ cells are relatively narrow in comparison.

On the basis of the colony morphologies of the HR mutants, we examined the degree of filamentation in the various strains in response to serum and in Spider medium at 37°C. True hyphae were observed in all of the mutants and the parental strain (data not shown).

We also investigated another morphological characteristic of C. albicans—its ability to produce large thick-walled spores called chlamydospores, whose function is unknown. We examined chlamydospore formation in the MMR and DSBR mutants; all are capable of producing chlamydospores. There was no delay in the appearance of the chlamydospores and no difference in their frequency or appearance (data not shown).

Susceptibility to DNA-damaging agents.

In many organisms, different DNA repair mutants exhibit different susceptibilities to various types of DNA-damaging agents. We tested the responses of the MMR and DSBR mutants to numerous agents, including oxidizing agents, UV radiation, and alkylating agents, including compounds known to induce DSBs.

We tested responses to three oxidizing agents, TBHP, menadione, and H2O2 (Fig. 2). The mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ mutants are very susceptible to TBHP (at least 10-fold, 100-fold, and 100-fold growth inhibition, respectively). The rad52Δ/rad52Δ mutants are slightly susceptible to menadione, while the mre11Δ/mre11Δ and rad50Δ/rad50Δ mutants are not. In our initial plate-based assay, none of the strains were affected by H2O2, but when we tested the strains with a more sensitive liquid assay, the pattern of susceptibility was very similar to the TBHP results, with the rad52Δ/rad52Δ mutants being the most susceptible and the mre11Δ/mre11Δ and rad50Δ/rad50Δ mutants slightly less so (data not shown). Interestingly, we observed that C. albicans is more resistant to oxidizing agents than is S. cerevisiae (Fig. 2). This increased resistance may have been selected for during systemic infections, as macrophages kill invading organisms by challenge with reactive oxygen species. Finally, the msh2Δ/msh2Δ, pms1Δ/pms1Δ, and yku80Δ/yku80Δ mutants are not affected by any of the oxidizing agents we tested (data not shown).

FIG. 2.

FIG. 2.

Sensitivities of C. albicans (Ca) and S. cerevisiae (Sc) HR mutants to various oxidizing agents. Cells from an overnight liquid YEPD+Uri culture were serially diluted; spotted onto YEPD+Uri plates containing 2 mM TBHP, 0.1 mM menadione, or 4 mM H2O2; and incubated at 30°C for 24 h. Two independent isolates of each deletion mutant are shown. The wild-type diploid S. cerevisiae strain is significantly more sensitive to TBHP and menadione than is the wild-type C. albicans strain.

The mutants and control strains were also exposed to various intensities of UV radiation. The strains that are defective in genes involved in HR (mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ) are affected by UV irradiation (Fig. 3), while the MMR msh2Δ/msh2Δ and pms1Δ/pms1Δ mutant strains and the NHEJ yku80Δ/yku80Δ mutant strains are not (data not shown). The rad52Δ/rad52Δ strain was most affected by UV exposure, while the rad50Δ/rad50Δ strain was least affected.

FIG. 3.

FIG. 3.

Sensitivities of C. albicans (Ca) and S. cerevisiae (Sc) HR mutants to UV light. Cells from an overnight liquid YEPD+Uri culture were serially diluted and spotted onto YEPD+Uri plates. The plates were then irradiated with 3.2 μW/cm2 UV light for 40 s, wrapped in foil, and incubated at 30°C for 24 h. The rad52Δ/rad52Δ strain exhibited the strongest sensitivity to UV exposure.

In S. cerevisiae, DSBR mutants exhibit susceptibility to alkylating agents that introduce DSBs. In our study, the mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ mutants were very susceptible to camptothecin, EMS, and MMS. The msh2Δ/msh2Δ, pms1Δ/pms1Δ, and yku80Δ/yku80Δ mutants exhibited a wild-type level of sensitivity (Fig. 4 and data not shown).

FIG. 4.

FIG. 4.

Sensitivities of C. albicans (Ca) and S. cerevisiae (Sc) DSBR mutants to various alkylating agents. Cells from an overnight liquid YEPD+Uri culture were serially diluted; spotted onto YEPD+Uri plates containing 100 μM camptothecin, 0.3% EMS, or 0.01% MMS; and incubated at 30°C for 24 h.

For all of the phenotypes we tested, reintegration of a wild-type gene at the endogenous locus in the mutants restores the wild-type phenotype (data not shown).

Chromosome instability assays.

To investigate the integrity of chromosome 1, we used a GAL1/URA3 marker system. The GAL1 locus is located on chromosome 1; we inserted a copy of URA3 into one allele of the GAL1 gene in order to allow us to readily distinguish between the two homologs. As this was done in the parental strain, the genotype of all of the resulting mutant derivatives is GAL1/gal1::URA3. The integrity of chromosome 1 was assessed by growing strains on medium containing either 2-DG, which kills GAL1+ cells, or 5-FOA, which kills URA3+ cells. The acquisition of 2-DG and 5-FOA resistance can result from several different types of events. The GAL1 or URA3 gene can still be present but nonfunctional because of point mutations in the ORF. Alternatively, the GAL1 or URA3 gene can be lost as a result of gene conversion, segmental aneuploidy, break-induced replication (BIR), a reciprocal crossover, or chromosome loss.

Initially, the frequencies of appearance of 2-DGr and 5-FOAr colonies were compared in the parental strain and the mutant strains. This first assay showed an increase in the frequency of appearance of 2-DGr and 5-FOAr colonies in the mre11Δ/mre11Δ and rad50Δ/rad50Δ mutants, whereas the frequency of appearance of 2-DGr and 5-FOAr colonies in the msh2Δ/msh2Δ, pms1Δ/pms1Δ, rad52Δ/rad52Δ, and yku80Δ/yku80Δ mutants was comparable to that in the parental strain (Table 5). To confirm and extend this result, we estimated the true rates of appearance of 2-DGr and 5-FOAr cells in the mre11Δ/mre11Δ and rad50Δ/rad50Δ mutants by fluctuation analysis as described by Spell and Jinks-Robertson (29). The fluctuation assays showed that the rates of appearance of 2-DGr and 5-FOAr cells in the mre11Δ/mre11Δ and rad50Δ/rad50Δ mutants are significantly higher than in the parental strain (Table 6).

TABLE 5.

Frequency of appearance of 2-DGr and 5-FOAr colonies in DNA repair mutant strains after 3 days

Strain Mutation Avga frequency of appearance (10−4) ± SD (n-fold increase)
2-DGr colonies 5-FOAr colonies
DKCa39 2.4 ± 0.59 1.5 ± 0.88
DKCa33 msh2Δ/msh2Δ 7.2 ± 2 (3) 2.6 ± 0.75 (1.7)
DKCa43 pms1Δ/pms1Δ 1.8 ± 0.55 (0.7) 1.3 ± 0.07 (0.9)
DKCa78 yku80Δ/yku80Δ 4.8 ± 2.6 (2) 2.9 ± 1.5 (1.9)
DKCa96 rad52Δ/rad52Δ 0.74 ± 0.14 (0.4)b 0.46 ± 0.43 (0.7)b
DKCa95 mre11Δ/mre11Δ 38 ± 13 (15.8) 12 ± 1 (8)
DKCa127 rad50Δ/rad50Δ 26 ± 6 (10.8) 13 ± 3.5 (8.7)
a

Each frequency-of-appearance value (number of events per population) is the average of three independent experiments.

b

The data for DKCa96 were collected in a separate set of experiments in which the frequency of appearance of 2-DGr colonies in the wild type was 1.8 × 10−4 and the frequency of appearance of 5-FOAr colonies in the wild type was 6.1 × 10−5.

TABLE 6.

Rate of appearance of 2-DGr and 5-FOAr colonies in DNA repair mutant strains after 3 days determined with a fluctuation test

Strain Mutation Rate of appearance (10−4) (n-fold increase)
2-DGr colonies 5-FOAr colonies
DKCa39 0.21 0.11
DKCa95 mre11Δ/mre11Δ 3 (14.3) 1.5 (13.4)
DKCa127 rad50Δ/rad50Δ >4.5 (21.4) 2.6 (23.4)

The mechanism of 2-DG or 5-FOA resistance acquisition in the parental strain and mutant strains was investigated by screening the genomic DNA of approximately 20 2-DGr and 20 5-FOAr colonies by PCR to test if the GAL1 or URA3 gene was still present (Table 7). When the gene was still present, the PCR product was sequenced to identify any point mutations that inactivated the gene. When the PCR showed that the GAL1 or the URA3 gene was absent, SNP typing was used to determine the extent of the alterations. The 1322-2294 SNP is located near the telomere of chromosome 1, while the F12n4 SNP is located close to the putative centromere of chromosome 1 but on the opposite side of the GAL1 locus (Fig. 5).

TABLE 7.

Analysis of URA3 and GAL1 alterations in 2-DGr and 5-FOAr colonies

Strain Gene disruption No. of 2-DGr colonies/total in which GAL1 was:
No. of 5-FOAr colonies/total in which URA3 was:
Deleted Present Deleted Present
DKCa39 None (wild type) 20/20 0/20 20/20 0/20
DKCa33 msh2Δ/msh2Δ 20/20 0/20 14/16 2/16c
DKCa43 pms1Δ/pms1Δ 18/20 2/20a 17/20 3/20d
DKCa58 mre11Δ/mre11Δ 20/20 0/20 20/20 0/20
DKCa67 rad50Δ/rad50Δ 20/20 0/20 20/20 0/20
DKCa78 yku80Δ/yku80Δ 20/20 0/20 16/16 0/16
DKCa96 rad52Δ/rad52Δ 18/20 2/20b 14/14 0/14
a

Both were insertions of A in the repetitive tract GTCAAAAAATTG at nucleotides 823 to 828.

b

Both were deletions of T in the repetitive tract CTGTTTTACC at nucleotides 188 to 191.

c

Deletion of A in the repetitive tract TTGAAAAAAACTG at nucleotides 793 to 799 and a change from A to C at nucleotide 94 (Thr32Pro).

d

Insertion of A in the repetitive tract TTGAAAAAAACTG at nucleotides 793 to 799, deletion of A in the repetitive tract TTGAAAAAAACTG at nucleotides 793 to 799, and a change from T to G at nucleotide 548 (Val183Gly).

Twenty 2-DGr colonies and 20 5-FOAr colonies were examined in the parental strain. All of the isolates had lost either the URA3 or the GAL1 gene, and SNP typing showed that the telomere-proximal 1322-2294 SNP had become homozygous for the same allele of the SNP, while the F12n4 SNP had remained heterozygous, indicating that a large portion of the left arm of chromosome 1 had undergone a loss-of-heterozygosity (LOH) event. The characterization of the 2-DGr and 5-FOAr colonies in the mutants showed a similar pattern—all of the resistant isolates had lost the gene and also become homozygous for the 1322-2294 SNP while retaining heterozygosity of F12n4. The only exceptions were found in the msh2Δ/msh2Δ, pms1Δ/pms1Δ, and rad52Δ/rad52Δ mutants. In the msh2Δ/msh2Δ strain, 2 (12.5%) of 16 5-FOAr isolates retained the URA3 gene; both of these isolates also retained heterozygosity at both SNP locations. In the pms1Δ/pms1Δ strain, 2 of 20 2-DGr and 3 of 20 5-FOAr (12.5% total) colonies retained the GAL1 or URA3 gene and remained heterozygous at both SNPs. Finally, 10% (2 of 20) of the 2-DGr isolates of the rad52Δ/rad52Δ strain exhibited the same pattern. For these isolates, the majority of the changes leading to 2-DG or 5-FOA resistance were alterations in repetitive tracts in the URA3 or GAL1 gene (as described in Table 7).

Drug resistance.

To determine the roles that the DNA repair genes may play in acquisition of drug resistance, we tested the susceptibility of MMR and DSBR mutants to fluconazole with an E-test assay. The E-test assay consists of plastic strips containing a gradient of an antifungal agent, in this case, fluconazole. When the E-test strip is applied to an inoculated agar plate, the drug is immediately released from the plastic strip into the agar. After incubation, a symmetrical inhibition ellipse centered along the strip can be seen. The MIC is determined by the point where the ellipse intersects the strip; the drug concentration is given in intervals along the length of the strip.

The MICs for the MMR and DSBR mutants were determined after 48 h of exposure to fluconazole E-test strips. We observed that the MIC for the msh2Δ/msh2Δ, pms1Δ/pms1Δ, and yku80Δ/yku80Δ mutants was 0.5 μg/ml, identical to that for the parental strain (data not shown). In contrast, the MICs for the mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ mutants were 0.19, 0.19, and 0.094 μg/ml, respectively (Fig. 6A), indicating that the total population of cells of these mutants was more susceptible to fluconazole than the parental cells were.

FIG. 6.

FIG. 6.

Drug resistance in C. albicans DNA repair mutants after 3 days. (A) Fluconazole (FL) E-test reading patterns for the parental strain and the HR mutants. The MICs shown are based on the scale of fluconazole concentrations imprinted on the E-test strip (in micrograms per milliliter). (B) Appearance of drug-resistant colonies inside the inhibition ellipse for the msh2Δ/msh2Δ DNA repair mutant strain. Arrows 1 to 6 point to large bright colonies within the inhibition ellipse of the msh2Δ/msh2Δ strain; these colonies are not present in the parental wild-type (WT) strain. Cells from these colonies were retested for sensitivity to fluconazole, as shown in parts 1 to 6. Four of the six initially fluconazole-resistant isolates were still resistant following retesting but exhibited various degrees of resistance.

Interestingly, large bright colonies appeared within the inhibition ellipse of the msh2Δ/msh2Δ, pms1Δ/pms1Δ, and rad50Δ/rad50Δ mutants on days 2 through 4. As shown in Fig. 6B, we retested the drug resistance of msh2Δ/msh2Δ colonies that grew within the inhibition ellipse during testing with a fluconazole E-test strip. Two-thirds of the resistant isolates remained resistant to fluconazole, although the level of resistance varied between the isolates. In another test of fluconazole-resistant isolates, an msh2Δ/msh2Δ colony (DKCa33-Rb) and a rad50Δ/rad50Δ colony (DKCa67-Ra), both of which are resistant to fluconazole at a very high level (MIC, >256 μg/ml), were still sensitive to caspofungin (MIC = 0.012 to 0.016 μg/ml) (data not shown). However, while DKCa33-Rb is also susceptible to itraconazole (MIC = 0.032 μg/ml, the same as the parental strain), DKCa67-Ra exhibited a greater degree of resistance to this azole (MIC = 0.125 μg/ml). We conclude from these data that multiple mechanisms of antifungal drug resistance are arising in the mutant strain populations.

No large bright colonies were observed in the ellipses of the parental strain or the other mutants. We did observe less-pigmented microcolonies within the ellipse of the parental strain and the msh2Δ/msh2Δ, pms1Δ/pms1Δ, and yku80Δ/yku80Δ mutants on day 5; however, upon retesting, these microcolonies did not exhibit any increase in antifungal resistance. Similar small microcolonies were seen at approximately the same time and frequency in all of the strains examined with E-test strips.

DISCUSSION

In the present work, we have investigated the function of DNA repair genes from C. albicans and the roles these genes play in genome stability and acquisition of drug resistance. We have shown that the HR mutants (mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ) are very susceptible to several DNA-damaging agents, whereas the msh2Δ/msh2Δ, pms1Δ/pms1Δ, and yku80Δ/yku80Δ mutants are not. We also observed that the mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ mutants are slow growing and produce wrinkled colonies with pseudohypha-like cells in YEPD+Uri at 30°C. We observed increased genome instability in the mre11Δ/mre11Δ and rad50Δ/rad50Δ mutants with an assay for chromosome 1 integrity. Surprisingly, deletion of some of the DSBR genes leads to an increased susceptibility to some antifungal drugs. We also observed an elevated frequency of appearance of drug-resistant colonies of the msh2Δ/msh2Δ, pms1Δ/pms1Δ, and rad50Δ/rad50Δ mutants inside the inhibition ellipse.

MSH2, PMS1, MRE11, RAD50, YKU80, and RAD52 are not essential genes in C. albicans, as we were able to construct null mutants for all of them. Nevertheless, RAD50 nulls were more difficult to obtain. This result is not likely to be due to the chromosomal location of RAD50; the ORF is not located near the centromere, telomeres, or one of the highly repetitive MRS elements, locations where gene disruptions can be more difficult to achieve. The difficulty in targeting the RAD50 sequence may be due to a local chromatin configuration that makes the sequence less accessible, to a specific function of the RAD50 protein required for HR, or to the oligonucleotide sequences.

As shown in Fig. 4 and 5, mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ are affected by oxidizing agents, UV, camptothecin, EMS, and MMS, whereas the msh2Δ/msh2Δ, pms1Δ/pms1Δ, and yku80Δ/yku80Δ mutants are not. Previous studies have shown that S. cerevisiae utilizes HR over NHEJ, while in mammals the reverse is found (16). We observed that mutations in genes involved in the HR pathway (MRE11, RAD50, and RAD52) affect the sensitivity of the mutants to DNA break-inducing compounds, while mutations in YKU80 (required for NHEJ) do not. From these data, we conclude that C. albicans preferentially uses HR to repair DNA breaks, in agreement with the work done by Larriba et al. (2, 4) on RAD52 and LIG4 in C. albicans.

We find that the mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ mutants exhibit a slow-growth phenotype. In other organisms, various types of DNA damage activate specific cell cycle checkpoints that result in arrested cell cycle progression, providing more time for repair. Because the main DNA repair proteins are absent in these mutants, cells arrest for an even longer time to allow efficient DNA repair. This hypothesis has been confirmed in the rad52Δ/rad52Δ mutants by the Larriba group (3), who showed that depletion of RAD52 in C. albicans activates the DNA damage checkpoint and that cell cycle arrest generates a polarized-growth phenotype. As their rad52Δ/rad52Δ phenotype is comparable to the phenotypes we observed in our mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ mutants, it is likely that the cell cycle checkpoint arrest hypothesis is true for RAD50 and MRE11 as well. Persistent DNA lesions in the absence of Mre11p, Rad50p, or Rad52p may trigger DNA checkpoints that result in changes in cell morphology. Work by other research groups has demonstrated that DNA checkpoint proteins are involved in morphological changes in response to a variety of DNA-damaging agents in C. albicans and other fungi (7, 18, 27).

A previous study (2) showed that mutations in LIG4, a gene shown to be involved in NHEJ in S. cerevisiae, impair myceliation in C. albicans. In our work, yku80Δ/yku80Δ NHEJ mutants did not show any defect in filament formation in response to serum and in Spider medium at 37°C. This observation suggests that the myceliation defect observed in lig4Δ/lig4Δ by Andaluz et al. is not the result of a defective NHEJ apparatus but rather may be due to a secondary function of the Lig4 protein in one of the signaling pathways controlling myceliation.

By using a GAL1/URA3 system on chromosome 1, we showed that deletion of MRE11 and RAD50 gives rise to an increased frequency of 2-DGr or 5-FOAr colonies compared to the parental strain when cells are grown on min-2-DG and min-5-FOA medium. This result indicates that the mre11Δ/mre11Δ and rad50Δ/rad50Δ mutants are more likely to lose GAL1 or URA3 function. The loss of GAL1 or URA3 function could be due to a point mutation in the ORF that would produce a nonfunctional protein or to the loss of the GAL1 or URA3 gene through gene conversion, BIR, reciprocal crossover, or segmental or total chromosome loss. To determine the relative frequencies of these events, we screened 20 2-DGr and 20 5-FOAr colonies of the parental, mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ strains by PCR to detect the presence of the GAL1 and URA3 sequences. We showed that the vast majority of the cells lost the GAL1 or URA3 gene. SNPs located on both sides of GAL1/URA3 were then used to distinguish among gene conversion, BIR, reciprocal crossovers, and segmental or total chromosome loss. If the flanking SNPs remained heterozygous in the 2-DGr or 5-FOAr strains, this would indicate that the cells lost the GAL1 or URA3 function by localized gene conversion. If the SNPs became homozygous, this would suggest that the cells underwent full-length chromosome loss. If one of the SNPs is still heterozygous while the other becomes homozygous, this would suggest that a segmental chromosome loss or BIR event took place. We observed that the majority of the 2-DGr and 5-FOAr colonies of the parental, mre11Δ/mre11Δ, rad50Δ/rad50Δ, and rad52Δ/rad52Δ strains lost GAL1 or URA3 function as a result of LOH events. Because the GAL1/URA3 locus is located 450 kb away from the telomere, it is more likely that LOH results from BIR, in which one chromosomal arm is duplicated by using the homolog as a template, rather than segmental aneuploidy. The determination of the breakage point in all of these strains is ongoing work; the data will tell us whether there is a weak spot on chromosome 1 where chromosome breaks are favored in response to stress.

When we investigated the parental strain and the other mutants, we observed the same LOH mechanism for the appearance of 2-DGr and 5-FOAr colonies. On the basis of these results, we conclude that the spectrum of alterations on chromosome 1 is unchanged between the mutants and the parental strain, but the frequency of events is greatly increased in the mre11Δ/mre11Δ and rad50Δ/rad50Δ mutant strains. Thus, the genome alterations observed on chromosome 1 with the GAL1/URA3 assay system in wild-type cells are likely to arise from a complete failure of the DSBR pathway.

Interestingly, we saw an increase in the proportion of colonies that accumulated point mutations in the GAL1 or URA3 gene for the msh2Δ/msh2Δ, pms1Δ/pms1Δ, and rad52Δ/rad52Δ mutants. After gene sequencing, we showed that the majority of the mutations were located within repetitive DNA tracts. This type of repetitive-tract instability is a known phenotype of the msh2Δ/msh2Δ and pms1Δ/pms1Δ mutants, as the MMR pathway has been shown to be involved in maintaining the stability of DNA repetitive tracts. However, DNA repetitive-tract instability is a novel phenotype of rad52Δ/rad52Δ mutants.

Loss of MMR (msh2Δ/msh2Δ and pms1Δ/pms1Δ mutants) or loss of DSBR (rad50Δ/rad50Δ) leads to an increase in fluconazole-resistant colonies, as shown in Fig. 6. Colonies of these strains appear within the inhibition ellipse of the E-test strip, whereas the wild-type parental strain and strains bearing homozygous deletions of other DNA repair genes do not exhibit this phenotype. Upon retesting, the resistant isolates exhibit various degrees of antifungal drug resistance. In other organisms, loss of MMR leads to a mutator phenotype; an increase in resistant isolates of the msh2Δ/msh2Δ and pms1Δ/pms1Δ strains would be expected in these C. albicans mutants. The appearance of colonies within E-test strip inhibition ellipses has been described in C. albicans previously; a heterogeneous population gave rise to resistant isolates, although the isolates were only resistant transiently, possibly because of an epigenetic change in the expression of drug efflux pumps (19).

The increase in resistant isolates of the mre11Δ/mre11Δ and rad50Δ/rad50Δ strains, but not of the rad52Δ/rad52Δ or yku80Δ/yku80Δ disruptant, indicates that a complete loss of DSBR is required for an increase in the frequency of antifungal drug resistance—loss of either HR or NHEJ alone is not sufficient. With regard to RAD52, this result is surprising, given the colony morphology, DNA damage sensitivity, and antifungal drug sensitivity phenotypes associated with the loss of RAD52. Examination of antifungal drug resistance development in other HR-specific gene disruptions might address this issue. If this is the case, compounds that specifically inhibit RAD52, or possibly HR, may be effective as companion drugs during treatment for Candida infections, as they would increase susceptibility to the antifungal drug without increasing the frequency of appearance of antifungal drug-resistant cells.

Our drug studies link genome instability to acquisition of drug resistance, as we have shown that cells that are defective in DSBR are generally more sensitive to the antifungal agent fluconazole but are more likely to give rise to a subpopulation of cells that have acquired resistance to fluconazole. Another link between antifungal drug resistance and genome instability has been identified by the Berman group (25). They demonstrated that Candida cells that become resistant to antifungal drugs can harbor an isochromosomal derivative of chromosome 5. Isochromosomes are chromosomal variants in which both arms of the chromosome are identical. Such derivatives may arise by aberrant HR events between sister chromatids during DSBR. Further investigation of isochromosome formation in DNA repair mutant strains might provide insight into the mechanisms of isochromosome formation. Finally, a large proportion of patients infected with C. albicans are cancer treatment patients. Cancer patients are often treated with topoisomerase inhibitors, which act against rapidly dividing cells. Fluconazole treatment of a C. albicans infection in a cancer patient undergoing therapy with topoisomerase inhibitors could favor the appearance of drug-resistant C. albicans cells, as inhibition of topoisomerases can lead to an increase in recombination.

Genome plasticity is a hallmark of C. albicans and is believed to generate diversity in an organism that propagates by clonal mitotic division, as Candida has not been demonstrated to undergo meiosis. Our data demonstrate that DNA repair pathways, the acquisition of drug resistance, and genome plasticity are linked. However, it is still unclear how C. albicans tolerates such drastic genome changes (isochromosome formation, aneuploidy, a high level of heterozygosity) and if these changes illustrate a global adaptive response of C. albicans to the various stresses the fungus encounters during the course of infection.

Acknowledgments

We thank Bebe Magee for technical assistance and Pete Magee, Judy Berman, and other members of the University of Minnesota Candida community for advice and helpful discussions during the course of this work.

This project was supported by grant 5R21-AI059664 from the National Institutes of Health.

Footnotes

Published ahead of print on 26 October 2007.

REFERENCES

  • 1.Alani, E., S. Subbiah, and N. Kleckner. 1989. The yeast RAD50 gene encodes a predicted 153-kD protein containing a purine nucleotide-binding domain and two large heptad-repeat regions. Genetics 122:47-57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Andaluz, E., R. Calderone, G. Reyes, and G. Larriba. 2001. Phenotypic analysis and virulence of Candida albicans LIG4 mutants. Infect. Immun. 69:137-147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Andaluz, E., T. Ciudad, J. Gomez-Raja, R. Calderone, and G. Larriba. 2006. Rad52 depletion in Candida albicans triggers both the DNA-damage checkpoint and filamentation accompanied by but independent of expression of hypha-specific genes. Mol. Microbiol. 59:1452-1472. [DOI] [PubMed] [Google Scholar]
  • 4.Ciudad, T., E. Andaluz, O. Steinberg-Neifach, N. F. Lue, N. A. Gow, R. A. Calderone, and G. Larriba. 2004. Homologous recombination in Candida albicans: role of CaRad52p in DNA repair, integration of linear DNA fragments and telomere length. Mol. Microbiol. 53:1177-1194. [DOI] [PubMed] [Google Scholar]
  • 5.Clark, A. B., F. Valle, K. Drotschmann, R. K. Gary, and T. A. Kunkel. 2000. Functional interaction of proliferating cell nuclear antigen with MSH2-MSH6 and MSH2-MSH3 complexes. J. Biol. Chem. 275:36498-36501. [DOI] [PubMed] [Google Scholar]
  • 6.Drotschmann, K., P. V. Shcherbakova, and T. A. Kunkel. 2000. Mutator phenotype due to loss of heterozygosity in diploid yeast strains with mutations in MSH2 and MLH1. Toxicol. Lett. 112-113:239-244. [DOI] [PubMed] [Google Scholar]
  • 7.Enserink, J. M., M. B. Smolka, H. Zhou, and R. D. Kolodner. 2006. Checkpoint proteins control morphogenetic events during DNA replication stress in Saccharomyces cerevisiae. J. Cell Biol. 175:729-741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Flores-Rozas, H., D. Clark, and R. D. Kolodner. 2000. Proliferating cell nuclear antigen and Msh2p-Msh6p interact to form an active mispair recognition complex. Nat. Genet. 26:375-378. [DOI] [PubMed] [Google Scholar]
  • 9.Forche, A., G. May, J. Beckerman, S. Kauffman, J. Becker, and P. T. Magee. 2003. A system for studying genetic changes in Candida albicans during infection. Fungal Genet. Biol. 39:38-50. [DOI] [PubMed] [Google Scholar]
  • 10.Funchain, P., A. Yeung, J. L. Stewart, R. Lin, M. M. Slupska, and J. H. Miller. 2000. The consequences of growth of a mutator strain of Escherichia coli as measured by loss of function among multiple gene targets and loss of fitness. Genetics 154:959-970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gudlaugsson, O., S. Gillespie, K. Lee, J. Vande Berg, J. Hu, S. Messer, L. Herwaldt, M. Pfaller, and D. Diekema. 2003. Attributable mortality of nosocomial candidemia, revisited. Clin. Infect. Dis. 37:1172-1177. [DOI] [PubMed] [Google Scholar]
  • 12.Haber, J. E. 2000. Lucky breaks: analysis of recombination in Saccharomyces. Mutat. Res. 451:53-69. [DOI] [PubMed] [Google Scholar]
  • 13.Kramer, W., B. Kramer, M. S. Williamson, and S. Fogel. 1989. Cloning and nucleotide sequence of DNA mismatch repair gene PMS1 from Saccharomyces cerevisiae: homology of PMS1 to procaryotic MutL and HexB. J. Bacteriol. 171:5339-5346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Legrand, M., P. Lephart, A. Forche, F. M. Mueller, T. Walsh, P. T. Magee, and B. B. Magee. 2004. Homozygosity at the MTL locus in clinical strains of Candida albicans: karyotypic rearrangements and tetraploid formation. Mol. Microbiol. 52:1451-1462. [DOI] [PubMed] [Google Scholar]
  • 15.Lewis, L. K., and M. A. Resnick. 2000. Tying up loose ends: nonhomologous end-joining in Saccharomyces cerevisiae. Mutat. Res. 451:71-89. [DOI] [PubMed] [Google Scholar]
  • 16.Lieber, M. R., and Z. E. Karanjawala. 2004. Ageing, repetitive genomes and DNA damage. Nat. Rev. Mol. Cell Biol. 5:69-75. [DOI] [PubMed] [Google Scholar]
  • 17.Looi, C. Y., E. C. D'Silva, H. F. Seow, R. Rosli, K. P. Ng, and P. P. Chong. 2005. Increased expression and hotspot mutations of the multidrug efflux transporter, CDR1 in azole-resistant Candida albicans isolates from vaginitis patients. FEMS Microbiol. Lett. 249:283-289. [DOI] [PubMed] [Google Scholar]
  • 18.Malavazi, I., C. P. Semighini, M. R. Kress, S. D. Harris, and G. H. Goldman. 2006. Regulation of hyphal morphogenesis and the DNA damage response by the Aspergillus nidulans ATM homolog AtmA. Genetics 173:99-109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Marr, K. A., C. N. Lyons, K. Ha, T. R. Rustad, and T. C. White. 2001. Inducible azole resistance associated with a heterogeneous phenotype in Candida albicans. Antimicrob. Agents Chemother. 45:52-59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Milne, G. T., S. Jin, K. B. Shannon, and D. T. Weaver. 1996. Mutations in two Ku homologs define a DNA end-joining repair pathway in Saccharomyces cerevisiae. Mol. Cell. Biol. 16:4189-4198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Noble, S. M., and A. D. Johnson. 2005. Strains and strategies for large-scale gene deletion studies of the diploid human fungal pathogen Candida albicans. Eukaryot. Cell 4:298-309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Pâques, F., and J. E. Haber. 1999. Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 63:349-404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Reenan, R. A., and R. D. Kolodner. 1992. Characterization of insertion mutations in the Saccharomyces cerevisiae MSH1 and MSH2 genes: evidence for separate mitochondrial and nuclear functions. Genetics 132:975-985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Reenan, R. A., and R. D. Kolodner. 1992. Isolation and characterization of two Saccharomyces cerevisiae genes encoding homologs of the bacterial HexA and MutS mismatch repair proteins. Genetics 132:963-973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Selmecki, A., A. Forche, and J. Berman. 2006. Aneuploidy and isochromosome formation in drug-resistant Candida albicans. Science 313:367-370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Shen, J., W. Guo, and J. R. Kohler. 2005. CaNAT1, a heterologous dominant selectable marker for transformation of Candida albicans and other pathogenic Candida species. Infect. Immun. 73:1239-1242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Shi, Q. M., Y. M. Wang, X. D. Zheng, R. T. Lee, and Y. Wang. 2007. Critical role of DNA checkpoints in mediating genotoxic-stress-induced filamentous growth in Candida albicans. Mol. Biol. Cell 18:815-826. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Sia, E. A., S. Jinks-Robertson, and T. D. Petes. 1997. Genetic control of microsatellite stability. Mutat. Res. 383:61-70. [DOI] [PubMed] [Google Scholar]
  • 29.Spell, R. M., and S. Jinks-Robertson. 2004. Determination of mitotic recombination rates by fluctuation analysis in Saccharomyces cerevisiae. Methods Mol. Biol. 262:3-12. [DOI] [PubMed] [Google Scholar]
  • 30.Vanden Bossche, H., G. Willemsens, and P. Marichal. 1987. Anti-Candida drugs—the biochemical basis for their activity. Crit. Rev. Microbiol. 15:57-72. [DOI] [PubMed] [Google Scholar]
  • 31.White, T. C., S. Holleman, F. Dy, L. F. Mirels, and D. A. Stevens. 2002. Resistance mechanisms in clinical isolates of Candida albicans. Antimicrob. Agents Chemother. 46:1704-1713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Williamson, M. S., J. C. Game, and S. Fogel. 1985. Meiotic gene conversion mutants in Saccharomyces cerevisiae. I. Isolation and characterization of pms1-1 and pms1-2. Genetics 110:609-646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wilson, R. B., D. Davis, and A. P. Mitchell. 1999. Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J. Bacteriol. 181:1868-1874. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Eukaryotic Cell are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES