Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2007 Sep 7;189(22):8371–8376. doi: 10.1128/JB.01217-07

trans-Acting Factors and cis Elements Involved in Glucose Repression of Arabinan Degradation in Bacillus subtilis

José Manuel Inácio 1, Isabel de Sá-Nogueira 1,2,*
PMCID: PMC2168706  PMID: 17827291

Abstract

In Bacillus subtilis, the synthesis of enzymes involved in the degradation of arabinose-containing polysaccharides is subject to carbon catabolite repression (CCR). Here we show that CcpA is the major regulator of repression of the arabinases genes in the presence of glucose. CcpA acts via binding to one cre each in the promoter regions of the abnA and xsa genes and to two cres in the araABDLMNPQ-abfA operon. The contributions of the coeffectors HPr and Crh to CCR differ according to growth phase. HPr dependency occurs during both exponential growth and the transitional phase, while Crh dependency is detected mainly at the transitional phase. Our results suggest that Crh synthesis may increase at the end of exponential growth and consequently contribute to this effect, together with other factors.


Bacillus subtilis secretes a vast number of polysaccharide-degrading enzymes that are able to hydrolyze plant cell wall material (30). Arabinose and xylose are the two most abundant pentoses in nature and often occur associated with hemicellulosic substrates, such as arabinans, xylans, and arabinoxylans (25, 26, 29). B. subtilis synthesizes enzymes, namely, endo-1,5-α-arabinanases (ABN; EC 3.2.1.99) and α-l-arabinofuranosidases (AF; EC 3.2.1.55), capable of releasing arabinosyl oligomers and arabinose from the plant tissue homoglycan arabinan (1, 13, 14, 35). In previous studies, we characterized the transcriptional regulation of three arabinan-degrading enzyme genes, abnA (ABN), xsa (AF), and abfA (AF), which are clustered with genes encoding enzymes that further catabolize l-arabinose (23). Expression of these genes is (i) induced by arabinose and arabinan, (ii) negatively controlled by AraR, the key regulator of the arabinose regulon, and (iii) repressed in the presence of glucose (6, 12, 23). The last phenomenon, carbon catabolite repression (CCR), is a global regulatory mechanism that ensures the selection of rapidly metabolized carbon and energy sources, such as glucose, for optimal bacterial growth (3, 30). CcpA is the master regulator of CCR in Bacilli and other gram-positive bacteria with low GC contents and regulates approximately 10% of the B. subtilis genome (2, 18). This global regulator binds to cres (catabolite-responsive elements) either upstream of or in the promoter region or within coding regions of target genes (17, 34). This interaction is modulated by phosphorylation of HPr, a phosphocarrier protein of the phosphoenolpyruvate phosphotransferase system (PTS), or of Crh (an HPr-like protein) (4, 30, 33). In this work, we identified trans-acting factors and cis elements involved in glucose repression of arabinan-degrading enzyme genes. Moreover, we address the question of temporal regulation of these genes (23) by determination of the contributions of CcpA and the coeffectors HPr and Crh to glucose repression at different growth stages (exponential and postexponential [transitional] growth).

cis-Regulatory elements in the promoter regions of abnA and xsa.

The involvement of two cres present in the araABDLMNPQ-abfA operon (cre araA and cre araB) (Fig. 1) in CCR was shown in previous studies (12, 17). Both cre araA, located between the promoter region and the araA gene, and cre araB, placed 2 kb downstream within the araB gene, are independently functional, and both contribute to glucose repression (12). Moreover, the level of glucose repression, 21.8-fold, measured in a strain bearing an abfA′-lacZ reporter fusion (IQB450) (23; see below) was only 1.6-fold higher than that observed with a strain bearing an araAB′-lacZ fusion, i.e., 13.4-fold (12), suggesting the absence of other cre active sites in glucose-mediated CCR of abfA expression. Expression of abnA and xsa is also subject to glucose repression (23). Potential cre sequences, namely, cre abnA (+83-TGTAAGCGCTTTCT [SubtiList position 2949135]) (Fig. 1) (17) and cre xsa (+1-TAAAAGCGCTTACA [SubtiList position 2914316]) (Fig. 1) (18), are present in the promoter regions of the genes. To assess the functionality of these putative regulatory sites, we introduced a single-base-pair substitution which destroyed the central symmetry in both cre abnA (+89 C→A) and cre xsa (+7 C→A) (Fig. 1). The two promoter regions, together with the respective mutated cres, were fused to the lacZ reporter gene and introduced into the amyE locus. In the resulting B. subtilis strains, IQB472 and IQB473 (Table 1), respectively, the levels of accumulated β-galactosidase activity in the absence or presence of the inducer arabinose and under repressing conditions (arabinose plus glucose) were determined. Glucose repression was almost abolished in the mutants compared to that in strains bearing the wild-type promoters (IQB410 and IQB405) (23) (Table 2). These results indicate that both cre abnA and cre xsa are functional and that the designed mutation prevented binding of CcpA (see below) in the presence of glucose. Thus, cre abnA and cre xsa are the cis-acting elements involved in glucose-mediated CCR of abnA and xsa expression at the transcriptional level. In addition, the results suggest that only one cre in each promoter is responsible for this phenomenon.

FIG. 1.

FIG. 1.

Organization of the B. subtilis chromosome region comprising the arabinan-degrading enzyme genes abnA, abfA, and xsa. The three genes are represented by dotted arrows pointing in the direction of transcription. abfA belongs to the araABDLMNPQ-abfA metabolic operon, abnA is located immediately upstream, and xsa is positioned 23 kb downstream of the metabolic operon. Hairpin structures denote terminators. The dotted boxes below the physical map represent extensions of the inserts fused to the lacZ reporter gene in the indicated plasmids. Plasmid pSA1 was integrated into the host chromosome by means of a single-crossover (Campbell-type) recombinational event that occurred in the region of homology of the resulting strain (Table 1). Linearized DNAs from plasmids pSN40, pZI26, pZI27, and pRIT1 were used to transform B. subtilis strains (Table 1), and the fusions were integrated into the chromosome via double recombination at the amyE locus. Above the map, the DNA sequences of cre abnA and cre xsa are depicted, and the numbers indicate the positions of the abnA and xsa genes relative to the transcriptional start site. The single nucleotide change (C→A) introduced into each cre is shown.

TABLE 1.

B. subtilis strains, plasmids, and oligonucleotides used in this study

Plasmid, strain, or oligonucleotide Relevant construction, genotype, or sequence (5′→3′) Source or referencea
Plasmids
    pJM783 Integrative plasmid; promoterless lacZ preceded by rbsspoVG and multicloning site (MCS); cat bla 22
    pSN32 Promoterless lacZ preceded by rbsspoVG and MCS; cat bla; flanked by amyE-5′ and amyE-3′ 20
    pMutin4 Promoterless lacZ preceded by rbsspoVG and MCS; lacI bla ery Pspac 31
    pRIT1 pSN32 containing a 281-bp fragment of the xsa promoter region in the MCS 23
    pSN40 pSN32 carrying a 292-bp fragment of the abnA promoter region in the MCS 23
    pSA1 pJM783 containing a 687-bp fragment comprising the abfA 5′ region in the MCS 23
    pZI26 Same as pSN40, but with a single-base-pair substitution at position +89 (C→A) This work
    pZI27 Same as pRIT1, but bearing a single-base-pair substitution at position +7 (C→A) This work
    pGP211 pBSK+ derivative that contains the spc gene inserted into the hprK gene 10
    pZI45 Identical to pBGM6 (9), pMutin4 bearing a crh′-lacZ fusion This work
    pZI48 Identical to pLF2 (9), pMutin4 bearing a ptsH′-lacZ fusion This work
Strains
    168T+ Prototroph 12
    QB5223 trpC2 ptsH1 15
    QB7097 trpC2 crh::spc 15
    WLN29 trpC2 aroG932 ccpA::Tn917 11
    IQB405 amyE::[xsa′-lacZ cat] 23
    IQB406 amyE::[xsa′-lacZ cat] araR::km 23
    IQB410 amyE::[abnA′-lacZ cat] 23
    IQB411 amyE::[abnA′-lacZ cat] araR::km 23
    IQB422 amyE::[abnA′-lacZ cat] ccpA::Tn917 WLN29→IQB410
    IQB423 amyE::[xsa′-lacZ cat] ccpA::Tn917 WLN29→IBQ405
    IQB450 abfA::pSA1[abfA′-lacZ cat] 23
    IQB453 abfA::pSA1[abfA′-lacZ cat] araR::km 23
    IQB466 amyE::[abnA′-lacZ cat] ptsH1 pRIT1→QB5223b
    IQB467 amyE::[xsa′-lacZ cat] ptsH1 pSN40→QB5223b
    IQB468 amyE::[abnA′-lacZ cat] crh::spc QB7097→IQB410
    IQB469 amyE::[xsa′-lacZ cat] crh::spc QB7097→IQB405
    IQB470 amyE::[abnA′-lacZ cat] ptsH1 crh::spc QB7097→IQB466
    IQB471 amyE::[xsa′-lacZ cat] ptsH1 crh::spc QB7097→IQB467
    IQB472 amyE::[abnA′(+89 C→A)-lacZ cat] pZI26→168T+b
    IQB473 amyE::[xsa′(+7 C→A)-lacZ cat] pZI27→168T+b
    IQB474 abfA::pSA1[abfA′-lacZ cat] ccpA::Tn917 WLN29→IBQ450
    IQB475 abfA::pSA1[abfA′-lacZ cat] ptsH1 pSA1→QB5223
    IQB476 abfA::pSA1[abfA′-lacZ cat] crh::spc QB7097→IQB450
    IQB477 abfA::pSA1[abfA′-lacZ cat] ptsH1 crh::spc QB7097→IQB476
    IQB478 abfA::pSA1[abfA′-lacZ cat] hprK::spc pGP211→IQB450b
    IQB479 amyE::[abnA′-lacZ cat] hprK::spc pGP211→IQB410b
    IQB480 amyE::[xsa′-lacZ cat] hprK::spc pGP211→IQB405b
    IQB495 crh::pZI45[crh′-lacZ erm (::pMutin4)] pZI45→168T+
    IQB496 ptsH::pZI48[ptsH′-lacZ erm (::pMutin4)] pZI48→168T+
Oligonucleotidesc
    ARA204 −8-GGTTACTTTAAAAGAGCTTACATTCATGC-+21 (xsa)
    ARA205 GCATGAATGTAAGCTCTTTTAAAGTAACC
    ARA206 +66-GGATAAATAATCTAATTTGTAAGAGCTTTCTAAAATAAAGG-+106 (abnA)
    ARA207 CCTTTATTTTAGAAAGCTCTTACAAATTAGATTATTTATCC
a

Arrows indicate transformation, performed as previously described (27), and point from donor DNA to the recipient strain.

b

Transformation was carried out with linearized plasmid DNA.

c

Substituted residues in oligonucleotides are underlined. The position relative to the transcriptional start site of the xsa and abnA genes is indicated in the forward primer. Site-directed mutagenesis was performed using a QuikChange kit (Stratagene).

TABLE 2.

Single-base-pair substitutions in the cres located in the promoter regions of the abnA and xsa genesa

Promoter fusion and strain (relevant genotype) β-Galactosidase activity (Miller units)b
Glucose repression indexc
−Ara +Ara +Ara +Glc
abnA′-lacZ
    IQB410d (WT) 3.2 ± 0.7 10.0 ± 0.8 1.6 ± 0.3 6.5
    IQB472 (cre abnAmut) 9.1 ± 1.3 80.7 ± 11.4 41.3 ± 3.3 1.9
xsa′-lacZ
    IQB405d (WT) 7.5 ± 0.2 117.3 ± 3.9 9.2 ± 0.5 19.3
    IQB473 (cre xsamut) 4.0 ± 0.5 163.1 ± 12.6 76.8 ± 9.5 2.1
a

Strains containing different promoter-lacZ fusions were grown on C minimal medium (21) supplemented with 1% (wt/vol) casein hydrolysate in the absence of sugar (−Ara), in the presence of 0.4% (wt/vol) arabinose (+Ara), and in the presence of 0.4% (wt/vol) arabinose plus 0.4% (wt/vol) glucose (+Ara +Glc). Antibiotics used as selective markers were added as appropriate. Samples were analyzed 2 h after the addition of sugar, as previously described (27).

b

The levels of accumulated β-galactosidase activity, determined as previously described (27), represent the averages ± standard deviations of two measurements each from three independent experiments.

c

The glucose repression index was calculated as the ratio of the level of expression (in Miller units) obtained in the presence of arabinose to the value determined in the presence of glucose.

d

Data are from the work of Raposo et al. (23).

A major role of CcpA and different contributions of effectors HPr and Crh to CCR.

The arabinan-degrading enzyme genes are subject to temporal regulation, since the levels of expression of abfA, xsa, and abnA increase at early postexponential phase in response to arabinose and arabinan (23). Here we analyzed this effect in the presence of glucose. The expression of abfA′-lacZ, xsa′-lacZ, and abnA′-lacZ transcriptional fusions, integrated into the chromosomes of strains IQB450, IQB405, and IQB410, respectively (Table 1) (23), was analyzed as described above, and samples were collected 2 and 4 h after induction (t2 and t4, respectively), corresponding to the middle exponential and early postexponential (transitional) growth phases, respectively (Fig. 2A). Although expression of abfA′-lacZ, xsa′-lacZ, and abnA′-lacZ increased at t4, the glucose repression indexes, measured as ratios between expression in the presence of arabinose and the values obtained in the presence of arabinose plus glucose, were similar during exponential growth and transitional phase (Fig. 2B, C, and D). These results suggest that the effect of glucose repression under these conditions is not affected over time.

FIG. 2.

FIG. 2.

Effects of ccpA, ptsH1, crh, hprK, and araR mutations on catabolite repression of the xsa, abnA, and abfA genes. (A) Growth curves for wild-type (squares) and ccpA-null mutant (triangles) B. subtilis strains in C minimal medium (21) supplemented with 1% (wt/vol) casein hydrolysate in the presence of 0.4% (wt/vol) arabinose plus 0.4% (wt/vol) glucose. Exponential growth phase (t2) and transitional phase (t4) are indicated. The strains bearing the xsa′-lacZ (B), abnA′-lacZ (C), and abfA′-lacZ (D) transcriptional fusions were grown in the absence of sugar, in the presence of 0.4% (wt/vol) arabinose, and in the presence of 0.4% (wt/vol) arabinose plus 0.4% (wt/vol) glucose. The levels of accumulated β-galactosidase activity, expressed as Miller units, were measured at hours 2 (t2) and 4 (t4) after induction (addition of arabinose). The results are represented by the glucose repression index, calculated as the ratio between the level of accumulated Miller units obtained in the presence of arabinose and the value determined in the presence of arabinose plus glucose. Each value is the average of two measurements each from three independent experiments.

To identify the trans-acting factors involved in CCR of the arabinan-degrading enzyme genes, we examined the expression of abfA′-lacZ, xsa′-lacZ, and abnA′-lacZ transcriptional fusions, as described above, in B. subtilis ccpA, pstH1, crh, hprK, and araR mutant backgrounds (Table 1). In a wild-type background, the addition of glucose caused 21.8-, 19.3-, and 6.5-fold repression of abfA′-lacZ, xsa′-lacZ, and abnA′-lacZ expression, respectively (strains IQB450, IQB405, and IQB410, respectively) during exponential growth phase (23). Disruption of the ccpA gene led to a complete loss of glucose-mediated CCR of expression from the abfA′-lacZ (IQB474), xsa′-lacZ (IQB423), and abnA′-lacZ (IQB422) fusions (Fig. 2), revealing its major role in glucose-mediated CCR of the arabinan-degrading enzyme genes. The ptsH1 mutation (HPr Ser46 to Ala), which impaired HPr Ser46 phosphorylation (5), partially abolished glucose repression of abfA′-lacZ (IQB475), xsa′-lacZ (IQB467), and abnA′-lacZ (IQB466) fusion expression (Fig. 2). In contrast, disruption of the crh gene caused almost no effect on glucose repression of expression from the abfA′-lacZ, xsa′-lacZ, and abnA′-lacZ fusions (IQB476, IQB469, and IQB468, respectively) during exponential growth phase (t2). Accordingly, in the ptsH1 crh double mutant background, the levels of glucose repression, at t2, of abfA′-lacZ (IQB477), xsa′-lacZ (IQB471), and abnA′-lacZ (IQB470) fusions were only slightly lower than those observed in the single ptsH1 mutant (Fig. 2), suggesting no or a small contribution of Crh to CCR mediated by glucose. These results are in agreement with previous observations that both CcpA and HPr, but not Crh, participate in glucose repression of the araE and araAB genes (12). However, in the crh-null mutant background, a significant relief of glucose repression of abfA′-lacZ and xsa′-lacZ expression, of 6.4-fold and 2.1-fold, respectively, was observed at transitional phase (t4), suggesting a contribution of Crh to glucose-mediated CCR at late growth phases (discussed below). The disruption of the hprK gene, encoding the bifunctional HPr kinase/phosphorylase, which reversible phosphorylates HPr and Crh (8, 16, 24), also caused a decrease of glucose repression (in IQB478, IQB479, and IQB480) (Fig. 2).

During exponential growth of cells with an araR-null mutant background, we observed a twofold derepression of expression of xsa′-lacZ (IQB406) and abfA′-lacZ (IQB453) in the presence of glucose compared to that of the wild type (Fig. 2B and C). AraR is a negative regulator of the arabinose-inducible genes (6, 7, 20), and this effect was previously observed with araE′-lacZ and araAB′-lacZ fusions (12). The AraR binding sites and cre sequences are located close to each other in the promoter regions of the araABDLMNPQ-abfA, araE, and xsa genes (12, 19, 23). Since under particular physiological conditions both CcpA and AraR might be bound to the DNA in close proximity, a possible interaction (cooperation) between the two proteins in the negative control of these genes was proposed (12, 19). Interestingly, this effect was not observed for the abnA′-lacZ fusion in an araR-null mutant background (strain IQB411) (Fig. 2D; Table 1). This observation is in agreement with a different localization of cre abnA relative to the AraR binding site in the abnA promoter and also to a weak control of abnA expression by AraR as a result of a distinct mechanism of action (23).

Crh expression increases at transitional growth phase.

The contribution of both effectors HPr and Crh to CCR by glucose can depend on the growth conditions, as shown for the hut operon, which responds to HPr in rich LB medium and to both HPr and Crh in minimal medium (36). Crh is the major effector for CCR of the citM gene in a medium containing succinate and glutamate (32). In connection with this, it was recently shown that the nature of the carbon source influences ptsH and crh expression (9). Using ptsH′-lacZ and crh′-lacZ transcription and translational fusion analysis, it was suggested that the different contributions of Crh and HPr to CCR might be due to the drastic differences in their synthesis rates under the conditions that cause CCR. In the presence of PTS carbohydrates, such as glucose, the synthesis level of HPr during exponential growth is 100-fold higher than that of Crh, which may explain the minor role of the latter in certain circumstances (9). Moreover, CcpA binds Crh(Ser-P) more weakly than HPr(Ser-P) (28). We have previously shown the absence of a Crh contribution to glucose repression of the araABDLMNPQ-abfA and araE genes in both C minimal medium supplemented with casein hydrolysate and CSK minimal medium (12). To further investigate the lack of Crh dependency during exponential growth and its possible contribution to glucose repression of the arabinan-degrading enzyme genes during the transitional growth phase, we analyzed the expression of both ptsH′-lacZ and crh′-lacZ transcriptional fusions at different growth stages. The constructed transcriptional fusions are identical to those described by Görke et al. (9). In B. subtilis strains bearing the fusions, the complete ptsH and crh coding regions are restored downstream from the lacZ insertion cassette. Their expression is directed by the IPTG (isopropyl-β-d-thiogalactopyranoside)-inducible Pspac promoter in order to prevent polar effects caused by insertions into their natural chromosomal loci (Table 1). Expression from the crh′-lacZ (IQB495) (Table 1) and ptsH′-lacZ (IQB496) (Table 1) transcriptional fusions during exponential growth phase (t2) was comparable in both C minimal medium supplemented with casein hydrolysate and CSK minimal medium (Table 3). The presence of arabinose, a non-PTS sugar, did not influence crh and ptsH expression (Table 3). In addition, the β-galactosidase activities obtained for crh′-lacZ and ptsH′-lacZ in CSK minimal medium plus glucose (29 and 229, respectively) (Table 3) were very similar to those obtained by Görke et al. (9). Interestingly, at transitional growth phase (t4), the expression of crh increased about twofold in the presence of glucose and in both media. In contrast, ptsH expression was unaffected by the growth phase. These results suggest that increased expression of crh at the transcriptional level during transitional phase in the presence of glucose may lead to a higher cellular concentration of Crh than of HPr. Thus, this difference in synthesis level may contribute to the glucose repression relief effect on abfA′-lacZ and xsa′-lacZ expression in the crh-null mutant background (Fig. 2). However, due to a still expected higher concentration of HPr than Crh under these conditions, other factors, such as intracellular variation of certain metabolites which may influence Crh(Ser-P) phosphorylation and/or CcpA-Crh(Ser-P) complex formation, are likely to contribute to Crh(Ser-P)-mediated glucose repression at transitional phase.

TABLE 3.

Expression from crh′-lacZ and ptsH′-lacZ fusions in minimal media at different growth stagesa

Medium Strain (promoter fusion) Timeb β-Galactosidase activity (Miller units)c
−Ara +Ara +Ara +Glc +Glc
C IQB495 (crh′-lacZ) t2 36.0 ± 3.8 31.5 ± 2.4 25.6 ± 1.2 23.9 ± 2.4
t4 37.0 ± 0.8 37.8 ± 1.2 56.8 ± 3.2 56.9 ± 2.6
IQB496 (ptsH′-lacZ) t2 97.4 ± 14.9 94.9 ± 10.1 315.4 ± 18.4 322.7 ± 16.2
t4 87.5 ± 7.1 94.3 ± 13.3 323.2 ± 16.3 322.7 ± 47.2
CSK IQB495 (crh′-lacZ) t2 31.4 ± 3.4 28.4 ± 3.5 24.5 ± 3.7 29.1 ± 2.3
t4 28.3 ± 1.3 27.1 ± 3.2 43.7 ± 6.8 45.5 ± 2.7
IQB496 (ptsH′-lacZ) t2 59.7 ± 5.4 56.7 ± 6.0 204.0 ± 31.1 229.1 ± 16.2
t4 55.0 ± 5.9 46.5 ± 8.3 195.9 ± 10.3 228.5 ± 38.8
a

Strains containing different promoter-lacZ fusions were grown on C minimal medium (21) supplemented with casein hydrolysate or in CSK minimal medium (9) with IPTG (1 mM) in the absence of sugar (−Ara), in the presence of arabinose (+Ara), in the presence of arabinose plus glucose (+Ara +Glc), and in the presence of glucose (+Glc). Antibiotics used as selective markers were added as appropriate.

b

Samples were analyzed 2 h (t2) and 4 h (t4) after the addition of sugars, which correspond to exponential growth phase and transitional phase, respectively.

c

The levels of accumulated β-galactosidase activity represent the averages of two measurements each from three independent experiments.

Concluding remarks.

CCR of the arabinan-degrading enzyme genes is mediated by binding of CcpA to one cre located downstream near the promoter regions of abnA and xsa and to two cres present in the araABDLMNPQ-abfA operon, with cre araA located near the promoter and cre araB positioned within the araB gene. Our data suggest that during exponential growth phase, glucose-mediated CCR is mediated by CcpA associated with the coeffector HPr(Ser-P), and that towards the end of exponential growth, at transitional phase, glucose repression is achieved by both CcpA-HPr(Ser-P) and CcpA-Crh(Ser-P) complexes.

Acknowledgments

We thank Jörg Stülke for the kind gift of plasmid pGP211.

This work was partially supported by grants POCTI/AGR/36212/00 and POCI/AGR/60236/2004 from Fundação para a Ciência e Tecnologia (FCT) and FEDER to I.D.S.-N. and by fellowship SFRH/BD/18238/2004 from FCT to J.M.I.

Footnotes

Published ahead of print on 7 September 2007.

REFERENCES

  • 1.Beldman, G., H. A. Schols, S. M. Pitson, M. J. F. Searl-van Leeuwen, and A. G. Voragen. 1997. Arabinans and arabinan degrading enzymes. Adv. Macromol. Carbohydr. Res. 1:1-64. [Google Scholar]
  • 2.Blencke, H.-M., G. Homuth, H. Ludwig, U. Mader, M. Hecker, and J. Stülke. 2003. Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metab. Eng. 5:133-149. [DOI] [PubMed] [Google Scholar]
  • 3.Brückner, R., and F. Titgemeyer. 2002. Carbon catabolite repression in bacteria: choice of carbon source and autoregulatory limitation of sugar utilization. FEMS Microbiol. Lett. 209:141-148. [DOI] [PubMed] [Google Scholar]
  • 4.Deutscher, J., C. Francke, and P. W. Postma. 2006. How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiol. Mol. Biol. Rev. 70:939-1031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Deutscher, J., J. Reizer, C. Fischer, A. Galinier, M. H. Saier, Jr., and M. Steinmetz. 1994. Loss of protein kinase-catalyzed phosphorylation of HPr, a phosphocarrier protein of the phosphotransferase system, by mutation of the ptsH gene confers catabolite repression resistance to several catabolic genes of Bacillus subtilis. J. Bacteriol. 176:3336-3344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Franco, I. S., L. J. Mota, C. M. Soares, and I. de Sá-Nogueira. 2006. Functional domains of the Bacillus subtilis transcription factor AraR and identification of amino acids important for nucleoprotein complex assembly and effector binding. J. Bacteriol. 188:3024-3036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Franco, I. S., L. J. Mota, C. M. Soares, and I. de Sá-Nogueira. 2007. Probing key DNA contacts in AraR-mediated transcriptional repression of the Bacillus subtilis arabinose regulon. Nucleic Acids Res. 35:4755-4766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Galinier, A., J. Deutscher, and I. Martin-Verstraete. 1999. Phosphorylation of either Crh or HPr mediates binding of CcpA to the Bacillus subtilis xyn cre and catabolite repression of the xyn operon. J. Mol. Biol. 286:307-314. [DOI] [PubMed] [Google Scholar]
  • 9.Görke, B., L. Fraysse, and A. Galinier. 2004. Drastic differences in Crh and HPr synthesis levels reflect their different impacts on catabolite repression in Bacillus subtilis. J. Bacteriol. 186:2992-2995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Hanson, K. G., K. Steinhauer, J. Reizer, W. Hillen, and J. Stülke. 2002. HPr kinase/phosphatase of Bacillus subtilis: expression of the gene and effects of mutations on enzyme activity, growth and carbon catabolite repression. Microbiology 148:1805-1811. [DOI] [PubMed] [Google Scholar]
  • 11.Henkin, T. M., F. J. Grundy, W. L. Nicholson, and G. H. Chambliss. 1991. Catabolite repression of alpha-amylase gene expression in Bacillus subtilis involves a trans-acting gene product homologous to the Escherichia coli LacL and GalR repressors. Mol. Microbiol. 5:575-584. [DOI] [PubMed] [Google Scholar]
  • 12.Inácio, J. M., C. Costa, and I. de Sá-Nogueira. 2003. Distinct molecular mechanisms involved in carbon catabolite repression of the arabinose regulon in Bacillus subtilis. Microbiology 149:2345-2355. [DOI] [PubMed] [Google Scholar]
  • 13.Kaji, A., and T. Saheki. 1975. Endo-arabanase from Bacillus subtilis F-11. Biochim. Biophys. Acta 410:354-360. [DOI] [PubMed] [Google Scholar]
  • 14.Kaneko, S., M. Sano, and I. Kusakabe. 1994. Purification and some properties of alpha-l-arabinofuranosidase from Bacillus subtilis 3-6. Appl. Environ. Microbiol. 60:3425-3428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Martin-Verstraete, I., J. Stülke, A. Klier, and G. Rapoport. 1995. Two different mechanisms mediate catabolite repression of the Bacillus subtilis levanase operon. J. Bacteriol. 177:6919-6927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Mijakovic, I., S. Poncet, A. Galinier, V. Monedero, S. Fieulaine, J. Janin, S. Nessler, J. A. Marquez, K. Scheffzek, S. Hasenbein, W. Hengstenberg, and J. Deutscher. 2002. Pyrophosphate-producing protein dephosphorylation by HPr kinase/phosphorylase: a relic of early life? Proc. Natl. Acad. Sci. USA 99:13442-13447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Miwa, Y., A. Nakata, A. Ogiwara, M. Yamamoto, and Y. Fujita. 2000. Evaluation and characterization of catabolite-responsive elements (cre) of Bacillus subtilis. Nucleic Acids Res. 28:1206-1210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Moreno, M. S., B. L. Schneider, R. R. Maile, W. Weyler, and M. H. Saier, Jr. 2001. Catabolite repression mediated by the CcpA protein in Bacillus subtilis: novel modes of regulation revealed by whole-genome analyses. Mol. Microbiol. 39:1366-1381. [DOI] [PubMed] [Google Scholar]
  • 19.Mota, L. J., L. M. Sarmento, and I. de Sá-Nogueira. 2001. Control of the arabinose regulon in Bacillus subtilis by AraR in vivo: crucial roles of operators, cooperativity, and DNA looping. J. Bacteriol. 183:4190-4201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Mota, L. J., P. Tavares, and I. Sá-Nogueira. 1999. Mode of action of AraR, the key regulator of l-arabinose metabolism in Bacillus subtilis. Mol. Microbiol. 33:476-489. [DOI] [PubMed] [Google Scholar]
  • 21.Pascal, M., F. Kunst, J. A. Lepesant, and R. Dedonder. 1971. Characterization of two sucrase activities in Bacillus subtilis Marburg. Biochimie 53:1059-1066. [DOI] [PubMed] [Google Scholar]
  • 22.Perego, M. 1993. Integrational vectors for genetic manipulation in Bacillus subtilis, p. 615-624. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology, and molecular genetics. ASM Press, Washington, DC.
  • 23.Raposo, M. P., J. M. Inácio, L. J. Mota, and I. Sá-Nogueira. 2004. Transcriptional regulation of arabinan-degrading genes in Bacillus subtilis. J. Bacteriol. 186:1287-1296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Reizer, J., C. Hoischen, F. Titgemeyer, C. Rivolta, R. Rabus, J. Stülke, D. Karamata, M. H. Saier, Jr., and W. Hillen. 1998. A novel protein kinase that controls carbon catabolite repression in bacteria. Mol. Microbiol. 27:1157-1169. [DOI] [PubMed] [Google Scholar]
  • 25.Saha, B. C. 2000. Alpha-l-arabinofuranosidases: biochemistry, molecular biology and application in biotechnology. Biotechnol. Adv. 18:403-423. [DOI] [PubMed] [Google Scholar]
  • 26.Saha, B. C. 2003. Hemicellulose bioconversion. J. Ind. Microbiol. Biotechnol. 30:279-291. [DOI] [PubMed] [Google Scholar]
  • 27.Sá-Nogueira, I., T. V. Nogueira, S. Soares, and H. de Lencastre. 1997. The Bacillus subtilis l-arabinose (ara) operon: nucleotide sequence, genetic organization and expression. Microbiology 143:957-969. [DOI] [PubMed] [Google Scholar]
  • 28.Seidel, G., M. Diel, N. Fuchsbauer, and W. Hillen. 2005. Quantitative interdependence of coeffectors, CcpA and cre in carbon catabolite regulation of Bacillus subtilis. FEBS J. 272:2566-2577. [DOI] [PubMed] [Google Scholar]
  • 29.Shallom, D., and Y. Shoham. 2003. Microbial hemicellulases. Curr. Opin. Microbiol. 6:219-228. [DOI] [PubMed] [Google Scholar]
  • 30.Stülke, J., and W. Hillen. 2000. Regulation of carbon catabolism in Bacillus species. Annu. Rev. Microbiol. 54:849-880. [DOI] [PubMed] [Google Scholar]
  • 31.Vagner, V., E. Dervyn, and S. D. Ehrlich. 1998. A vector for systematic gene inactivation in Bacillus subtilis. Microbiology 144:3097-3104. [DOI] [PubMed] [Google Scholar]
  • 32.Warner, J. B., and J. S. Lolkema. 2003. A Crh-specific function in carbon catabolite repression in Bacillus subtilis. FEMS Microbiol. Lett. 220:277-280. [DOI] [PubMed] [Google Scholar]
  • 33.Warner, J. B., and J. S. Lolkema. 2003. CcpA-dependent carbon catabolite repression in bacteria. Microbiol. Mol. Biol. Rev. 67:475-490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Weickert, M. J., and G. H. Chambliss. 1990. Site-directed mutagenesis of a catabolite repression operator sequence in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 87:6238-6242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Weinstein, L., and P. Albersheim. 1979. Structure of plant cell walls. IX. Purification and partial characterization of a wall-degrading endo-arabanase and an arabinosidase from Bacillus subtilis. Plant Physiol. 63:425-432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Zalieckas, J. M., L. V. Wray, Jr., and S. H. Fisher. 1999. trans-Acting factors affecting carbon catabolite repression of the hut operon in Bacillus subtilis. J. Bacteriol. 181:2883-2888. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES