Skip to main content
The Journal of Cell Biology logoLink to The Journal of Cell Biology
. 2004 Jan 5;164(1):123–131. doi: 10.1083/jcb.200307017

Amyloid-β peptide induces oligodendrocyte death by activating the neutral sphingomyelinase–ceramide pathway

Jiunn-Tay Lee 3, Jan Xu 1, Jin-Moo Lee 1, Grace Ku 1, Xianlin Han 2, Ding-I Yang 1, Shawei Chen 1, Chung Y Hsu 1,4
PMCID: PMC2171973  PMID: 14709545

Abstract

Amyloid-β peptide (Aβ) accumulation in senile plaques, a pathological hallmark of Alzheimer's disease (AD), has been implicated in neuronal degeneration. We have recently demonstrated that Aβ induced oligodendrocyte (OLG) apoptosis, suggesting a role in white matter pathology in AD. Here, we explore the molecular mechanisms involved in Aβ-induced OLG death, examining the potential role of ceramide, a known apoptogenic mediator. Both Aβ and ceramide induced OLG death. In addition, Aβ activated neutral sphingomyelinase (nSMase), but not acidic sphingomyelinase, resulting in increased ceramide generation. Blocking ceramide degradation with N-oleoyl-ethanolamine exacerbated Aβ cytotoxicity; and addition of bacterial sphingomyelinase (mimicking cellular nSMase activity) induced OLG death. Furthermore, nSMase inhibition by 3-O-methyl-sphingomyelin or by gene knockdown using antisense oligonucleotides attenuated Aβ-induced OLG death. Glutathione (GSH) precursors inhibited Aβ activation of nSMase and prevented OLG death, whereas GSH depletors increased nSMase activity and Aβ-induced death. These results suggest that Aβ induces OLG death by activating the nSMase–ceramide cascade via an oxidative mechanism.

Keywords: Alzheimer's disease; apoptosis; cell death; oxidative stress; white matter

Introduction

The amyloid-β peptide (Aβ), a 39–43–amino acid cleavage product of amyloid precursor protein (Estus et al., 1992; Haass et al., 1992), has been implicated as the primary neurotoxic factor in Alzheimer's disease (AD) pathogenesis (Yankner et al., 1989). In vitro, Aβ is toxic to neurons (Yankner et al., 1989; Behl et al., 1994; Yu et al., 1998), endothelial cells (Thomas et al., 1996; Huang et al., 1998), astrocytes (Brera et al., 2000), vascular smooth muscle cells (Kawai et al., 1993; Davis-Salinas et al., 1995), and oligodendrocytes (OLGs; Xu et al., 2001); and Aβ depositions in senile plaques are postulated to cause neuronal and vascular degeneration in AD brains (Masters et al., 1985; Yankner et al., 1989; Thomas et al., 1996). Although Aβ-mediated cell death demonstrates morphological, biochemical, and molecular features of apoptosis, the molecular mechanism underlying Aβ cytotoxicity remains largely undefined but may involve oxidative stress (Behl et al., 1994; Schapira, 1996). NF-κB and AP-1, redox-sensitive transcription factors, are activated in Aβ-treated OLGs, and N-acetylcysteine (NAC), an antioxidant, prevents Aβ-mediated OLG apoptosis (Xu et al., 2001). OLGs are susceptible to oxidative stress because they have low levels of reduced glutathione (GSH) and high concentrations of iron, resulting in a compromised ability to scavenge peroxides (Thorburne and Juurlink, 1996; Back et al., 1998; Juurlink et al., 1998).

Ceramide, a lipid second messenger that increases the cellular oxidative state, has been implicated in several apoptosis paradigms including trophic factor withdrawal and exposure to proinflammatory molecules (Coroneos et al., 1995; Kyriakis and Avruch, 1996; Kolesnick and Kronke, 1998). Cellular ceramide synthesis increases in response to stress or death signals (Haimovitz-Friedman et al., 1994; Tepper et al., 1995; Verheij et al., 1996). One pathway of ceramide formation involves sphingomyelin hydrolysis by either neutral sphingomyelinase (nSMase) or acidic sphingomyelinase (aSMase; Testi, 1996); both enzymes are involved in several cell death paradigms (Kolesnick and Kronke, 1998; Levade and Jaffrezou, 1999). Another pathway involves ceramide synthase–catalyzed de novo ceramide synthesis (Bose et al., 1995; Spiegel and Merrill, 1996; Xu et al., 1998).

Aβ and ceramide share cell death signaling characteristics. Aβ-induced apoptosis involves TNF-α, p75 neurotrophin receptor, and Fas ligand (Blasko et al., 1997; de la Monte et al., 1997; Yaar et al., 1997), which are cell surface receptors that relay death signals through the sphingomyelin–ceramide pathway (Dobrowsky et al., 1995; Hannun, 1996). Moreover, both Aβ (Kaneko et al., 1995; Askanas et al., 1996; Bruce-Keller et al., 1998; Xu et al., 2001) and ceramide (Garcia-Ruiz et al., 1997; Singh et al., 1998) cause mitochondrial dysfunction and induce oxidative stress. In vitro, OLG death induced by Aβ (Xu et al., 2001) or ceramide (Larocca et al., 1997; Singh et al., 1998; Scurlock and Dawson, 1999) share similar apoptotic characteristics. Lower sphingomyelin levels and higher ceramide levels in AD brains have been reported (Soderberg et al., 1992), thereby implying that increased sphingomyelin degradation and ceramide accumulation contribute to AD pathogenesis. We have previously shown that Aβ induced OLG death with characteristic features of apoptosis (Xu et al., 2001). In this paper, we demonstrate that ceramide mediates Aβ-induced OLG death by activating the nSMase–ceramide cascade.

Results

Aβ and C2-ceramide are cytotoxic to OLGs

We have previously shown that Aβ induced apoptosis in primary OLG cultures derived from neonatal rat brains, characterized by nuclear and cytoskeletal disintegration, DNA fragmentation, and mitochondrial dysfunction (Xu et al., 2001). In this paper, we used neurosphere-derived differentiated OLGs because of their ease of preparation compared with primary OLG isolation. The neurosphere-derived differentiated OLGs exhibited characteristic OLG morphology, which is composed of large cell bodies with multiple branching processes (Fig. 1, A–H). Immunocytochemical analysis revealed that virtually all cells in culture expressed four OLG-specific surface markers including cyclic nucleotide 3′-phosphodiesterase (Fig. 1 A, CNP), Rip (Fig. 1 C), galactocerebroside (Fig. 1 E, GalC), and PLP (myelin proteolipid protein; Fig. 1 G). In addition, differentiated OLGs showed similar characteristic electrophysiological membrane potentials (unpublished data) as reported in previous studies (McDonald et al., 1999).

Figure 1.

Figure 1.

Characterization of OLG cultures. Immunofluorescent (A, C, E, and G) and corresponding phase-contrast (B, D, F, and H) photomicrographs of neurosphere-derived differentiated OLGs in culture. Cells demonstrate characteristic morphology of OLGs, plump cell body with multiple branching processes. Virtually all cells in culture immunostained for the OLG-specific antigens, CNP (A), Rip (C), GalC (E), and PLP (G). Bar, 30 μm.

As demonstrated previously, Aβ 1-40 and Aβ 25-35 peptides have equal potencies for inducing death in primary cultures of OLGs (Xu et al., 2001); thus, most of our studies were conducted using Aβ 25-35 with key experiments confirmed with Aβ 1-40. Aβ 25-35 treatment for 48 h caused OLG death in a concentration-dependent manner with an approximate EC50 = 20 μM (Fig. 2 A). C2-ceramide, a cell-permeable ceramide analogue, also induced dose-dependent OLG death with an approximate EC50 = 30 μM (Fig. 2 B). C2-dihydroceramide, a cell-impermeable and inactive form of ceramide, was not cytotoxic at concentrations up to 100 μM (unpublished data). The toxic effect of ceramide was apparent at an earlier time point than that of Aβ (Fig. 3, A and B), raising the possibility that ceramide may be a mediator of Aβ-induced cell death.

Figure 2.

Figure 2.

Aβ 25-35 and C2-ceramide induced OLG death. (A) OLGs treated with 10–100 μM Aβ 25-35 for 48 h. (B) OLGs exposed to 10–100 μM C2-ceramide for 24 h. The assessment of cell survival based on MTT assay or cell death based on LDH assay showed a dose-dependent cytotoxic effect of Aβ 25-35 and C2-ceramide. Data shown are representative of three separate experiments of triplicate samples with similar results; error bars represent SD.

Figure 3.

Figure 3.

Time-dependent cell death induced by Aβ 25-35 and C2-ceramide. (A) Cell survival as measured by MTT assay. (B) Cell death as determined by LDH assay. OLGs were treated with 20 μM Aβ 25-35 or 30 μM C2-ceramide for the time periods indicated. The cells and culture medium were used for the MTT or LDH assay, respectively. Note the faster pace of ceramide in inducing OLG death, 50% OLG death was noted 24 and 48 h after ceramide and Aβ treatment, respectively. Data shown are representative of three separate experiments of triplicate samples with similar results; error bars represent SD.

Ceramide in Aβ 25-35–induced OLG death

To support the contention that ceramide is involved in Aβ-induced OLG death, TLC and electrospray ionization/mass spectrometry (ESI/MS) were used to measure ceramide content in OLGs with and without Aβ treatment. Aβ 25-35 treatment resulted in a fivefold increase in ceramide synthesis as determined by TLC (Fig. 4 A). An increase in cellular ceramide content was confirmed by ESI/MS, which demonstrated peak ceramide content 10 h after Aβ treatment (Fig. 4 B). N-oleoyl-ethanolamine (NOE), a specific ceramidase inhibitor that prevents the degradation of cellular ceramide at subtoxic doses (Sugita et al., 1975; Pahan et al., 1998), augmented Aβ 25-35–induced OLG death (Fig. 4 C). Together, these results suggest a strong correlation between increases in cellular ceramide levels and Aβ-induced OLG death.

Figure 4.

Figure 4.

Aβ 25-35–induced ceramide production and enhancement of Aβ cytotoxicity by a ceramidase inhibitor. (A) An increase in cellular ceramide synthesis in OLGs prelabeled with [3H]palmitate and treated with 10 μM Aβ 25-35 for 24 h. (B) Quantitative determination of endogenous ceramide concentration by ESI/MS at various time points after Aβ 25-35 treatment. Note the elevated ceramide content at 5, 10, and 16 h after Aβ 25-35 exposure. (C) Effect of NOE, a ceramidase inhibitor, on Aβ-induced OLG death. OLGs were treated with 10 μM Aβ 25-35 plus 1 μM NOE for 24 h. The culture medium was collected for the LDH assay. Data shown are mean ± SD of three separate experiments in triplicate. *, Significant difference from control; **, significant difference from Aβ treatment; P < 0.05.

nSMase activation in Aβ 25-35–induced OLG death

Ceramide is derived from sphingomyelin hydrolysis catalyzed by nSMase or aSMase (Hannun, 1996). Aβ 25-35 treatment increased nSMase activity in OLGs as early as 2.5 min after exposure and reached maximal levels at ∼16 h (Fig. 5 A). Aβ 1-40 treatment also increased OLG nSMase activity in a similar manner (unpublished data). In contrast, Aβ 25-35 treatment did not alter aSMase activity (Fig. 5 A). The addition of recombinant bacterial sphingomyelinase (bSMase), an exogenous source of sphingomylinase that mimics nSMase action by degrading membrane sphingomyelin to increase cellular ceramide levels (Okazaki et al., 1989; Jarvis et al., 1994; Zhang et al., 1997; Tonnetti et al., 1999), caused OLG death (Fig. 5 B). Furthermore, the nSMase inhibitors, 3-O-methyl-sphingomyelin (3-OMe-SM; Lister et al., 1995) and NAC (Liu et al., 1998a; Yoshimura et al., 1999), were effective in protecting OLGs against Aβ cytotoxicity (Fig. 5, C and D). Confirming the effects of the nSMase inhibitors, a marked reduction in nSMase enzymatic activity was observed in OLGs treated with 3-OMe-SM or NAC (Fig. 6 A). Moreover, significant decreases in endogenous ceramide content and increases in sphingomyelin levels were detected in OLGs treated with the inhibitors (Fig. 6, B and C). To further confirm the contribution of nSMase in Aβ-mediated cell death, sense and antisense oligonucleotides specific for nSMase were generated. Antisense oligonucleotides reduced nSMase activity (Fig. 7 A), reduced ceramide content in cell lysates (Fig. 7 B), and attenuated Aβ-induced cell death (Fig. 7 C), but sense oligonucleotides had no effect on nSMase activity, ceramide content, or cell survival.

Figure 5.

Figure 5.

Sphingomyelinase in Aβ-induced OLG death. (A) nSMase and aSMase activity in OLGs treated with 10 μM Aβ 25-35 for various time periods (from 2.5 min to 36 h). (B) Aβ or bSMase induced OLG death as determined by LDH assay. OLGs were exposed to 10 μM Aβ 25-35 or bSMase (1 U/ml) for 24 h. (C) LDH and (D) trypan blue assays on the effects of nSMase inhibitors on Aβ-mediated OLG death. OLGs were treated with 25 mM NAC or 1 μM 3-OMe-SM for 2 h before 10 μM Aβ 25-35 treatment for 24 h. Data shown are representative of three separate experiments of triplicate samples with similar results; error bars represent SD. *, Significant difference from control; **, significant difference from Aβ treatment; P < 0.05.

Figure 6.

Figure 6.

Effect of nSMase inhibitors on sphingomyelinase activity and ceramide/sphingomyelin content in Aβ 25-35–treated OLGs. nSMase and aSMase activity (A) and cellular ceramide (B) and sphingomyelin (C) content in OLGs treated with NAC or 3-OMe-SM nSMase inhibitors. OLGs were treated with 1 μM 3-OMe-SM or 25 mM NAC for 2 h before 10 μM Aβ 25-35 exposure for 16 h. Representative TLC data are shown from one of three experiments in the top panels in B and C. A and the bottom panels in B and C show composite results from three separate experiments; error bars represent SD. *, Significant difference from control; **, significant difference from Aβ treatment; P < 0.05.

Figure 7.

Figure 7.

Treatment of OLGs with nSMase antisense oligonucleotides. OLGs were treated with sense or antisense oligonucleotides specific for nSMase 4 h before 20 μM Aβ addition. After 24 h, the cells were harvested and assayed for nSMase activity (A), ceramide content (B), and MTT (C). The graph depicts a representative of three separate experiments with similar results; error bars represent SD. *, Significant differences compared with Aβ treatment alone; P < 0.05.

It has been shown that Aβ depletes GSH in cortical neurons in vitro (Muller et al., 1997), which correlates well with the ability of Aβ to heighten cellular oxidative stress (Cafe et al., 1996). GSH depletion has been shown to activate nSMase activity (Liu and Hannun, 1997; Liu et al., 1998a,b). The fact that NAC, a GSH precursor, inhibited Aβ 25-35 activation of nSMase and prevented Aβ-mediated OLG death suggests that Aβ 25-35 depletion of cellular GSH is involved in the Aβ–nSMase–ceramide OLG death signaling cascade. Buthionine sulfoximine (BSO) and diethyl maleate (DEM) have been shown to deplete GSH in various cell types (Anderson and Meister, 1983; Masukawa et al., 1983; Szekely and Lobreau, 1987). Both BSO and DEM selectively increased nSMase activity (Fig. 8 A), increased ceramide levels (Fig. 8 B), decreased cellular GSH levels (Fig. 8 C), and were cytotoxic to OLGs (Fig. 8 D).

Figure 8.

Figure 8.

Effects of GSH depleting agents compared with Aβ 25-35 on sphingomyelinase activity, cellular GSH content, and cell survival. OLGs were treated with 10 μM Aβ 25-35, 100 μM BSO, or 500 μM DEM for 16 h before measurement of sphingomyelinase activity (A), ceramide synthesis (B), or GSH content (C), or 24 h before MTT assay (D). Data shown in A, C, and D are representative of three separate experiments of triplicate samples and, in B, of two separate experiments with similar findings; error bars represent SD. *, Significant difference from control; P < 0.05.

Because Aβ 25-35 did not activate aSMase, it is unlikely that aSMase is involved in Aβ 25-35–induced OLG death. Selective aSMase inhibitors such as desipramine and chlorpromazine (Albouz et al., 1986) were ineffective in protecting OLGs from Aβ 25-35–induced death (unpublished data). Furthermore, fumonisin B2, a ceramide synthase inhibitor, did not block Aβ 25-35 cytotoxicity in this cell death paradigm (unpublished data). Together, these results suggest that ceramide generation catalyzed by nSMase, but not aSMase or ceramide synthase, mediates the Aβ 25-35 death pathway in OLGs.

Discussion

Several lines of evidence support the contention that ceramide mediates, at least in part, Aβ-induced OLG death. Both Aβ and C2-ceramide (but not the biologically inactive dihydroceramide) caused OLG death in a time-dependent manner. Aβ treatment increased ceramide formation in OLGs. In addition, increasing cellular ceramide release from sphingomyelin by exogenous bSMase, which mimics cellular nSMase action, also induced OLG death. Inhibition of ceramide degradation by NOE, a ceramidase inhibitor, enhanced Aβ cytotoxicity in OLGs.

Results from this study also support the contention that Aβ cytotoxicity is mediated via activation of nSMase leading to increased cellular ceramide generation. Aβ 25-35 and Aβ 1-40 activated nSMase, but not aSMase, in OLGs. Additionally, nSMase inhibitors such as 3-OMe-SM and NAC (also an antioxidant) prevented Aβ 25-35–induced nSMase activity, which resulted in decreased ceramide synthesis from sphingomyelin and protected OLGs from Aβ 25-35 cytotoxicity. Antisense oligonucleotides specific for nSMase also attenuated Aβ-induced OLG cell death, further implicating nSMase as a mediator. Chemical agents such as BSO and DEM that deplete cellular GSH content also activated nSMase in OLGs and caused cell death. The specific role of nSMase in Aβ-induced OLG death is supported by the finding that pharmacological inhibition of nSMase, but not aSMase or ceramide synthase, prevented Aβ 25-35–induced OLG death.

The exact mechanism underlying Aβ-mediated nSMase activation remains to be elucidated but may involve changes in the cellular redox state and/or GSH metabolism (Sawai and Hannun, 1999); GSH is the most abundant thiol-containing compound in living cells. nSMase enzymatic activity is directly regulated by cellular GSH content (Liu and Hannun, 1997; Liu et al., 1998a,b). Aβ has been shown to deplete GSH in cultured cortical neurons (Muller et al., 1997), and depletion of cellular GSH stores by oxidative stress has been proposed as a prime mechanism underlying the Aβ cytotoxic action (Muller et al., 1997; Pereira et al., 1999). Thus, it is plausible that a decrease in GSH level subsequent to Aβ exposure may activate nSMase in OLGs. NAC, a GSH precursor, inhibited Aβ 25-35 activation of nSMase and protected OLGs against Aβ-induced death, whereas depletion of cellular GSH stores by BSO or DEM resulted in selective activation of nSMase and OLG death. Although the agents used to manipulate GSH levels may be relatively nonspecific, these findings raise the possibility that the activation of nSMase by Aβ may involve the depletion of cellular GSH content.

Oxidative stress plays a prominent role in Aβ-mediated neuronal and OLG death (Behl et al., 1994; Behl, 1999; Markesbery, 1999; Xu et al., 2001). Brain tissue is especially sensitive to oxidative injury because of its higher metabolic rate driven by glucose, lower concentrations of protective antioxidants, and higher levels of polyunsaturated fatty acids that are susceptible to lipid peroxidation (Behl and Sagara, 1997; Behl, 1999; Markesbery, 1999). Although Aβ-mediated oxidative stress induces mtDNA damage (Bozner et al., 1997; Xu et al., 2001) and activates selected transcription factors including NF-κB and AP-1 (Abate et al., 1990; Schreck et al., 1991; Pinkus et al., 1996; Xu et al., 2001), the mechanism by which Aβ induces oxidative stress in the AD brain remains unknown. Ceramide has emerged as a potent second messenger in oxidative stress-induced apoptosis (Hannun and Luberto, 2000). Hydrogen peroxide (Goldkorn et al., 1998), 1-β-d-arabinofuranosylcytosine (Bradshaw et al., 1996), daunorubicin (Jaffrezou et al., 1996), TNF-α (Bezombes et al., 1998), γ-rays (Bruno et al., 1998), hypoxia (Yoshimura et al., 1998), CD40 activation (Segui et al., 1999), and sindbis virus infection (Jan et al., 2000) are among the agents that can mediate cell death via nSMase activation, thus emphasizing the central role of the nSMase–ceramide cascade. Results shown here provide a unique signaling pathway from cell surface Aβ engagement, induction of oxidative stress, and activation of the nSMase–ceramide cascade culminating in OLG death.

In summary, this work demonstrates a novel mechanism for Aβ-induced OLG death. These results reveal a causal relationship between Aβ exposure and the activation of the nSMase–ceramide pathway, which is likely to involve heightened oxidative stress after depletion of cellular GSH stores. In addition, we have evidence that activation of the nSMase–ceramide cascade may also contribute to Aβ-induced death of cortical neurons and cerebral endothelial cells (unpublished data), thereby suggesting that this cascade may be operating in many cell types other than OLGs. Aβ→nSMase→ceramide cascade represents a novel signaling pathway that contributes at least in part to Aβ cytotoxicity to various types of brain cells. Identification of this pathway may lead to the development of more effective therapeutic strategies aimed at preventing Aβ-induced cell death. For instance, blockade of the Aβ-activated death signaling process can be achieved by pharmacological modulation of nSMase activity as demonstrated in this work.

Materials and methods

Reagents and cell culture

All chemicals were purchased from Sigma-Aldrich, and all cell culture reagents were purchased from Invitrogen unless otherwise specified. B104 cells (a gift from David Schubert, Salk Institute for Biological Studies, La Jolla, CA) were cultured in DME supplemented with 10% FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin.

OLG culture

Neurospheres were cultured using the methods of Zhang et al. (1999) with modifications. In brief, embryonic rat brains (E14–16 d) were dissected, homogenized gently in DME/Ham's F12, and centrifuged at 350 g for 5 min. The pellet was digested with 0.05% trypsin in 1.5 ml of 0.53 M EDTA for 30 min at 37°C, followed by the addition of 1.5 ml DME/Ham's F12 with 20% FBS, and filtered through 10-μm nylon mesh. The filtrate was centrifuged at 350 g for 5 min, and the pellet was washed twice with DME/Ham's F12. Dissociated cells were layered on a preequilibrated Percoll gradient (formed by centrifuging 50% Percoll and 50% DME/Ham's F12 at 23,500 g for 1 h at 4°C) and centrifuged at 3,500 g for 15 min. The fraction containing glial progenitors banding between myelin and blood cell layers was recovered and washed twice with DME/Ham's F12 followed by another wash with neurosphere culture medium (DME/Ham's F12/Hepes, N1 supplement, 25 μg/ml insulin, 130 ng/ml progesterone, 20 ng/ml of basic FGF, and 20 ng/ml EGF). The cell pellet was resuspended in 20 ml of neurosphere culture medium and seeded in 75-mm culture flasks. After 24 h, when neurospheres had formed, 5 ml of fresh medium was added to each culture every other day for 7 d, and then the neurosphere cultures were split (1:2). The neurospheres were dissociated gently 10 times with a syringe and a 25-gauge needle and centrifuged at 350 g. The resulting cell pellets were treated with 0.05% trypsin/0.53 mM EDTA and centrifuged at 350 g for 10 min. The cells were resuspended in progenitor medium (69% DME/Ham's F12/Hepes containing N1 supplement, 10 μg/ml insulin, 20 nM progesterone, 30% conditioned medium from B104 cells, and 1% FBS) and plated on 100-mm culture dishes precoated with poly-l-ornithine. For differentiated OLG cultures, progenitor cells were detached with trypsin/EDTA and cultured on poly-l-ornithine–coated plates or coverslips in mature OLG medium (DME/Ham's F12; N1 supplement, 20 μg/ml biotin; 20 μg/ml triiodo-l-thyronine, T3, and 1% FBS).

Immunocytochemistry

Differentiated OLG cultures were fixed in 4% PFA, washed in PBS, and blocked with 5% goat serum. Fixed cells were incubated with the primary antibody overnight at 4°C. The following primary antibodies were used: anti–mouse CNP, anti–mouse Rip, anti–mouse PLP (Chemicon), and anti–mouse GalC (Cedarlane Laboratories) at a concentration of 1:100. The secondary antibody, anti–mouse IgG conjugated to FITC (Vector Laboratories), was added for 1 h at RT. The cells were washed in PBS and visualized using a confocal microscope (model LSM 5 Pascal; Carl Zeiss MicroImaging, Inc.) equipped with a CCD camera (model Axiocam HR; Carl Zeiss MicroImaging, Inc.). Images were collected and processed using Adobe Photoshop software.

Sphingomyelinase assay

The cells were washed twice with PBS, pH 7.4, and lysed in 0.2% Triton X-100 for 10 min at 4°C. The lysates were sonicated for 30 s in ice-cold bath, and protein concentrations were determined by Lowry assay (Lowry et al., 1951). A sphingomyelinase substrate, [methyl-14C]sphingomyelin (55 mCi/mmol; Amersham Biosciences), was evaporated to dryness and resuspended in either 25 μl of nSMase assay buffer (40 mM Hepes, 5 mM MgCl2, and 0.2% Triton X-100, pH 7.4) or aSMase assay buffer (250 mM sodium acetate and 0.2% Triton X-100, pH 5.2) and sonicated to form micelles on ice until use. Each reaction containing 25 μl of cell lysate protein (1 mg/ml) and 25 μl [methyl-14C]sphingomyelin (0.23 nmol) in nSMase or aSMase assay buffer was incubated for 2 h at 37°C. The reaction was terminated with 200 μl CHCl3/methanol (1:1) and 90 μl H2O followed by vigorous agitation. The samples were centrifuged at 6,000 g for 5 min. [14C]Phosphocholine in the aqueous phase (120 μl) was collected for liquid scintillation counting. Phosphocholine is the degraded moiety of sphingomyelin after ceramide is released by nSMase or aSMase. The aSMase or nSMase activity was calculated as picomoles of sphingomyelin hydrolyzed by 1 mg of total proteins per hour and expressed as a percentage of control values.

TLC

OLGs with or without Aβ 25-35 treatment were cultured with 10 μCi [3H]palmitate (1 mCi/ml; Amersham Biosciences; Kaneko et al., 1995). The labeled cells were collected and washed twice with PBS, pH 7.4, to remove free isotope before lipid extraction (Xu et al., 1998). The cell pellet was resuspended in 400 μl methanol/1 N HCl (100:6, vol/vol) followed by 800 μl chloroform and 240 μl H2O. The sample was mixed and centrifuged at 6,000 g for 5 min. The lipid fraction was reextracted with 1 ml chloroform/methanol (2:1, vol/vol) and applied to a TLC plate. The solvent was chloroform/methanol/acetic acid/H2O (85:4.5:5:0.5, vol/vol) for ceramide and chloroform/methanol/acetic acid/water (65:25:8.8:4.5, vol/vol) for sphingomyelin. Plates were air dried and sprayed with 1 M sodium salicylate for autoradiography. Standard lipids were stained by rhodamine 6G (Sigma-Aldrich) and visualized by UV light.

Quantitative ceramide analysis by ESI/MS

After three washes with PBS, pH 7.4, OLGs harvested from 100-mm culture plates with or without Aβ 25-35 treatment were homogenized in 0.5 ml PBS, pH 7.4, with a glass tissue grinder. A bicinchomic protein assay kit was used to determine the protein concentration before lipid extraction (Pierce Chemical Co.). Lipids from the homogenates were extracted as described previously with modifications (Bligh and Dyer, 1959) using 50 mM LiOH in the aqueous layer and C17:0 ceramide (2 nmol/mg protein) as an internal standard for quantitation of ceramide content. These molecular species represent <1% of the endogenous cellular lipid mass. The lipid extracts were dried under a nitrogen stream, dissolved in chloroform, desalted with Sep-Pak columns, and filtered with 0.2 μm PTFE syringe filters (Fisher Scientific). Lipids were reextracted with 20 mM LiOH in the aqueous layer, dried under a nitrogen stream, and resuspended in 0.5 ml of chloroform/methanol (1:1, vol/vol) for ESI/MS analysis.

ESI/MS analysis was performed using a spectrometer (model TSQ-7000; Finnigan) equipped with an electrospray ion source as described previously (Han et al., 1996, 2001). A 5-min period of signal averaging in the profile mode was used for each spectrum of a lipid extract. All extracts were directly infused into the ESI chamber using a syringe pump at 1 μl/min flow rate. Ceramide in the lipid extracts was quantitated directly as deprotenated ions ([M-H]) in comparison with an internal standard (C17:0 ceramide) after correction for 13C isotope effects in the negative-ion mode. Ion peaks were identified using tandem mass spectroscopic analyses as described previously (Han and Gross, 1995).

Cell death assays

OLG viability was quantitated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and trypan blue exclusion method. Cell death was also assessed by the amount of lactate dehydrogenase (LDH) release into the culture medium after Aβ or C2-ceramide treatment (Koh and Choi, 1987; Shaikh et al., 1997; Xu et al., 1998). The amount of LDH released by cells killed with Triton X-100 was considered maximal cell death or “full kill” (Xu et al., 1998).

Assay for cellular GSH content

Cellular GSH levels were determined using a GSH-400 colorimetric assay kit (Calbiochem-Novabiochem). Triplicate samples (3 × 106 cells) were collected by centrifugation and washed twice with PBS, pH 7.4. The cell pellets were treated with 5% metaphosphoric acid (Sigma-Aldrich). A Teflon pestle was used to homogenize the cells. Protein concentrations were determined by Lowry assay (Lowry et al., 1951). The homogenates were centrifuged at 3,000 g for 10 min at 4°C. Supernatants were assayed for GSH according to the instructions provided with the kit. A standard curve was generated with graded concentrations of GSH (5–40 μM). GSH concentration was measured by absorbance at 400 nm with a spectrophotometer.

nSMase antisense oligonucleotides

Morpholino sense (GCCGCAGAGAAAAGTTGTGCTTCAT) and antisense (CCTCTTACCTCAGTTACAATTTATA) oligonucleotides were generated for nSMase (Gene Tools, LLC). OLGs in serum-free medium were treated with 1.4 μM oligonucleotides in EPEI delivery solution (per manufacturer's instructions; Gene Tools) for 4 h. The medium was exchanged and Aβ was added for 24 h, after which cells were harvested for nSMase activity or cell death determination.

Statistical analysis

Results are expressed as mean ± SD. Differences among groups were analyzed by one-way ANOVA followed by Bonferroni's post-hoc t test to determine statistical significance. Comparison between two experimental groups was based on two-tailed t test. P < 0.05 was considered statistically significant.

Acknowledgments

We would like to thank Dr. Yannan Ouyang for his technical expertise in confocal microscopy.

This work was supported by National Institutes of Heath grants NS37230 and NS40525.

J.-T. Lee and J. Xu contributed equally to this paper.

Abbreviations used in this paper: 3-OMe-SM, 3-O-methyl-sphingomyelin; Aβ, amyloid-β peptide; AD, Alzheimer's disease; aSMase, acidic sphingomyelinase; bSMase, bacterial sphingomyelinase; BSO, buthionine sulfoximine; DEM, diethyl maleate; ESI/MS, electrospray ionization/mass spectrometry; GSH, glutathione; LDH, lactate dehydrogenase; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; NAC, N-acetylcysteine; nSMase, neutral sphingomyelinase; NOE, N-oleoyl-ethanolamine; OLG, oligodendrocyte; PLP, proteolipid protein.

References

  1. Abate, C., L. Patel, F.J. Rauscher, III, and T. Curran. 1990. Redox regulation of fos and jun DNA-binding activity in vitro. Science. 249:1157–1161. [DOI] [PubMed] [Google Scholar]
  2. Albouz, S., F. Le Saux, D. Wenger, J.J. Hauw, and N. Baumann. 1986. Modifications of sphingomyelin and phosphatidylcholine metabolism by tricyclic antidepressants and phenothiazines. Life Sci. 38:357–363. [DOI] [PubMed] [Google Scholar]
  3. Anderson, M.E., and A. Meister. 1983. Transport and direct utilization of gamma-glutamylcyst(e)ine for glutathione synthesis. Proc. Natl. Acad. Sci. USA. 80:707–711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Askanas, V., J. McFerrin, S. Baque, R.B. Alvarez, E. Sarkozi, and W.K. Engel. 1996. Transfer of beta-amyloid precursor protein gene using adenovirus vector causes mitochondrial abnormalities in cultured normal human muscle. Proc. Natl. Acad. Sci. USA. 93:1314–1319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Back, S.A., X. Gan, Y. Li, P.A. Rosenberg, and J.J. Volpe. 1998. Maturation-dependent vulnerability of oligodendrocytes to oxidative stress-induced death caused by glutathione depletion. J. Neurosci. 18:6241–6253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Behl, C. 1999. Alzheimer's disease and oxidative stress: implications for novel therapeutic approaches. Prog. Neurobiol. 57:301–323. [DOI] [PubMed] [Google Scholar]
  7. Behl, C., and Y. Sagara. 1997. Mechanism of amyloid beta protein induced neuronal cell death: current concepts and future perspectives. J. Neural Transm. Suppl. 49:125–134. [DOI] [PubMed] [Google Scholar]
  8. Behl, C., J.B. Davis, R. Lesley, and D. Schubert. 1994. Hydrogen peroxide mediates amyloid beta protein toxicity. Cell. 77:817–827. [DOI] [PubMed] [Google Scholar]
  9. Bezombes, C., N. Maestre, G. Laurent, T. Levade, A. Bettaieb, and J.P. Jaffrezou. 1998. Restoration of TNF-alpha-induced ceramide generation and apoptosis in resistant human leukemia KG1a cells by the P-glycoprotein blocker PSC833. FASEB J. 12:101–109. [DOI] [PubMed] [Google Scholar]
  10. Blasko, I., T.L. Schmitt, E. Steiner, K. Trieb, and B. Grubeck-Loebenstein. 1997. Tumor necrosis factor alpha augments amyloid beta protein (25-35) induced apoptosis in human cells. Neurosci. Lett. 238:17–20. [DOI] [PubMed] [Google Scholar]
  11. Bligh, E.G., and W.J. Dyer. 1959. A rapid method of total lipid extraction and purification. Can. J. Med. Sci. 37:911–917. [DOI] [PubMed] [Google Scholar]
  12. Bose, R., M. Verheij, A. Haimovitz-Friedman, K. Scotto, Z. Fuks, and R. Kolesnick. 1995. Ceramide synthase mediates daunorubicin-induced apoptosis: an alternative mechanism for generating death signals. Cell. 82:405–414. [DOI] [PubMed] [Google Scholar]
  13. Bozner, P., V. Grishko, S.P. LeDoux, G.L. Wilson, Y.C. Chyan, and M.A. Pappolla. 1997. The amyloid beta protein induces oxidative damage of mitochondrial DNA. J. Neuropathol. Exp. Neurol. 56:1356–1362. [DOI] [PubMed] [Google Scholar]
  14. Bradshaw, C.D., K.M. Ella, A.L. Thomas, C. Qi, and K.E. Meier. 1996. Effects of Ara-C on neutral sphingomyelinase and mitogen- and stress-activated protein kinases in T-lymphocyte cell lines. Biochem. Mol. Biol. Int. 40:709–719. [DOI] [PubMed] [Google Scholar]
  15. Brera, B., A. Serrano, and M.L. de Ceballos. 2000. beta-amyloid peptides are cytotoxic to astrocytes in culture: a role for oxidative stress. Neurobiol. Dis. 7:395–405. [DOI] [PubMed] [Google Scholar]
  16. Bruce-Keller, A.J., J.G. Begley, W. Fu, D.A. Butterfield, D.E. Bredesen, J.B. Hutchins, K. Hensley, and M.P. Mattson. 1998. Bcl-2 protects isolated plasma and mitochondrial membranes against lipid peroxidation induced by hydrogen peroxide and amyloid beta-peptide. J. Neurochem. 70:31–39. [DOI] [PubMed] [Google Scholar]
  17. Bruno, A.P., G. Laurent, D. Averbeck, C. Demur, J. Bonnet, A. Bettaieb, T. Levade, and J.P. Jaffrezou. 1998. Lack of ceramide generation in TF-1 human myeloid leukemic cells resistant to ionizing radiation. Cell Death Differ. 5:172–182. [DOI] [PubMed] [Google Scholar]
  18. Cafe, C., C. Torri, L. Bertorelli, N. Angeretti, E. Lucca, G. Forloni, and F. Marzatico. 1996. Oxidative stress after acute and chronic application of beta-amyloid fragment 25-35 in cortical cultures. Neurosci. Lett. 203:61–65. [DOI] [PubMed] [Google Scholar]
  19. Coroneos, E., M. Martinez, S. McKenna, and M. Kester. 1995. Differential regulation of sphingomyelinase and ceramidase activities by growth factors and cytokines. Implications for cellular proliferation and differentiation. J. Biol. Chem. 270:23305–23309. [DOI] [PubMed] [Google Scholar]
  20. Davis-Salinas, J., S.M. Saporito-Irwin, C.W. Cotman, and W.E. Van Nostrand. 1995. Amyloid beta-protein induces its own production in cultured degenerating cerebrovascular smooth muscle cells. J. Neurochem. 65:931–934. [DOI] [PubMed] [Google Scholar]
  21. de la Monte, S.M., Y.K. Sohn, and J.R. Wands. 1997. Correlates of p53- and Fas (CD95)-mediated apoptosis in Alzheimer's disease. J. Neurol. Sci. 152:73–83. [DOI] [PubMed] [Google Scholar]
  22. Dobrowsky, R.T., G.M. Jenkins, and Y.A. Hannun. 1995. Neurotrophins induce sphingomyelin hydrolysis. Modulation by co-expression of p75NTR with Trk receptors. J. Biol. Chem. 270:22135–22142. [DOI] [PubMed] [Google Scholar]
  23. Estus, S., T.E. Golde, T. Kunishita, D. Blades, D. Lowery, M. Eisen, M. Usiak, X.M. Qu, T. Tabira, B.D. Greenberg, et al. 1992. Potentially amyloidogenic, carboxyl-terminal derivatives of the amyloid protein precursor. Science. 255:726–728. [DOI] [PubMed] [Google Scholar]
  24. Garcia-Ruiz, C., A. Colell, M. Mari, A. Morales, and J.C. Fernandez-Checa. 1997. Direct effect of ceramide on the mitochondrial electron transport chain leads to generation of reactive oxygen species. Role of mitochondrial glutathione. J. Biol. Chem. 272:11369–11377. [DOI] [PubMed] [Google Scholar]
  25. Goldkorn, T., N. Balaban, M. Shannon, V. Chea, K. Matsukuma, D. Gilchrist, H. Wang, and C. Chan. 1998. H2O2 acts on cellular membranes to generate ceramide signaling and initiate apoptosis in tracheobronchial epithelial cells. J. Cell Sci. 111:3209–3220. [DOI] [PubMed] [Google Scholar]
  26. Haass, C., M.G. Schlossmacher, A.Y. Hung, C. Vigo-Pelfrey, A. Mellon, B.L. Ostaszewski, I. Lieberburg, E.H. Koo, D. Schenk, D.B. Teplow, et al. 1992. Amyloid beta-peptide is produced by cultured cells during normal metabolism. Nature. 359:322–325. [DOI] [PubMed] [Google Scholar]
  27. Haimovitz-Friedman, A., C.C. Kan, D. Ehleiter, R.S. Persaud, M. McLoughlin, Z. Fuks, and R.N. Kolesnick. 1994. Ionizing radiation acts on cellular membranes to generate ceramide and initiate apoptosis. J. Exp. Med. 180:525–535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Han, X., and R.W. Gross. 1995. Structural determination of picomole amounts of phospholipids via electrospray ionization tandem mass spectrometry. J. Am. Soc. Mass Spectrom. 6:1202–1210. [DOI] [PubMed] [Google Scholar]
  29. Han, X., R.A. Gubitosi-Klug, B.J. Collins, and R.W. Gross. 1996. Alterations in individual molecular species of human platelet phospholipids during thrombin stimulation: electrospray ionization mass spectrometry-facilitated identification of the boundary conditions for the magnitude and selectivity of thrombin-induced platelet phospholipid hydrolysis. Biochemistry. 35:5822–5832. [DOI] [PubMed] [Google Scholar]
  30. Han, X., D.M. Holtzman, and D.W. McKeel. 2001. Plasmalogen deficiency in early Alzheimer's disease subjects and in animal models: molecular characterization using electrospray ionization mass spectrometry. J. Neurochem. 77:1168–1180. [DOI] [PubMed] [Google Scholar]
  31. Hannun, Y.A. 1996. Functions of ceramide in coordinating cellular responses to stress. Science. 274:1855–1859. [DOI] [PubMed] [Google Scholar]
  32. Hannun, Y.A., and C. Luberto. 2000. Ceramide in the eukaryotic stress response. Trends Cell Biol. 10:73–80. [DOI] [PubMed] [Google Scholar]
  33. Huang, S.S., F.W. Huang, J. Xu, S. Chen, C.Y. Hsu, and J.S. Huang. 1998. Amyloid beta-peptide possesses a transforming growth factor-beta activity. J. Biol. Chem. 273:27640–27644. [DOI] [PubMed] [Google Scholar]
  34. Jaffrezou, J.P., T. Levade, A. Bettaieb, N. Andrieu, C. Bezombes, N. Maestre, S. Vermeersch, A. Rousse, and G. Laurent. 1996. Daunorubicin-induced apoptosis: triggering of ceramide generation through sphingomyelin hydrolysis. EMBO J. 15:2417–2424. [PMC free article] [PubMed] [Google Scholar]
  35. Jan, J.T., S. Chatterjee, and D.E. Griffin. 2000. Sindbis virus entry into cells triggers apoptosis by activating sphingomyelinase, leading to the release of ceramide. J. Virol. 74:6425–6432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Jarvis, W.D., R.N. Kolesnick, F.A. Fornari, R.S. Traylor, D.A. Gewirtz, and S. Grant. 1994. Induction of apoptotic DNA damage and cell death by activation of the sphingomyelin pathway. Proc. Natl. Acad. Sci. USA. 91:73–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Juurlink, B.H., S.K. Thorburne, and L. Hertz. 1998. Peroxide-scavenging deficit underlies oligodendrocyte susceptibility to oxidative stress. Glia. 22:371–378. [DOI] [PubMed] [Google Scholar]
  38. Kaneko, I., N. Yamada, Y. Sakuraba, M. Kamenosono, and S. Tutumi. 1995. Suppression of mitochondrial succinate dehydrogenase, a primary target of beta-amyloid, and its derivative racemized at Ser residue. J. Neurochem. 65:2585–2593. [DOI] [PubMed] [Google Scholar]
  39. Kawai, M., R.N. Kalaria, P. Cras, S.L. Siedlak, M.E. Velasco, E.R. Shelton, H.W. Chan, B.D. Greenberg, and G. Perry. 1993. Degeneration of vascular muscle cells in cerebral amyloid angiopathy of Alzheimer disease. Brain Res. 623:142–146. [DOI] [PubMed] [Google Scholar]
  40. Koh, J.Y., and D.W. Choi. 1987. Quantitative determination of glutamate mediated cortical neuronal injury in cell culture by lactate dehydrogenase efflux assay. J. Neurosci. Methods. 20:83–90. [DOI] [PubMed] [Google Scholar]
  41. Kolesnick, R.N., and M. Kronke. 1998. Regulation of ceramide production and apoptosis. Annu. Rev. Physiol. 60:643–665. [DOI] [PubMed] [Google Scholar]
  42. Kyriakis, J.M., and J. Avruch. 1996. Protein kinase cascades activated by stress and inflammatory cytokines. Bioessays. 18:567–577. [DOI] [PubMed] [Google Scholar]
  43. Larocca, J.N., M. Farooq, and W.T. Norton. 1997. Induction of oligodendrocyte apoptosis by C2-ceramide. Neurochem. Res. 22:529–534. [DOI] [PubMed] [Google Scholar]
  44. Levade, T., and J.P. Jaffrezou. 1999. Signalling sphingomyelinases: which, where, how and why? Biochim. Biophys. Acta. 1438:1–17. [DOI] [PubMed] [Google Scholar]
  45. Lister, M.D., Z.S. Ruan, and R. Bittman. 1995. Interaction of sphingomyelinase with sphingomyelin analogs modified at the C-1 and C-3 positions of the sphingosine backbone. Biochim. Biophys. Acta. 1256:25–30. [DOI] [PubMed] [Google Scholar]
  46. Liu, B., and Y.A. Hannun. 1997. Inhibition of the neutral magnesium-dependent sphingomyelinase by glutathione. J. Biol. Chem. 272:16281–16287. [DOI] [PubMed] [Google Scholar]
  47. Liu, B., N. Andrieu-Abadie, T. Levade, P. Zhang, L.M. Obeid, and Y.A. Hannun. 1998. a. Glutathione regulation of neutral sphingomyelinase in tumor necrosis factor-alpha-induced cell death. J. Biol. Chem. 273:11313–11320. [DOI] [PubMed] [Google Scholar]
  48. Liu, B., D.F. Hassler, G.K. Smith, K. Weaver, and Y.A. Hannun. 1998. b. Purification and characterization of a membrane bound neutral pH optimum magnesium-dependent and phosphatidylserine-stimulated sphingomyelinase from rat brain. J. Biol. Chem. 273:34472–34479. [DOI] [PubMed] [Google Scholar]
  49. Lowry, O.H., N.J. Rosebrough, A.L. Farr, and R.J. Randall. 1951. Protein measurement with the Folin-Phenol reagents. J. Biol. Chem. 193:265–275. [PubMed] [Google Scholar]
  50. Markesbery, W.R. 1999. The role of oxidative stress in Alzheimer disease. Arch. Neurol. 56:1449–1452. [DOI] [PubMed] [Google Scholar]
  51. Masters, C.L., G. Multhaup, G. Simms, J. Pottgiesser, R.N. Martins, and K. Beyreuther. 1985. Neuronal origin of a cerebral amyloid: neurofibrillary tangles of Alzheimer's disease contain the same protein as the amyloid of plaque cores and blood vessels. EMBO J. 4:2757–2763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Masukawa, T., T. Nishimura, H. Kito, and H. Iwata. 1983. Influence of diethylmaleate on the formation of bis(methylmercuric)selenide and methylmercury distribution in rats. J. Pharmacobiodyn. 6:950–953. [DOI] [PubMed] [Google Scholar]
  53. McDonald, J.W., X.Z. Liu, Y. Qu, S. Liu, S.K. Mickey, D. Turetsky, D.I. Gottlieb, and D.W. Choi. 1999. Transplanted embryonic stem cells survive, differentiate and promote recovery in injured rat spinal cord. Nat. Med. 5:1410–1412. [DOI] [PubMed] [Google Scholar]
  54. Muller, W.E., F.J. Romero, S. Perovic, G. Pergande, and P. Pialoglou. 1997. Protection of flupirtine on beta-amyloid-induced apoptosis in neuronal cells in vitro: prevention of amyloid-induced glutathione depletion. J. Neurochem. 68:2371–2377. [DOI] [PubMed] [Google Scholar]
  55. Okazaki, T., R.M. Bell, and Y.A. Hannun. 1989. Sphingomyelin turnover induced by vitamin D3 in HL-60 cells. Role in cell differentiation. J. Biol. Chem. 264:19076–19080. [PubMed] [Google Scholar]
  56. Pahan, K., F.G. Sheikh, M. Khan, A.M. Namboodiri, and I. Singh. 1998. Sphingomyelinase and ceramide stimulate the expression of inducible nitric-oxide synthase in rat primary astrocytes. J. Biol. Chem. 273:2591–2600. [DOI] [PubMed] [Google Scholar]
  57. Pereira, C., M.S. Santos, and C. Oliveira. 1999. Involvement of oxidative stress on the impairment of energy metabolism induced by A beta peptides on PC12 cells: protection by antioxidants. Neurobiol. Dis. 6:209–219. [DOI] [PubMed] [Google Scholar]
  58. Pinkus, R., L.M. Weiner, and V. Daniel. 1996. Role of oxidants and antioxidants in the induction of AP-1, NF-kappaB, and glutathione S-transferase gene expression. J. Biol. Chem. 271:13422–13429. [DOI] [PubMed] [Google Scholar]
  59. Sawai, H., and Y.A. Hannun. 1999. Ceramide and sphingomyelinases in the regulation of stress responses. Chem Phys. Lipids. 102:141–147. [DOI] [PubMed] [Google Scholar]
  60. Schapira, A.H. 1996. Oxidative stress and mitochondrial dysfunction in neurodegeneration. Curr. Opin. Neurol. 9:260–264. [DOI] [PubMed] [Google Scholar]
  61. Schreck, R., P. Rieber, and P.A. Baeuerle. 1991. Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kappa B transcription factor and HIV-1. EMBO J. 10:2247–2258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Scurlock, B., and G. Dawson. 1999. Differential responses of oligodendrocytes to tumor necrosis factor and other pro-apoptotic agents: role of ceramide in apoptosis. J. Neurosci. Res. 55:514–522. [DOI] [PubMed] [Google Scholar]
  63. Segui, B., N. Andrieu-Abadie, S. Adam-Klages, O. Meilhac, D. Kreder, V. Garcia, A.P. Bruno, J.P. Jaffrezou, R. Salvayre, M. Kronke, and T. Levade. 1999. CD40 signals apoptosis through FAN-regulated activation of the sphingomyelin-ceramide pathway. J. Biol. Chem. 274:37251–37258. [DOI] [PubMed] [Google Scholar]
  64. Shaikh, A.Y., J. Xu, Y. Wu, L. He, and C.Y. Hsu. 1997. Melatonin protects bovine cerebral endothelial cells from hyperoxia-induced DNA damage and death. Neurosci. Lett. 229:193–197. [DOI] [PubMed] [Google Scholar]
  65. Singh, I., K. Pahan, M. Khan, and A.K. Singh. 1998. Cytokine-mediated induction of ceramide production is redox-sensitive. Implications to proinflammatory cytokine-mediated apoptosis in demyelinating diseases. J. Biol. Chem. 273:20354–20362. [DOI] [PubMed] [Google Scholar]
  66. Soderberg, M., C. Edlund, I. Alafuzoff, K. Kristensson, and G. Dallner. 1992. Lipid composition in different regions of the brain in Alzheimer's disease/senile dementia of Alzheimer's type. J. Neurochem. 59:1646–1653. [DOI] [PubMed] [Google Scholar]
  67. Spiegel, S., and A.H. Merrill, Jr. 1996. Sphingolipid metabolism and cell growth regulation. FASEB J. 10:1388–1397. [DOI] [PubMed] [Google Scholar]
  68. Sugita, M., M. Willians, J.T. Dulaney, and H.W. Moser. 1975. Ceramidase and ceramide synthesis in human kidney and cerebellum. Description of a new alkaline ceramidase. Biochim. Biophys. Acta. 398:125–131. [DOI] [PubMed] [Google Scholar]
  69. Szekely, J.G., and A.U. Lobreau. 1987. The effect of glutathione depletion by diamide, diethyl maleate or buthione sulfoximine on the surface structure of mouse L-cells. Scanning Microsc. 1:273–281. [PubMed] [Google Scholar]
  70. Tepper, C.G., S. Jayadev, B. Liu, A. Bielawska, R. Wolff, S. Yonehara, Y.A. Hannun, and M.F. Seldin. 1995. Role for ceramide as an endogenous mediator of Fas-induced cytotoxicity. Proc. Natl. Acad. Sci. USA. 92:8443–8447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Testi, R. 1996. Sphingomyelin breakdown and cell fate. Trends Biochem. Sci. 21:468–471. [DOI] [PubMed] [Google Scholar]
  72. Thomas, T., G. Thomas, C. McLendon, T. Sutton, and M. Mullan. 1996. beta-Amyloid-mediated vasoactivity and vascular endothelial damage. Nature. 380:168–171. [DOI] [PubMed] [Google Scholar]
  73. Thorburne, S.K., and B.H. Juurlink. 1996. Low glutathione and high iron govern the susceptibility of oligodendroglial precursors to oxidative stress. J. Neurochem. 67:1014–1022. [DOI] [PubMed] [Google Scholar]
  74. Tonnetti, L., M.C. Veri, E. Bonvini, and L. D'Adamio. 1999. A role for neutral sphingomyelinase-mediated ceramide production in T cell receptor-induced apoptosis and mitogen-activated protein kinase–mediated signal transduction. J. Exp. Med. 189:1581–1589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Verheij, M., R. Bose, X.H. Lin, B. Yao, W.D. Jarvis, S. Grant, M.J. Birrer, E. Szabo, L.I. Zon, J.M. Kyriakis, et al. 1996. Requirement for ceramide-initiated SAPK/JNK signalling in stress-induced apoptosis. Nature. 380:75–79. [DOI] [PubMed] [Google Scholar]
  76. Xu, J., C.H. Yeh, S. Chen, L. He, S.L. Sensi, L.M. Canzoniero, D.W. Choi, and C.Y. Hsu. 1998. Involvement of de novo ceramide biosynthesis in tumor necrosis factor-alpha/cycloheximide-induced cerebral endothelial cell death. J. Biol. Chem. 273:16521–16526. [DOI] [PubMed] [Google Scholar]
  77. Xu, J., S. Chen, S.H. Ahmed, H. Chen, G. Ku, M.P. Goldberg, and C.Y. Hsu. 2001. Amyloid-beta peptides are cytotoxic to oligodendrocytes. J. Neurosci. 21:RC118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Yaar, M., S. Zhai, P.F. Pilch, S.M. Doyle, P.B. Eisenhauer, R.E. Fine, and B.A. Gilchrest. 1997. Binding of beta-amyloid to the p75 neurotrophin receptor induces apoptosis. A possible mechanism for Alzheimer's disease. J. Clin. Invest. 100:2333–2340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Yankner, B.A., L.R. Dawes, S. Fisher, L. Villa-Komaroff, M.L. Oster-Granite, and R.L. Neve. 1989. Neurotoxicity of a fragment of the amyloid precursor associated with Alzheimer's disease. Science. 245:417–420. [DOI] [PubMed] [Google Scholar]
  80. Yoshimura, S., Y. Banno, S. Nakashima, K. Takenaka, H. Sakai, Y. Nishimura, N. Sakai, S. Shimizu, Y. Eguchi, Y. Tsujimoto, and Y. Nozawa. 1998. Ceramide formation leads to caspase-3 activation during hypoxic PC12 cell death. Inhibitory effects of Bcl-2 on ceramide formation and caspase-3 activation. J. Biol. Chem. 273:6921–6927. [DOI] [PubMed] [Google Scholar]
  81. Yoshimura, S., Y. Banno, S. Nakashima, K. Hayashi, H. Yamakawa, M. Sawada, N. Sakai, and Y. Nozawa. 1999. Inhibition of neutral sphingomyelinase activation and ceramide formation by glutathione in hypoxic PC12 cell death. J. Neurochem. 73:675–683. [DOI] [PubMed] [Google Scholar]
  82. Yu, S.P., Z.S. Farhangrazi, H.S. Ying, C.H. Yeh, and D.W. Choi. 1998. Enhancement of outward potassium current may participate in beta-amyloid peptide-induced cortical neuronal death. Neurobiol. Dis. 5:81–88. [DOI] [PubMed] [Google Scholar]
  83. Zhang, P., B. Liu, G.M. Jenkins, Y.A. Hannun, and L.M. Obeid. 1997. Expression of neutral sphingomyelinase identifies a distinct pool of sphingomyelin involved in apoptosis. J. Biol. Chem. 272:9609–9612. [DOI] [PubMed] [Google Scholar]
  84. Zhang, S.C., B. Ge, and I.D. Duncan. 1999. Adult brain retains the potential to generate oligodendroglial progenitors with extensive myelination capacity. Proc. Natl. Acad. Sci. USA. 96:4089–4094. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Cell Biology are provided here courtesy of The Rockefeller University Press

RESOURCES