Skip to main content
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2007 Jul 2;151(8):1262–1271. doi: 10.1038/sj.bjp.0707336

Sch35966 is a potent, selective agonist at the peripheral cannabinoid receptor (CB2) in rodents and primates

W Gonsiorek 1, C A Lunn 2, X Fan 1, G Deno 1, J Kozlowski 3, R W Hipkin 1,*
PMCID: PMC2189839  PMID: 17603556

Abstract

Background and purpose:

The peripheral cannabinoid receptor (CB2) is expressed on peripheral immune cells and is thought to have a role in the immunosuppressive effects of cannabinoids. Historically, there have been few potent, CB2-selective agonists to assess the contribution of CB2 to this phenomenon. The studies presented here describe the synthesis of 8,10-bis[(2,2-dimethyl-1-oxopropyl)oxy]-11-methyl-1234-tetrahydro-6H-benzo[β]quinolizin-6-one (Sch35966), which binds with low nanomolar potency to CB2 in both primates and rodents.

Experimental approach:

The affinity, potency and efficacy of Sch35966 and other cannabinoid ligands at CB2 was assessed using competition binding assays vs [3H]CP55,940, [35S]GTPγS exchange, cAMP accumulation and cell chemotaxis assays.

Key results:

We showed that Sch35966 has >450-fold selectivity for CB2 binding vs the central cannabinoid receptor (CB1) in primates (humans and cynomolgus monkeys) and rodents (rats and mice). Sch35966 is an agonist as it effectively inhibited forskolin-stimulated cAMP synthesis in CHO-hCB2 cells, stimulated [35S]GTPγS exchange and directed chemotaxis in cell membranes expressing CB2. In all species examined, Sch35966 was more potent, more efficacious and more selective than JWH-015 (a commonly used CB2-selective agonist).

Conclusions and implications:

Taken together, the data show that Sch35966 is a potent and efficacious CB2-selective agonist in rodents and primates.

Keywords: peripheral cannabinoid receptor, CB2-selective agonist, Sch35966

Introduction

The actions of cannabinoids such as Δ9-tetrahydrocannabinol (Δ9-THC), the endocannabinoids, anandamide and 2-arachidonyl glycerol (2-AG) and synthetic cannabinoids such as HU210 and (CP55,940) are mediated through activation of central cannabinoid receptor (CB1) and peripheral cannabinoid receptor (CB2) (Devane et al., 1992; Mechoulam et al., 1995; Sugiura et al., 1995; for review, see Howlett et al., 2002). Activation of either receptor subtype stimulates the inhibition of adenylyl cyclase (Bayewitch et al., 1995; Slipetz et al., 1995) and the activation of mitogen-activated protein kinase (Bouaboula et al., 1995, 1996). Originally cloned from rat brain (Matsuda et al., 1990; Gerard et al., 1991), CB1 is expressed primarily in the central nervous system and mediates most of the psychotropic and analgesic effects associated with cannabinoid agonists. CB2 was cloned from rat spleen and promyelocytic leukaemic HL60 cells (Munro et al., 1993) and is highly expressed in peripheral immune cells (Galiegue et al., 1995; Schatz et al., 1997). More recent work suggests that the receptor may also be expressed in neuronal cells involved in pain modulation and/or perception (Hanus et al., 1999; Malan et al., 2002; Hohmann et al., 2004; Ibrahim et al., 2005).

The recreational use of cannabinoids has been linked with diminished immune function (Kaminski, 1996, 1998; Klein et al., 1998) and there are studies suggesting that endocannabinoids may be immunomodulators (Cabral et al., 1995; Lee et al., 1995; Di Marzo et al., 1999). Owing to its expression pattern, the immunosuppressive effects of cannabinoids have been largely attributed to CB2 activation. However, Smith et al. (2001b) recently showed that intracerebroventricular administration of the non-selective cannabinoid agonists HU210 or WIN55,212 to mice before an endotoxin challenge attenuated proinflammatory cytokine production and increased the levels of the anti-inflammatory cytokine interleukin (IL)-10. Co-administration of a CB1-selective antagonist, SR141716A attenuated this reaction while the CB2-selective antagonist SR144528 was ineffective in blocking the response.

Direct measurements of CB1- and CB2-specific effects have been hindered by the shortage of isotype-selective agonists. Indeed, until the recent isolation of 2-AG ether from porcine brain, there were no CB1-selective agonists. 2-AG ether was characterized as an agonist with >140-fold selectivity for the CB1 vs CB2. Interestingly, there has been more success generating CB2-selective agonists. For example, JWH-015 and JWH-133 are aminoalkylindole congeners of Δ9-THC that are relatively selective (28 to 200-fold selectivity over CB1) and potent (Ki=13.8 and 3.4 nM, respectively) agonists (Showalter et al., 1996; Chin et al., 1999). L759633 and L759656 are aminoalkylindole congeners that have also been shown to be selective and potent CB2 agonists (Ross et al., 1999). A bicyclic compound, HU-308, was recently described as a very selective CB2 agonist (>400-fold selectivity over CB1) although it has only moderate affinity for CB2 (19–27 nM; Hanus et al., 1999). However, the CB2-selective ligands described above are not widely accessible and until recently, only JWH-015 was available commercially. Data regarding the affinity, selectivity and efficacy of JWH-015 at CB2 in human, nonhuman primates and rodents are lacking or incomplete.

In the studies described here, we assessed the utility of a benzoquinolizinone compound, 8,10-bis[(2,2-dimethyl-1-oxopropyl)oxy]-11-methyl-1234-tetrahydro-6H-benzo[β]quinolizin-6-one (Sch35966), as a CB2-selective cannabinoid agonist in both rodents and primates. Using both functional and binding assays, we demonstrated that Sch35966 is both a potent and selective CB2 agonist in rat, mouse, cynomolgus monkey and human.

Methods

Synthesis of Sch35966

Sch35966 was prepared from 3,5-bis(acetyloxy)benzoyl chloride and 2-(1,1-dimethoxyethyl)piperidine hydrochloride (Friary, 1990). The procedures described were used without further modification. The structure of Sch35966 is shown in Figure 1.

Figure 1.

Figure 1

The structure of Sch35966.

Cloning CB2 from rat, mouse and cynomolgus monkey

RNA was isolated from lymph node and spleen samples using RNA STAT-60 (Tel-Test, Friendsword, TX, USA) according to manufacturer's protocol. RNA was isolated from cynomolgus blood using the PAXgene blood RNA kit by PreAnalytiX (Hombrechtikon, CH). All samples were DNase treated using DNase 1 (Roche Diagnostics Corp., Indianapolis, IN, USA) before cDNA synthesis. cDNA was generated using SuperScript First Strand Synthesis System for reverse transcription-PCR (Invitrogen, Carlsbad, CA, USA). Both oligo-dT (Invitrogen) and random hexomers (Promega, Madison, WI, USA) were used to prime first strand synthesis. Mouse CB2 cDNA was generated by amplifying mouse spleen cDNA with the forward primer ACGGCTAGCGAGGGATGCCGGGAGACAGAAGT (Nhe1 site) and the reverse primer GACACGCGGCCGCCTAGGTGGTTTTCACATCAGCCTCTG (Not1 site). The amplified gene was cloned into pme18neoCD8-FLAG. To obtain the 5′- and 3′-prime ends of the rat CB2 gene, primers (forward primer GGCCGGAGCTGACTTTCCTGGCCAGCGTGATCTTT and reverse primer GCCAGCCCAGTAGGTAGTCGTTGGGGATCA) were designed for the rapid amplification of cDNA ends (RACE) based on the existing CB2 sequences. Marathon RACE amplification (Gibco-BRL; Bethesda, MD, USA) was performed on RNA purified from rat spleen RNA. The forward primer ACGGCTAGCGCGGGATGCCGGGAGCTGGAG (with an Nhe1 site) and a reverse primer GTTGGCGGCCGCTCAGCAATTGGAGCAGCCCTGGTGTCT (with a Not1 site) were designed based on the RACE sequences. Rat CB2 cDNA was then amplified by PCR of rat spleen cDNA and cloned into the pME18neoCD8FLAG vector. Cyno CB2 sequence was determined using SMART RACE cDNA amplification kit (Clontech, Mountain View, CA, USA) using the forward primer GCCTTCTGCTCCATGCTGTGCCTCGTCA and the reverse primer GCAGGCGGAGAAGAGTGCACAACACGGC on cyno lymph node RNA. After sequencing of the RACE products, PCR primers (forward primer ACGGCTAGCGAGGAATGCTGGCTGACAGAGATA and reverse primer GTTGGCGGCCGCTCATCAGCAACTGGAGTGGTCTAG) were designed based on the sequence of the 5′ and 3′ end of cyno CB2 to amplify the entire CB2 cDNA from lymph node RNA. The cyno CB2 gene was then cloned into the pME18neoCD8FLAG vector.

Cells and cell culture

The clonal Chinese hamster ovary (CHO)–hCB2 cell line was generated by transfection of CHO-K1 cells with human cannabinoid type 2 receptor cDNA modified by placement of the haemagglutinin (HA) epitope on the N-terminus as described previously (Gonsiorek et al., 2000). Monolayer cultures were grown at 37°C in a humidified atmosphere (5% CO2) in Dulbecco's modified Eagle F-12 medium containing L-glutamine and supplemented with 1% non-essential amino acids, 1% penicillin/streptomycin, 10% fetal bovine serum (FBS) (Gemini Bio-Products, Calabasas, CA, USA) and 0.2 mg ml−1 hygromycin B, pH 7.4. Ba/F3 cell lines transfected to express human CB1 (Ba/F3-hCB1) or CB2 (Ba/F3-hCB2) were generated as described previously (Lunn et al., 2006). Ba/F3 cell lines transfected to express rat, mouse or cyno CB2 were generated and maintained similarly. Experimental cultures were used 1–2 days after seeding. Cell culture medium (RPMI-1640) was purchased from Gibco-BRL (Grand Island, NY, USA).

Membrane preparation

Cell membranes from brains of mice, rats and cynomolgus monkeys or transfected cell lines were prepared as described previously (Hipkin et al., 1997). Briefly, brains were minced on ice using a razor blade, rinsed with ice-cold phosphate-buffered saline (Invitrogen Corp., Carlsbad, CA, USA) to remove excess blood and kept on ice. CHO–hCB2 cells were harvested using cell dissociation buffer according to the manufacturer's instructions (Invitrogen Corp.), collected by centrifugation and used immediately or stored at −80°C. Transfected Ba/F3 cells were pelleted by centrifugation and used immediately or stored at −80°C. Cell pellets were resuspended and incubated on ice for 30 min in cell homogenization buffer (10 mM Tris-HCl, 5 mM ethylenediaminetetraacetic acid (EDTA), 3 mM ethylene glycol bis(β-aminoethylether)-N,N,N',N',-tetraacetic acid (EGTA), pH 7.6). Brain tissue was incubated with tissue homogenization buffer (10 mM Tris-HCl, 5 mM EDTA, 3 mM EGTA, 250 mM sucrose, pH 7.6). Both cell and tissue homogenization buffer were supplemented with 1 mM phenylmethylsulphonyl fluoride. Cells and brain tissue were then homogenized with 15–20 strokes at 900 r.p.m. with a Dounce homogenizer using stirrer type RZR1 polytron homogenizer (Caframo, Wiarton, Ontario, Canada). Intact cells and nuclei were removed by low-speed centrifugation (500 g for 5 min at 4°C). Membranes in the supernatant were pelleted by centrifugation at 100 000 g for 30 min at 4°C and then resuspended in gly–gly buffer (20 mM glycylglycine, 1 mM MgCl2, 250 mM sucrose, pH 7.2) and stored at −80°C. Protein determinations were performed using the Bradford method (Bradford, 1976).

[35S]GTPγS and [3H]CP55,940 membrane binding

Binding reactions were carried out in 96-well microplates in a final volume of 100 μl. Cell membranes (1–25 μg, in triplicate) were incubated in the presence or absence of various compounds for 60 min at room temperature in binding buffer (50 mM Tris, 100 mM NaCl, 5 mM MgCl2, and 0.1% (1 mg l−1) bovine serum albumin (BSA; factor V, lipid free), pH 7.4) containing 1–2 nM [3H]CP55,940 (SA=180 Ci mmol−1). In some experiments, [3H]CP55,940 binding was done in GTPγS-binding buffer (20 mM 4-(2-hydroxyethyl)-1-piperazineethanesulphonic acid (HEPES), 100 mM NaCl, 5 mM MgCl2, and 0.2% (2 mg l−1) BSA, pH 7.4), supplemented with the indicated concentrations of GDP and 0.1 nM nonisotopic GTPγS. [3H]CP55,940 binding was terminated by rapid filtration of the membranes through the microfiltration plates coated with 0.5% polyethylenimine (UniFilter GF/C filter plate; Packard, Meriden, CT, USA), using a Tomtek 96-well cell harvester (Hamden, CT, USA). The membranes were washed 10 times with ice-cold buffer (50 mM Tris, 3 mM MgCl2, 1 mM EDTA, 0.1% BSA, pH 7.4). Membrane-bound radioligand was measured by liquid scintillation using a TopCount NXT Microplate Scintillation and Luminescence Counter (Packard, Meriden, CT, USA).

For [35S]GTPγS-binding experiments, membranes in GTPγS-binding buffer were incubated in the presence or absence of cannabinoids, 0.3 nM [35S]GTPγS (SA=1250 Ci mmol−1 (NEN Boston, MA, USA) and the indicated concentrations of GDP. Membrane-bound [35S]GTPγS was measured using WGA-SPA beads (300 μg) at 60 min by use of a 1450 Microbeta Trilux counter (Wallac, Gaithersburg, MD, USA) as described previously (Chou et al., 2002).

Cyclic AMP accumulation assay

Assays were performed as described previously (Gonsiorek et al., 2000). Briefly, cells, seeded in 96-well plates, were chilled on ice and washed two times with cold F-12 nutrient mixture (HAM) medium, containing 10 mM HEPES and 0.2% BSA, pH 7.4. Cells were then incubated for 15 min at 37°C in the above medium supplemented with 200 μM isobutylmethylxanthine (cAMP assay media), 5 μM forskolin and the indicated concentrations of cannabinoids. The media was removed and the cells lysed with 0.1 N HCl and rapid freezing. Intracellular cAMP in thawed lysates was measured by cAMP Enzyme Immunoassay (Biomol Research Laboratories, Plymouth Meeting, PA, USA) according to manufacturer's instructions. The results are expressed as a fraction of forskolin-stimulated cAMP accumulation measured in the absence of cannabinoids.

Cell chemotaxis assays

Cellular migration was measured as described previously (Lunn et al., 2006). Briefly, cannabinoids diluted in assay buffer (phenol red free-RPMI supplemented with 10% FBS) were dispensed (30 μl) into the bottom wells of disposable microchemotaxis plates (ChemoTx 101-5 sp; Neuroprobe Inc., Gaithersburg, MD, USA). Cell aliquots (25 μl; 50 000 Ba/F3-hCB2 cells) in assay buffer were then applied to filters (5 μm pore size) in the top plate. After incubation for 90 min at 37°C, migrated cells were collected in the bottom well by centrifugation and transferred to wells of a flat-bottom Microlite (1+) luminometer plate (Thermo Electron Corporation, Waltham, MA, USA). Eighty microlitres of assay buffer and 100 μl of CellTiter Glo Reagent (Promega) were added per well, incubated for 10 min and the luminescence intensity was measured using a luminometer (Thermo Electron Corporation) at an excitation time of 100 ms. We found that a linear relationship exists between luminescence intensity and cell number (data not shown). Relative migration is expressed as a percentage of total input cell number. Data are presented as the mean of triplicate determinations.

Data analysis

Data are presented as mean values±s.e.m. of at least three independent experiments, each of which was performed in triplicate. Nonlinear regression analysis of saturation data and of concentration–response data was performed using Prism 2.0c software (GraphPad Software, San Diego, CA, USA) to calculate KD, Bmax, IC50 and EC50 values. IC50 values were converted to apparent Ki values by the method of Cheng and Prusoff (1973) using the KD values for [3H]CP55,940 determined from saturation experiments.

Materials

Sf9 membranes exogenously expressing Gαi3, β1γ2 and hCB2 (7–14 pmol mg−1) or hCB1 (0.7 pmol mg−1) were purchased from NEN Life Sciences. HU210 ((6aR)-trans-3-(1,1-dimethylheptyl)-6a,7,10,10a-tetrahydro-1-hydroxy-6,6-dimethyl-6H-dibenzo[b,d]pyran-9-methanol) was purchased from BIOMOL Research Laboratories. AM-630 (6-iodopravadoline) and JWH-015 (2-methyl-1-propyl-1H-indol-3-yl-1-naphthalenylmethanone) was purchased from Tocris Bioscience (Ellisville, Missouri, USA). CP55,940 ((1R,3R,4R)-3-[2-hydroxy-4-(1,1-dimethylheptyl)phenyl]-4-(3-hydroxypropyl)cyclohexan-1-ol) was purchased from NEN. WIN55,212-2 ((R)-(+)-2,3-dihydro-5-methyl-3-(4-morpholinylmethyl)pyrrolo-[1,2,3-de]-1,4-benzoxazin-6-yl]-1-naphthaleneylmethanone mesylate) and SR144528 (N-[(1S)-endo-1,3,3-trimethyl bicycle[2,2,1] heptane-2-yl]-5-(4-chloro-3-methylphenyl)-1-(4-methylbenzyl)-pyrazole-3carboxamide) were synthesized in our Department of Chemistry at SPRI. All other reagents were of the best grade available and purchased from common suppliers.

Results

Functional characterization of Sch35966

To assess if Sch35966 is an agonist, inverse agonist or neutral antagonist, we tested the effect of known cannabinoid agonists (HU210, WIN55,212-2), Sch35966 and an inverse agonist (SR144528) on forskolin-stimulated cAMP accumulation in CHO–hCB2 cells, (Figure 2) which we had previously used to characterize endocannabinoid pharmacology (Gonsiorek et al., 2000). As shown in Figure 2a, Sch35966 inhibited forskolin-stimulated cAMP accumulation with an efficacy similar to HU210 and WIN55,212-2, although the latter ligands were more potent. It is difficult to conclude if Sch35966 is a full or partial agonist due to the high constitutive activity of CB2, which suppressed the endogenous adenylyl cyclase activity in these cells. The constitutive activity of CB2 was apparent upon co-incubation of these cells with SR144528 which relieved this tonic suppression as witnessed by a dramatic increase in forskolin-stimulated cAMP levels. In parallel, we assessed the effect of these ligands on forskolin-stimulated cAMP accumulation in CHO–hCB2 cells preincubated with pertussis toxin (PTX) to inactivate the Gi transducers (Figure 2b). Interestingly, incubation of PTX-pretreated cells with cannabinoid agonists resulted in stimulation of cAMP levels. The stimulatory effects of the inverse agonist were largely abolished. These data suggest that hCB2 expressed in our cell line interacts with both inhibitory (Gi) and stimulatory G proteins (Gs). A similar observation was made for CB1 in the brain (Glass and Felder, 1997).

Figure 2.

Figure 2

The effect of cannabinoids on cAMP accumulation in CHO–hCB2 cells. Cells in 96-well plates were pretreated in the absence (left) or presence (right) of 100 ng ml−1 PTX for 24 h (as described in the Methods section). Cells were washed and incubated for 15 min at 37°C in cAMP assay buffer containing 5 μM forskolin and the indicated concentrations of HU210, Sch35966, WIN 55,212-2 or SR144528. Following incubation, intracellular cAMP was measured by enzyme immunoassay. Data represent the mean fraction of forskolin-stimulated cAMP (pmol/well)±range of triplicate determinations from a representative experiment.

Lastly, we tested the chemotactic response of Ba/F3-hCB2 in response to Sch35966 and HU210 as cannabinoids have been shown to stimulate cell chemotaxis via CB2 (Sacerdote et al., 2000; Kishimoto et al., 2003; Lunn et al., 2006). Both Sch35966 and HU210 stimulated Ba/F3-hCB2 cell chemotaxis with the classic bell-shaped concentration–response curve (data not shown).

We next assessed the pharmacology of Sch35966 using [35S]GTPγS-exchange assays (as described in the Methods section). Breivogel et al. (1998) previously established that relative to full agonists, the efficacy of partial agonists at the cannabinoid CB1 to stimulate [35S]GTPγS exchange was more susceptible to inhibition with elevated GDP concentrations. Therefore, we assessed the effect of increasing concentrations of GDP on the [35S]GTPγS exchange in CHO–hCB2 membranes in response to 100 nM HU210, CP55,940, WIN55,212-2, SR144528, AM-630, Sch35966 or 1 μM JWH-015 (Figure 3a) and expressed the effect of the ligands relative to basal binding (Figure 3b). CP55,940 was the most efficacious ligand tested in stimulating GTPγS exchange. While HU210 appeared to be (at least) as effective as CP55,940 with ⩽1 μM GDP, its relative efficacy declined in the face of higher GDP levels. Sch35966, WIN55,212-2 and JWH-015 were less efficacious. As would be expected, the inverse agonists SR144528 and AM-630 decreased constitutive GTPγS exchange. From these experiments, we selected 5 μM GDP and 0.3 nM GTPγS for the more extensive assessment of the potency, efficacy and affinity of HU210, CP55,940, Sch35966 and JWH-015 at hCB2. Representative data are shown in Figure 4. Consistent with the data from the GDP titration experiments (Figure 3), CP55,940 was a slightly more efficacious agonist than HU210 and Sch35966 although the latter compound was less potent. In this particular set of data, Sch35966 stimulated GTPγS exchange to levels which are equivalent to that seen with HU210, although taken together the results from our experiments suggest that HU210 is slightly more efficacious than Sch35966 (Figure 3b; data not shown). HU210, CP55,940 and Sch35966 were all more potent than JWH-015 in stimulating GTPγS exchange. The binding affinities in buffer containing 5 μM GDP and 0.3 nM nonisotopic GTPγS were in general agreement with the functional potencies.

Figure 3.

Figure 3

The effect of GDP concentration on [35S]GTPγS exchange in response to cannabinoids in CHO–hCB2 membranes. Membranes expressing hCB2 (4 μg) prebound to WGA-SPA beads were incubated in GTPγS binding buffer (as described in the Methods section) containing 0.1 nM [35S]GTPγS and the indicated concentration of GDP in the absence or presence of cannabinoids at either 100 nM (HU210, CP55,940, WIN 55,212, SR144528) or 1 μM (Sch35966, JWH-015) for 60 min at room temperature. The mean binding±range of triplicate determinations from a representative experiment is shown on the left panel. The same data are presented in the right panel expressed as total/basal binding at each GDP concentration (B/B0). Membrane-associated radioactivity was measured by WGA-SPA scintillation.

Figure 4.

Figure 4

The effect of cannabinoids on [35S]GTPγS exchange and [3H]CP55,940 binding in CHO–hCB2 membranes. Membranes (4 μg) were incubated at 30°C for 60 min in binding buffer containing 5 μM GDP, the indicated concentrations of HU210, CP55,940, WIN 55,212 or Sch35966. In GTPγS exchange assays, the incubation contained 0.1 nM [35S]GTPγS (open symbols, solid lines). In competition binding assays, the incubation contained 0.1 nM nonisotopic GTPγS and 1–2 nM [3H]CP55,940 (closed symbols, broken lines), Following filtration, the membrane-associated radioactivity was measured by liquid scintillation. Data (expressed as B/B0) represent the mean specific binding±range of triplicate determinations from a representative experiment (n=2–4).

The effect of Sch35966 on [3H]CP55,940 binding and [35S]GTPγS exchange in membranes expressing primate or rodent CB2

We measured the binding affinities and intrinsic efficacies of Sch35966, HU210, JWH-015 using membranes from a cell line transfected to express CB2 from human (Ba/F3-hCB2), cynomolgus monkey (Ba/F3-cynoCB2), rat (Ba/F3-rCB2) or mouse (Ba/F3-mCB2). Saturation analysis (Figure 5) showed that [3H]CP55,940 bound with high affinity to CB2 from mouse (mCB2 KD=0.5 nM), rat (rCB2 KD=0.6 nM) and cynomolgus monkey (cynoCB2 KD=0.7 nM). In GTPγS exchange assays (Figure 6, Table 1), Sch35966 was less potent than HU210 and demonstrably more potent than JWH-015. In competition binding assays (Figure 7 and Table 2), HU210 bound with highest affinity in all species (0.40–0.60 nM) followed by Sch35966 (2–7 nM). JWH-015 bound CB2 with considerably lower affinity (∼30–400 nM).

Figure 5.

Figure 5

Saturation binding isotherms for mouse, rat and monkey CB2. Membranes from Ba/F3 cells transfected to express CB2 from the mouse (mCB2), rat (rCB2) or monkey (cynoCB2) were incubated for 30 min at 30°C in binding buffer (as described in the Methods section) with the indicated concentrations of [3H]CP55,940 in the presence or absence of excess unlabelled ligand. Following filtration, the membrane-associated radioactivity was measured by liquid scintillation. Data represent the mean total binding±range of triplicate determinations from two independent experiments.

Figure 6.

Figure 6

The effect of cannabinoids on [35S]GTPγS exchange in membranes-expressing rodent or monkey CB2. Membranes from Ba/F3 cells transfected to express CB2 from the mouse (mCB2), rat (rCB2) or monkey (cynoCB2) were incubated at 30°C for 60 min in binding buffer containing 5 μM GDP and the indicated concentrations of HU210, Sch35966 or JWH-015. The incubation contained 0.1 nM [35S]GTPγS. Following filtration, the membrane-associated radioactivity was measured by liquid scintillation. Data represent the mean specific binding±range of triplicate determinations from a representative experiment (n=2–4).

Table 1.

Comparison of functional potencies (EC50) of cannabinoid ligands in stimulating [35S]GTPγS exchange in membranes expressing monkey, rat or mouse CB2

Ligand Monkey Rat Mouse
HU-210 0.32±0.17 0.28±0.22 0.24±0.09
Sch35966 1.5±0.98 6203±7597 2.4±1.4
JWH-015 106±41 4407±3090 537±253

Abbreviation: CB2, peripheral cannabinoid receptor.

Potency data (nM) are presented as mean±s.e./(range) values from two or three independent experiments performed in triplicate.

Figure 7.

Figure 7

The effect of cannabinoids on [3H]CP55,940 binding to human, rat and monkey CB1 and CB2. Membranes from Ba/F3 cells transfected to express rCB2, mCB2, cynoCB2 or hCB1 or from rat or monkey brain were incubated at 30°C for 60 min in binding buffer containing 2 nM [3H]CP55,940 and the indicated concentrations of HU210, Sch35966 or JWH-015. Following filtration, the membrane-associated radioactivity was measured by liquid scintillation. Data represent the mean specific binding±range of triplicate determinations from a representative experiment (n=2–4).

Table 2.

Comparison of binding affinities (Ki) of cannabinoid ligands to CB2 in human, monkey, rat and mouse

Ligand Human Monkey Rat Mouse
HU-210 0.45±0.01 0.53±0.1 0.41±0.12 0.50±0.09
Sch35966 6.8±2.3 5.4±0.4 2.4±0.5 4.8±1.6
JWH-015 180±70 34±6 340±111 373±176

Abbreviation: CB2, peripheral cannabinoid receptor.

Binding constants (nM) are presented as mean±s.d. values from at least three independent experiments performed in triplicate.

To assess CB2 selectivity, we measured the binding affinity of these compounds to hCB1 (Ba/F3-hCB1 membranes), rCB1 (rat brain membranes) and cynoCB1 (cynomolgus monkey brain membranes) by competition with [3H]CP55,940 (Figure 7). Again, HU210 bound with high affinity in all of the membrane preparations (0.7–1.1 nM; Table 3). Both Sch35966 and JWH-015 displaced [3H]CP55,940 from CB1 with low affinity. On the basis of its higher affinity for CB2, Sch35966 is more CB2 selective than is JWH-015 in all species tested.

Table 3.

Comparison of binding affinities (Ki) of cannabinoid ligands to human, monkey and rat CB1

Ligand Human Monkey Rat
HU-210 0.7±0.11 0.94±0.03 1.00±0.18
Sch35966 2633±829 5100±718 3000±982
JWH-015 2300±442 4400±1227 1257±400

Binding constants (nM) are presented as mean±s.e. values from at least three independent experiments performed in triplicate.

Discussion

The studies presented here describe the characterization of a novel benzoquinolizinone, Sch35966, which binds with low nM potency to CB2 in both primates (human and cynomolgus monkey) and rodents (rat and mouse). Further, we demonstrated that Sch35966 has >450-fold selectivity for CB2 binding vs the CB1. Sch35966 is an agonist as it effectively inhibited forskolin-stimulated cAMP synthesis in CHO–hCB2 cells and stimulated [35S]GTPγS exchange in cell membranes expressing human, monkey, rat and mouse CB2. In all species examined, Sch35966 was more potent and selective than JWH-015 (a commonly used CB2-selective agonist).

Benzoquinolizinones have been used to treat a number of medical conditions. The compounds were identified early on as novel partial agonists for the benzodiazepine receptors (Jenck et al., 1992) and developed for the treatment of anxiety disorders. More recent examples of this class of compound can be seen in the development of a class of non-steroidal inhibitors of human steroid 5α-reductases 1 and 2 (Ferrali et al., 2005), progressed for the treatment of prostatic hyperplasia, acne and alopecia. We identified the benzoquinolizinone Sch35966 by screening a group of compounds using a recombinant CB2 membrane preparation in a ligand-binding assay, while seeking to identify a novel class of cannabinoid CB2 ligands. The interest in developing cannabinoid CB2-specific agonists was based on the hypothesis that the relatively high expression of the receptor mRNA in immune cells vs its expression in the CNS could allow the generation of an immunomodulatory cannabinoid compound that lacked the psychoactive effects mediated by the central CB1. Data supporting this approach continue to be demonstrated – in a recent publication, Correa et al. (2005) showed that a cannabinoid CB2-specific agonist inhibited lipopolysaccharide/interferon-γ (IFN-γ) induced IL-12p40 and enhanced IL-10 release.

In spite of the extensive in vitro data supporting an immunomodulatory role for cannabinoid agonists, in recent clinical trials no immunological deficits were observed following short-term dosing with plant cannabinoid agonists. Abrams et al. (2003) showed that Δ9-THC had no significant effect on the number of peripheral CD4+ and CD8+ cells, and no effect on viral load in patients using cannabis to control AIDS-related wasting syndrome. Likewise, Katona et al. (2005) found no effect on serum IFN-γ, IL-10, IL-12 or C-reactive protein in patients participating in CAMS, the multicentre randomized placebo-controlled trial on the effect of Δ9-THC on the symptoms of multiple sclerosis. In addition, trials for the only cannabinoid compounds approved for clinical use, marinol and sativex, have reported no drug-related immunological deficits in an immunocompromised patient population (Guy and Stout, 2005). It is important to note that the lack of profound immunological effects upon administration of Δ9-THC may well reflect its lack of activity as an agonist at hCB2 (Bayewitch et al., 1995, 1996; Govaerts et al., 2004; for review, see Howlett et al., 2002). Interestingly, Smith et al. (2000, 2001a) demonstrated that in vivo cytokine regulation in mice challenged with endotoxin involved the central CB1. Studies in models of thioglycolate-induced or staphylococcus enterotoxin A-induced peritoneal inflammation demonstrated roles for both CB1 and CB2 ligands in mediating inflammation (Smith et al., 2001b). Our experiments have also suggested that cannabinoid CB2 inverse agonists may mediate immune cell motility following an immune insult (Lavey et al., 2005; Lunn et al., 2006), supporting the idea that CB2 agonists may not be the only productive strategy for cannabinoid-based immunoregulation.

In recent years, another CB2-mediated physiological effect has been identified, further intensifying the search for novel CB2-specific agonists. CB2 agonists have been found to be effective in a number of animal models of pain, including formalin-induced and capsaicin-induced pain (Hanus et al., 1999; Hohmann et al., 2004), inflammatory pain (Clayton et al., 2002; Quartilho et al., 2003), neuropathic pain (Malan et al., 2002; Ibrahim et al., 2005) and a hindpaw incision model of postoperative pain (Labuda et al., 2005). The mechanism by which CB2 mediates pain probably varies between the different classes of pain and remains an active area of investigation. Because of the highly selective expression of CB2 in peripheral immune cells, most models target these cells. Malan et al. (2003) suggested that the CB2 agonists could act on immune cells proximal to the site of insult, blocking mediator release. Ibrahim et al. (2005) showed that the pain response was blocked by μ-receptor antagonists or anti-β-endorphin, suggesting the modulation of β-endorphin production by neighbouring tissue was involved. With increasing evidence for CB2 expression in neural tissue (Van Sickle et al., 2005), other non-peripheral models for the role of CB2 in pain have been proposed. Beltramo et al. (2006) showed that CB2-specific agonists reduce capsaicin-induced calcitonin gene-related peptide (CGRP) release from cultures of spinal cord microglia cells. This effect appeared to be mediated by the CB2, as SR144528 induced a rightward shift of the agonist dose–response curve. In addition, studies in CB1-depleted mice ruled out a role for the central CB1. These studies support a potential role for CB2-specific agonists as a novel new class of drug for the induction of pain relief without psychoactive effects (Malan et al., 2003).

In conclusion, the benzoquinolizinone compound Sch35966 is a novel agonist at the CB2. Sch35966 potently activates CB2 from both primates (human and cynomolgus monkey) and rodents (rat and mouse) with >450-fold selectivity vs the CB1. In all species examined, Sch35966 was more potent and selective than JWH-015 (a commonly used CB2-selective agonist).

Acknowledgments

We acknowledge the helpful discussions with Drs Dan Lundell, Lorreta Bober, Jay Fine, Massimiliano Beltramo and John Hunter during the preparation of this manuscript.

Abbreviations

2-AG

2-arachidonyl glycerol

CB1

central cannabinoid receptor

CB2

peripheral cannabinoid receptor

CHO

Chinese hamster ovary

FBS

fetal bovin serum

Δ9-THC

Δ9-tetrahydrocannabinol

Conflict of interest

The authors are or were employees of the Schering-Plough Research Institute.

References

  1. Abrams DI, Hilton JF, Leiser RJ, Shade SB, Elbeik TA, Aweeka FT, et al. Short-term effects of cannabinoids in patients with HIV-1 infection: a randomized, placebo-controlled clinical trial. Ann Intern Med. 2003;139:258–266. doi: 10.7326/0003-4819-139-4-200308190-00008. [DOI] [PubMed] [Google Scholar]
  2. Bayewitch M, Avidor-Reiss T, Levy R, Barg J, Mechoulam R, Vogel Z. The peripheral cannabinoid receptor: adenylate cyclase inhibition and G protein coupling. FEBS Lett. 1995;375:143–147. doi: 10.1016/0014-5793(95)01207-u. [DOI] [PubMed] [Google Scholar]
  3. Bayewitch M, Rhee MH, Avidor-Reiss T, Breuer A, Mechoulam R, Vogel Z. (−)-Delta9-tetrahydrocannabinol antagonizes the peripheral cannabinoid receptor-mediated inhibition of adenylyl cyclase. J Biol Chem. 1996;271:9902–9905. doi: 10.1074/jbc.271.17.9902. [DOI] [PubMed] [Google Scholar]
  4. Beltramo M, Bernardini N, Bertorelli R, Campanella M, Nicolussi E, Fredduzzi S, et al. CB2 receptor-mediated antihyperalgesia: possible direct involvement of neural mechanisms. Eur J Neurosci. 2006;23:1530–1538. doi: 10.1111/j.1460-9568.2006.04684.x. [DOI] [PubMed] [Google Scholar]
  5. Bouaboula M, Poinot-Chazel C, Bourrie B, Canat X, Calandra B, Rinaldi-Carmona M, et al. Activation of mitogen-activated protein kinases by stimulation of the central cannabinoid receptor CB1. Biochem J. 1995;312:637–641. doi: 10.1042/bj3120637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bouaboula M, Poinot-Chazel C, Marchand J, Canat X, Bourrie B, Rinaldi-Carmona M, et al. Signaling pathway associated with stimulation of CB2 peripheral cannabinoid receptor. Involvement of both mitogen-activated protein kinase and induction of Krox-24 expression. Eur J Biochem. 1996;237:704–711. doi: 10.1111/j.1432-1033.1996.0704p.x. [DOI] [PubMed] [Google Scholar]
  7. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  8. Breivogel CS, Selley DE, Childers SR. Cannabinoid receptor agonist efficacy for stimulating [35S]GTPγS binding to rat cerebellar membranes correlates with agonist-induced decreases in GDP affinity. J Biol Chem. 1998;273:16865–16873. doi: 10.1074/jbc.273.27.16865. [DOI] [PubMed] [Google Scholar]
  9. Cabral GA, Toney DM, Fischer-Stenger K, Harrison MP, Marciano-Cabral F. Anandamide inhibits macrophage-mediated killing of tumor necrosis factor-sensitive cells. Life Sci. 1995;56:2065–2072. doi: 10.1016/0024-3205(95)00190-h. [DOI] [PubMed] [Google Scholar]
  10. Cheng Y, Prusoff WH. Relationship between the inhibition constant (K1) and the concentration of inhibitor which causes 50 per cent inhibition (I50) of an enzymatic reaction. Biochem Pharmacol. 1973;22:3099–3108. doi: 10.1016/0006-2952(73)90196-2. [DOI] [PubMed] [Google Scholar]
  11. Chin C, Murphy J, Huffman J, Kendall DA. The third transmembrane helix of the cannabinoid receptor plays a role in the selectivity of aminoalkylindoles for CB2, peripheral cannabinoid receptor. J Pharmacol Exp Ther. 1999;291:837–844. [PubMed] [Google Scholar]
  12. Chou CC, Fine JS, Pugliese-Sivo C, Gonsiorek W, Davies L, Deno G, et al. Pharmacological characterization of the chemokine receptor, hCCR1 in a stable transfectant and differentiated HL-60 cells: antagonism of hCCR1 activation by MIP-1β. Br J Pharmacol. 2002;137:663–675. doi: 10.1038/sj.bjp.0704907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Clayton N, Marshall FH, Bountra C, O'Shaughnessy CT. CB1 and CB2 cannabinoid receptors are implicated in inflammatory pain. Pain. 2002;96:253–260. doi: 10.1016/S0304-3959(01)00454-7. [DOI] [PubMed] [Google Scholar]
  14. Correa F, Mestre L, Docagne F, Guaza C. Activation of cannabinoid CB2 receptor negatively regulates IL-12p40 production in murine macrophages: role of IL-10 and ERK1/2 kinase signaling. Br J Pharmacol. 2005;145:441–448. doi: 10.1038/sj.bjp.0706215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Devane WA, Hanus L, Breuer A, Pertwee RG, Stevenson LA, Griffin G, et al. Isolation and structure of a brain constituent that binds to the cannabinoid receptor. Science. 1992;258:1946–1949. doi: 10.1126/science.1470919. [DOI] [PubMed] [Google Scholar]
  16. Di Marzo V, Bisogno T, De Petrocellis L, Melck D, Orlando P, Wagner JA, et al. Biosynthesis and inactivation of the endocannabinoid 2- arachidonoylglycerol in circulating and tumoral macrophages. Eur J Biochem. 1999;264:258–267. doi: 10.1046/j.1432-1327.1999.00631.x. [DOI] [PubMed] [Google Scholar]
  17. Ferrali A, Menchi G, Occhiato EG, Danza G, Mancina R, Serio M, et al. Synthesis and activity of 8-substituted benzo[c]quinolizin-3-ones as dual inhibitors of human 5alpha-reductases 1 and 2. Bioorg Med Chem Lett. 2005;15:145–148. doi: 10.1016/j.bmcl.2004.10.017. [DOI] [PubMed] [Google Scholar]
  18. Friary RJUS.Benzoquinolizinones as antiallergic, antiinflammatory, and antihyperproliferative agents and their preparation 1990. US 4897391
  19. Galiegue S, Mary S, Marchand J, Dussossoy D, Carriere D, Carayon P, et al. Expression of central and peripheral cannabinoid receptors in human immune tissues and leukocyte subpopulations. Eur J Biochem. 1995;232:54–61. doi: 10.1111/j.1432-1033.1995.tb20780.x. [DOI] [PubMed] [Google Scholar]
  20. Gerard CM, Mollereau C, Vassart G, Parmentier M. Molecular cloning of a human cannabinoid receptor which is also expressed in testis. Biochem J. 1991;279:129–134. doi: 10.1042/bj2790129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Glass M, Felder CC. Concurrent stimulation of cannabinoid CB1 and dopamine D2 receptors augments cAMP accumulation in striatal neurons: evidence for a Gs linkage to the CB1 receptor. J Neurosci. 1997;17:5327–5333. doi: 10.1523/JNEUROSCI.17-14-05327.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Gonsiorek W, Lunn C, Fan X, Narula S, Lundell D, Hipkin RW. Endocannabinoid 2-arachidonyl glycerol is a full agonist through human type 2 cannabinoid receptor: antagonism by anandamide. Mol Pharmacol. 2000;57:1045–1050. [PubMed] [Google Scholar]
  23. Govaerts SJ, Hermans E, Lambert DM. Comparison of cannabinoid ligands affinities and efficacies in murine tissues and in transfected cells expressing human recombinant cannabinoid receptors. Eur J Pharm Sci. 2004;23:233–243. doi: 10.1016/j.ejps.2004.07.013. [DOI] [PubMed] [Google Scholar]
  24. Hanus L, Breuer A, Tchilibon S, Shiloah S, Goldenberg D, Horowitz M, et al. HU-308: a specific agonist for CB2, a peripheral cannabinoid receptor. Proc Natl Acad Sci USA. 1999;96:14228–14233. doi: 10.1073/pnas.96.25.14228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hipkin RW, Friedman J, Clark RB, Eppler CM, Schonbrunn A. Agonist-induced desensitization, internalization, and phosphorylation of the sst2A somatostatin receptor. J Biol Chem. 1997;272:13869–13876. doi: 10.1074/jbc.272.21.13869. [DOI] [PubMed] [Google Scholar]
  26. Hohmann AG, Farthing JN, Zvonok AM, Makriyannis A. Selective activation of cannabinoid CB2 receptors suppresses hyperalgesia evoked by intradermal capsaicin. J Pharmacol Exp Ther. 2004;308:446–453. doi: 10.1124/jpet.103.060079. [DOI] [PubMed] [Google Scholar]
  27. Howlett AC, Barth F, Bonner TI, Cabral G, Casellas P, Devane WA, et al. International Union of Pharmacology. XXVII. Classification of cannabinoid receptors. Pharmacol Rev. 2002;54:161–202. doi: 10.1124/pr.54.2.161. [DOI] [PubMed] [Google Scholar]
  28. Ibrahim MM, Porreca F, Lai J, Albrecht PJ, Rice FL, Khodorova A, et al. CB2 cannabinoid receptor activation produces antinociception by stimulating peripheral release of endogenous opioids. Proc Natl Acad Sci USA. 2005;102:3093–3098. doi: 10.1073/pnas.0409888102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Jenck F, Moreau JL, Bonetti EP, Martin JR, Haefely WE. Ro 19-8022, a nonbenzodiazepine partial agonist at benzodiazepine receptors: neuropharmacological profile of a potential anxiolytic. J Pharmacol Exp Ther. 1992;262:1121–1127. [PubMed] [Google Scholar]
  30. Kaminski NE. Immune regulation by cannabinoid compounds through the inhibition of the cyclic AMP signaling cascade and altered gene expression. Biochem Pharmacol. 1996;52:1133–1140. doi: 10.1016/0006-2952(96)00480-7. [DOI] [PubMed] [Google Scholar]
  31. Kaminski NE. Regulation of the cAMP cascade, gene expression and immune function by cannabinoid receptors. J Neuroimmunol. 1998;83:124–132. doi: 10.1016/s0165-5728(97)00228-2. [DOI] [PubMed] [Google Scholar]
  32. Katona S, Kaminski E, Sanders H, Zajicek J. Cannabinoid influence on cytokine profile in multiple sclerosis. Clin Exp Immunol. 2005;140:580–585. doi: 10.1111/j.1365-2249.2005.02803.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kishimoto S, Gokoh M, Oka S, Muramatsu M, Kajiwara T, Waku K, et al. 2-Arachidonoylglycerol induces the migration of HL-60 cells differentiated into macrophage-like cells and human peripheral blood monocytes through the cannabinoid CB2 receptor-dependent mechanism. J Biol Chem. 2003;278:24469–24475. doi: 10.1074/jbc.M301359200. [DOI] [PubMed] [Google Scholar]
  34. Klein TW, Newton C, Friedman H. Cannabinoid receptors and the cytokine network. Adv Exp Med Biol. 1998;437:215–222. doi: 10.1007/978-1-4615-5347-2_24. [DOI] [PubMed] [Google Scholar]
  35. LaBuda CJ, Koblish M, Little PJ. Cannabinoid CB2 receptor agonist activity in the hindpaw incision model of postoperative pain. Eur J Pharmacol. 2005;527:172–174. doi: 10.1016/j.ejphar.2005.10.020. [DOI] [PubMed] [Google Scholar]
  36. Lavey BJ, Kozlowski JA, Hipkin RW, Gonsiorek W, Lundell DJ, Piwinski JJ, et al. Triaryl bis-sulfones as a new class of cannabinoid CB2 receptor inhibitors: identification of a lead and initial SAR studies. Bioorg Med Chem Lett. 2005;15:783–786. doi: 10.1016/j.bmcl.2004.11.007. [DOI] [PubMed] [Google Scholar]
  37. Lee M, Yang KH, Kaminski NE. Effects of putative cannabinoid receptor ligands, anandamide and 2-arachidonyl-glycerol, on immune function in B6C3F1 mouse splenocytes. J Pharmacol Exp Ther. 1995;275:529–536. [PubMed] [Google Scholar]
  38. Lunn CA, Fine JS, Rojas-Triana A, Jackson JV, Fan X, Kung TT, et al. J Pharmacol Exp Ther. 2006. pp. 780–788. [DOI] [PubMed]
  39. Malan TP, Jr, Ibrahim MM, Vanderah TW, Makriyannis A, Porreca F. Inhibition of pain responses by activation of CB(2) cannabinoid receptors. Chem Phys Lipids. 2002;121:191–200. doi: 10.1016/s0009-3084(02)00155-x. [DOI] [PubMed] [Google Scholar]
  40. Malan TP, Jr, Ibrahim MM, Lai J, Vanderah TW, Makriyannis A, Porreca F. CB2 cannabinoid receptor agonists: pain relief without psychoactive effects. Curr Opin Pharmacol. 2003;3:62–67. doi: 10.1016/s1471-4892(02)00004-8. [DOI] [PubMed] [Google Scholar]
  41. Matsuda LA, Lolait SJ, Brownstein MJ, Young AC, Bonner TI. Structure of a cannabinoid receptor and functional expression of the cloned cDNA. Nature. 1990;346:561–564. doi: 10.1038/346561a0. [DOI] [PubMed] [Google Scholar]
  42. Mechoulam R, Ben-Shabat S, Hanus L, Ligumsky M, Kaminski NE, Schatz AR, et al. Identification of an endogenous 2-monoglyceride, present in canine gut, that binds to cannabinoid receptors. Biochem Pharmacol. 1995;50:83–90. doi: 10.1016/0006-2952(95)00109-d. [DOI] [PubMed] [Google Scholar]
  43. Munro S, Thomas KL, Abu-Shaar M. Molecular characterization of a peripheral receptor for cannabinoids. Nature. 1993;365:61–65. doi: 10.1038/365061a0. [DOI] [PubMed] [Google Scholar]
  44. Quartilho A, Mata HP, Ibrahim MM, Vanderah TW, Porreca F, Makriyannis A, et al. Inhibition of inflammatory hyperalgesia by activation of peripheral CB2 cannabinoid receptors. Anesthesiology. 2003;99:955–960. doi: 10.1097/00000542-200310000-00031. [DOI] [PubMed] [Google Scholar]
  45. Ross RA, Brockie HC, Stevenson LA, Murphy VL, Templeton F, Makriyannis A, et al. Agonist-inverse agonist characterization at CB1 and CB2 cannabinoid receptors of L759633, L759656 and AM630. Br J Pharmacol. 1999;126:665–672. doi: 10.1038/sj.bjp.0702351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Sacerdote P, Massi P, Panerai AE, Parolaro D. In vivo and in vitro treatment with the synthetic cannabinoid CP55, 940 decreases the in vitro migration of macrophages in the rat: involvement of both CB1 and CB2 receptors. J Neuroimmunol. 2000;109:155–163. doi: 10.1016/s0165-5728(00)00307-6. [DOI] [PubMed] [Google Scholar]
  47. Schatz AR, Lee M, Condie RB, Pulaski JT, Kaminski NE. Cannabinoid receptors CB1 and CB2: a characterization of expression and adenylate cyclase modulation within the immune system. Toxicol Appl Pharmacol. 1997;142:278–287. doi: 10.1006/taap.1996.8034. [DOI] [PubMed] [Google Scholar]
  48. Showalter VM, Compton DR, Martin BR, Abood ME. Evaluation of binding in a transfected cell line expressing a peripheral cannabinoid receptor (CB2): identification of cannabinoid receptor subtype selective ligands. J P. 1996;278:989–999. [PubMed] [Google Scholar]
  49. Slipetz DM, O'Neill GP, Favreau L, Dufresne C, Gallant M, Gareau Y, et al. Activation of the human peripheral cannabinoid receptor results in inhibition of adenylyl cyclase. Mol Pharmacol. 1995;48:352–361. [PubMed] [Google Scholar]
  50. Smith SR, Denhardt G, Terminelli C. The anti-inflammatory activities of cannabinoid receptor ligands in mouse peritonitis models. Eur J Pharmacol. 2001a;432:107–119. doi: 10.1016/s0014-2999(01)01477-7. [DOI] [PubMed] [Google Scholar]
  51. Smith SR, Terminelli C, Denhardt G. Effects of cannabinoid receptor agonist and antagonist ligands on production of inflammatory cytokines and anti-inflammatory interleukin-10 in endotoxemic mice. J Pharmacol Exp Ther. 2000;293:136–150. [PubMed] [Google Scholar]
  52. Smith SR, Terminelli C, Denhardt G. Modulation of cytokine responses in Corynebacterium parvum-primed endotoxemic mice by centrally administered cannabinoid ligands. Eur J Pharmacol. 2001b;425:73–83. doi: 10.1016/s0014-2999(01)01142-6. [DOI] [PubMed] [Google Scholar]
  53. Stout GW, Stott CG.The development of Sativex—a natural cannabis-based medicine. Cannabinoids as Therapeutics 2005Birkhauser Verlag: Basel, Boston, Berlin; In: Mechoulam R (ed).pp 231–263 [Google Scholar]
  54. Sugiura T, Kondo S, Sukagawa A, Nakane S, Shinoda A, Itoh K, et al. 2-Arachidonoylglycerol: a possible endogenous cannabinoid receptor ligand in brain. Biochem Biophys Res Commun. 1995;215:89–97. doi: 10.1006/bbrc.1995.2437. [DOI] [PubMed] [Google Scholar]
  55. Van Sickle MD, Duncan M, Kingsley PJ, Mouihate A, Urbani P, Mackie K, et al. Identification and functional characterization of brainstem cannabinoid CB2 receptors. Science. 2005;310:329–332. doi: 10.1126/science.1115740. [DOI] [PubMed] [Google Scholar]

Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES