Abstract
Experimental colitis in mice is characterized by infiltration of activated T helper (Th) cells and macrophages into the lamina propria. Particularly, these cells expressed CD44 variant exon 7 (CD44v7)-containing isoforms. Upregulation of CD44v7 isoforms was induced by CD40 ligation, an inflammation-driving interaction between activated Th cells and macrophages. To define the role of CD44v7 in colitis, mice bearing a targeted deletion for exon v7 were generated. In trinitrobenzene sulfonic acid–induced colitis, wild-type mice developed severe signs of persistent inflammation. Mice lacking CD44v7 initially showed unspecific inflammation, then recovered completely. The pathogenic origin was shown to reside in bone marrow–derived CD44v7+ cells, because adoptive transfer experiments demonstrated an absolute requirement for CD44v7 on hematopoietic cells for maintenance of colitis. Interleukin (IL)-10–deficient mice, which develop a chronic Th1-driven enterocolitis, were crossbred with CD44v6/v7 null mice. In IL-10 × CD44v6/v7 double deficient mice, intestinal inflammation developed only weakly and at an older age. Analysis of cell death in the inflamed lesions revealed that mononuclear cells in the CD44v7 null infiltrates had higher rates of apoptosis than those from wild-type mice. Thus, the region encoded by CD44v7 appears to be essential for survival of effector lymphocytes, resulting in persistence of inflammation.
Keywords: experimental colitis, CD44 knockout, IL-10 knockout, TNBS, apoptosis
Introduction
In inflammatory bowel disease (IBD), such as Crohn's disease and ulcerative colitis 1 2 3, an aberrant mucosal homeostasis is observed accompanied by an upregulation of proinflammatory cytokines 4 5. Similar findings have been described in mouse models of colitis, e.g., in a chemically induced colitis in which the contact sensitizer trinitrobenzene sulfonic acid (TNBS) is locally administered, in transgenic mice bearing targeted deletions for cytokines and receptors important in T cell development or activation and in immunodeficient mice receiving defined T cell subpopulations 6 7 8.
Pathogenic cells in inflamed lesions of autoimmune diseases have an activated phenotype and are known to express high levels of CD44 that appear to be pivotal for extravasation into inflamed tissues 9. Furthermore, the transmembrane glycoprotein CD44 has been proposed to mediate costimulatory functions 10. A large number of isoforms generated by strictly controlled alternative splicing 11 12 is found in association with activated lymphocytes, hematopoiesis, and tumor progression 13. These findings prompted us to evaluate whether blockade of defined CD44 variant (CD44v) isoforms might provide a specific and effective therapeutic strategy for inflammatory diseases. In fact, administration of an mAb specific to CD44v7 efficiently cured TNBS-induced colitis in mice 14 15. However, it was not clear from these studies whether the antibody blocked CD44 receptor functions or delivered a transmembrane stimulus. CD44v7 has recently been demonstrated to be upregulated in peripheral blood leukocytes of patients with chronic IBD 16.
We generated mice deficient for CD44 variant exons 6 and 7, known to be upregulated in leukocyte activation and hematological malignancies in humans, rats, and mice 13. Stimulation of CD40 ligation caused upregulation of CD44v7 isoforms. Deficiency for CD44v6/v7 prevented susceptible mice from developing experimental colitis. The inflammation promoting potential resided on CD44v7+ bone marrow cells. These cells appeared to sustain the inflammatory process by inhibiting apoptosis.
Materials and Methods
Vector Construction and Generation of CD44v7- and CD44v6/v7-deficient Mice.
The mouse CD44 variant region was isolated from a 129SV genomic library. (The mouse CD44 full-length cDNA sequence is available from EMBL/GenBank/DDBJ under accession no. AJ251594.) Two 34-bp loxP sites were inserted in direct repeats into a single SacI site 3′ of exon v6 and at the 5′ end of the neor cassette, which was then inserted into the single Bst1107I site 5′ of exon v6. The HSV-tk cassette was blunt ligated into the BamHI site. For electroporation, the targeting vector was linearized with PvuI and 20 μg was transfected into 107 R1 embryonic stem (ES) cells. ES cells were maintained on a feeder layer of embryonic fibroblasts in the presence of leukemia inhibitory factor. After selection with G418 (300 μg/ml) and gancyclovir (10−6 M), 415 clones were analyzed by Southern blot using a 5′ external probe (StuI–EcoRI; see probe A in Fig. 1 C). SacI digests revealed that two clones showed homologous recombination (frequency 1/200). Positive clones were injected into C57BL/6 (BL/6) blastocysts and chimeric male offspring were mated with 129SV and BL/6 females. Heterozygous 129SV mice were intercrossed to produce homozygous 129SV mice, targeted with loxP sites flanking exon v6. Heterozygous offspring of the BL/6 females was backcrossed for 10 generations onto the BL/6 background. As reverse transcription (RT)-PCR analyses revealed that homozygous v6 loxP-targeted mice do not express exon v7 (data not shown), further Southern blot analyses were performed using probes 3′ of exon v6. Probe B (EcoRI–EcoRV) indicated loss of 1.6 kb in the region of exon v7, which only occurred in one of the two positive ES clones.
To generate v6-deficient mice, loxP-positive ES clones were transiently transfected with pBS185, a plasmid expressing cre recombinase 17. Cells were grown in the absence of G418, and clones obtained were tested for the loss of G418 resistance. Southern blotting of SacI-digested genomic DNA indicated that one clone (no. 126/28) showed the correct genotype. ES cells were again injected into BL/6 blastocysts, and male chimeric offspring were mated with 129SV, BL/6, or BALB/c females. Heterozygous 129SV mice were intercrossed to produce homozygous 129SV mice, deficient for exon v6. Heterozygous offspring of the BL/6 females was backcrossed for 10 generations onto the BL/6 background. Heterozygous BALB/c females were backcrossed for six generations onto the BALB/c background. Mice were kept under specific pathogen-free conditions; 10–20-wk-old mice were used for inducing colitis with TNBS, all of them on either 129SV or BALB/c background.
IL-10−/− mice backcrossed to BL/6 for eight generations were provided by M. Kopf (Basel Institute for Immunology) with permission of W. Müller (Institute for Genetics, Cologne, Germany; 18) and cross-bred with CD44v6/v7−/− BL/6 mice. Groups of 6–8 mice at an age of 10–13 wk (a total of 94 mice) were placed into normal housing conditions and investigated weekly for overall health and weight. All mouse experiments were performed in accordance with Swiss and institutional animal care guidelines.
Generation of Antibodies Specific for Mouse CD44v.
The CD44v6/v7-deficient mice were also used to obtain mAbs with specificity for v6 (LN6.1) and v7 (LN7.1 and LN7.2). Mice (CD44v6/v7−/−) or rats were immunized with 100–200 μg of CD44v4–10/glutathione S-transferase (GST) fusion protein, three times over a period of 12 d. 2 d after the last immunization, the regional LNs were taken and cell fusion was performed using the cell line X63-Ag8. The following mAbs were obtained: anti-CD44v10 (termed LN10.1, rat IgG1), anti-CD44v7 (LN7.1, mouse IgG1; LN7.2, mouse IgG2a; and LN7.3, mouse IgM), and anti-CD44v6 (LN6.1, mouse IgG2a). The epitopes recognized by the mAbs were mapped using 16-mer peptides (overlapping by eight amino acids) covering the region v4–v10 in ELISAs coated with CD44v4–10/GST, yielded the following specificities: FQNGWQGKNPPTPSED (LN6.1), QEDVSWTDFFDPISHP (LN7.1), and FFDPISHPMGQGHQTE (LN7.2). A CD44v10-specific mAb had already been generated by immunizing rats. It recognizes the sequence PTDTTTSVEGYTFQYPDTMENGTL (LN10.1).
mAbs were purified from cell culture supernatant using protein G–Sepharose columns (Amersham Pharmacia Biotech), and isotypes of the mAbs were determined using commercially available kits (Serotec; Roche Molecular Biochemicals). The purified antibodies were dialyzed and concentrated using Centricon concentrators (Amicon) and labeled with biotin-N-hydroxy-succinimide ester (Sigma-Aldrich). Secondary antibodies with enzymatic or fluorescent labels were purchased from Southern biotechnology Associates, Inc., and titrated for use at optimal concentrations. Biotinylated isotype control mAbs (rat IgG1, mouse IgG1, mouse IgG2a) were purchased from BD PharMingen and used at identical concentrations as the respective mAbs. Data were acquired in a FACSCalibur™ (Becton Dickinson) and analyzed with the CELLQuest™ program (Becton Dickinson).
Induction of TNBS Colitis.
1 wk before induction of colitis, mice were transferred from specific pathogen-free to conventional conditions. Mice at an age of 10–16 wk were separated into groups of six to eight mice. In the colitis group, mice were given 200 μl TNBS (2.5% wt/vol; Sigma-Aldrich) in 50% ethanol. Control mice received identical injections of 50% ethanol in PBS. A 2.5 F catheter was inserted into the colon up to the appendix, the hapten was applied, and the animals were kept in a vertical position for 30 s.
Histological and Immunohistological Analysis.
Colons were macroscopically investigated, and small pieces were embedded in Tissue-Tek (Sakura), frozen on dry ice, and stored at −70°C. Cryostat sections (6 μm) were air dried and stained with hematoxylin and eosin according to standard protocols. The histological changes were graded semiquantitatively into no signs of inflammation (grade 0); low level of leukocyte infiltration (grade 1); high level of leukocyte infiltration, thickening of the colon wall (grade 2); and transmural infiltration of leukocytes with loss of goblet cells, thickening of the colon wall (grade 3).
For immunohistological evaluations, sections were fixed in chloroform/acetone for 2 min. Sections were incubated in PBS containing 0.2% FCS and 2% H2O2 to quench endogenous peroxidase activity, followed by incubation with human serum (10% in PBS) to block nonspecific binding of antibodies. Tissue was washed twice with an isotonic sodium chloride buffer and then incubated for 30 min with the biotinylated antibodies LN6.1 (anti-v6) and LN7.2 (anti-v7). Detection of immunolabeled cells was performed with streptavidin-biotinylated horseradish peroxidase (Amersham Pharmacia Biotech), and visualized by 3-amino-9-ethylcarbazol (ICN Biomedicals). Negative controls were processed identically, apart from omitting the primary antibody.
Lamina Propria Mononuclear Cell Preparation and Cultivation.
Mice were killed by CO2 at days 2, 5, and 9 after TNBS application. The colon was trimmed of fat, mesenteric tissue, and Peyer's patches. The colon was opened longitudinally and cut into 3-mm pieces. Intraepithelial lymphocytes were removed by incubation in HBSS containing 5 mM EDTA for 30 min at room temperature under vigorous agitation. After three washing steps with PBS, the tissue was incubated for 45 min at 37°C in RPMI 1640 medium, supplemented with 5% FCS and 0.2 mg/ml collagenase D (Roche Molecular Biochemicals) and 0.1 mg/ml DNAse I (Sigma-Aldrich). Cells were separated from tissue debris by filtration through a nylon gauze followed by purification through a discontinuous 40/70% Percoll gradient (Amersham Pharmacia Biotech) for 60 min at 1,500 g. This procedure yielded 0.5–1 × 106 cells/mouse.
Cell Culture.
LNs from wild-type and v6/v7−/− mice were isolated and single cell suspensions were prepared. Cells were incubated overnight in RPMI medium, and supplemented with 10% FCS and 20 U/ml IL-2. Activation was induced by 1 μg/ml PHA (Wellcome) or coculture with CD40L secreting J558 myeloma cells in transwells (Costar) overnight.
Reconstitution of Lethally Irradiated 129SV Mice with CD44v7-deleted Lymphocytes.
129SV mice were lethally irradiated with 8 Gy followed by reconstitution with 5 × 106 bone marrow cells from either CD44v7−/− (n = 10) or CD44v7+/+ (n = 5) mice (129SV or BALB/c background) intravenously. 6 wk after reconstitution, mice were treated with a single application of TNBS as described above.
Semiquantitative Analysis of CD44 Isoforms by RT-PCR.
Mononuclear cells prepared from inflamed and noninflamed colon mucosa were resuspended in guanidium isothiocyanate (GITC), and cDNA was prepared as described previously 19. For semiquantitative analysis, cDNA amounts were equilibrated by standardizing to the mouse hypoxanthine ribosyltransferase (HPRT) gene product. The HPRT primers GCCCCAAAATGGTTAAGGTTGC and GACAACGATTTACTGAAAGTGGG yield a product of 701 bp. Identical amounts of cDNAs were then used to perform CD44v-specific PCR. The primers used for CD44 amplification were CCGGAGCACCTTGGCCACC and CCTGGTTCGCACTTGAGTGTC, which are flanking the alternatively spliced variant region yielding a product of 107 bp for CD44s when no variant exons are included (see Fig. 1 B). The PCR regime was 10 s at 96°C, 15 s at 55°C (for HPRT) or 60°C (for CD44), 1 min at 72°C for 30 cycles, followed by a final 10 min at 72°C in a Hybaid OmniGene machine.
Products were separated on 1.2% agarose gels and alkaline-transferred onto Hybond N+ membranes (Amersham Pharmacia Biotech). For specific detection, PCR products from CD44v exons were prepared, gel purified, and 33P-labeled using the Megaprime DNA labeling system from Amersham Pharmacia Biotech. After stringent hybridization and washing, blots were exposed to BioMax films (Eastman Kodak Co.) for 6 h.
Results
CD44 Isoform Expression in Colitis and Generation of CD44v7- and CD44v6/v7-deficient Mice.
Activation of human and rat lymphocytes causes a preferential upregulation of CD44v6-containing isoforms 19 20. Immunohistochemical analyses revealed that CD44v7-containing isoforms were also present in the weakly inflamed infiltrates in the colonic mucosa of TNBS-treated BALB/c mice (Fig. 1 A, top left). About 50% of the cells in the infiltrates with severe colitis were positive for CD44v6 (not shown) and v7 (Fig. 1 A, bottom right). Lamina propria mononuclear cells (LPMCs) from inflamed colons were mostly CD4+ T cells (40–70%) and CD11b+ macrophages (10–30%) (data not shown).
To analyze the composition of CD44 splice variants, we performed RT-PCR analyses of LPMCs from inflamed and noninflamed mucosa (Fig. 1 B). Whereas in LPMCs from noninflamed mucosa only exons v3 and v10 were expressed (included into the standard framework either as a single exon or, for v10, combined with exons v8 and v9) and no exon v7, in LPMC inflamed mucosa, especially variant isoforms containing exon v7 were detected (Fig. 1 B). RT-PCR analysis of Th1-polarized CD4+ splenic T cells revealed a very similar pattern as LPMCs from inflamed mucosa. In contrast, the pattern of LPMCs in noninflamed mucosa resembled one of the naive T cells and Th2-polarized CD4+ splenic T cells (19; and Johansson, B., and U. Günthert, manuscript in preparation).
The v6 exon of the CD44 gene (Fig. 1 C) was targeted in murine R1 ES cells with flanking loxP sites and 5′ insertion of a neo expression cassette. Detailed Southern blot analysis indicated that a deletion occurred in the region of exon v7, most likely during homologous recombination in one of the two ES clones. Thus, v6 loxP-targeted mice were devoid of exon v7, but retained expression of the other isoforms. The loxP-targeted ES cell clones were transiently transfected with a cre recombinase–expressing plasmid, pBS165 17, and a neo-sensitive clone revealed proper excision of the loxP-targeted region, R1-126/28. Heterozygous 129SV mice were backcrossed with BL/6 mice for 10 generations and with BALB/c mice for 6 generations. Homozygous mice were born at the expected frequency on all backgrounds. Female and male mutant mice (v7−/− and v6/v7−/−) were fertile and did not show obvious abnormalities. The distribution of subpopulations of hematopoietic cells in central and peripheral lymphoid organs appeared unaltered (data not shown).
Activation of LN cells from BALB/c mice with PHA in vitro led to a 12-fold increase of CD44v6 and v10 (not shown) surface expression, but v7 expression was almost unchanged (Fig. 1 D). Cocultivation of LN cells with CD40L-secreting J558 cells 21 increased the CD44v7 expression sixfold, but did not affect v6 (Fig. 1 D). Similar upregulation of v7 was achieved by treatment of LN cells with anti-CD40 antibodies (data not shown). Neither PHA nor CD40L induced expression of v6 and v7 in CD44v6/v7−/− mice. Notably, CD44's expression was unaffected in the v6/v7−/− mice and similarly strong as in the wild-type mice (Fig. 1 D).
CD44v7-deleted Mice Do Not Develop Colitis.
A small number of either wild-type 129SV (19%, 10/52) or CD44v7−/− mice (18%, 11/61) died within 2 d after rectal administration of TNBS in ethanol (Fig. 2 A). However, all CD44v7−/− mice that survived the acute injury were protected from colitis and were clinically normal at day 9. Similar findings (survival rate 78%, 32/41) accounted for CD44v6/v7−/− mice. In contrast, only 44% of wild-type mice survived, and 92% of these developed severe colitis with wasting disease. The clinical data were consistent with the histological findings. CD44v7−/− and CD44v6/v7−/− mice responded to the vehicle (50% ethanol) injection with an acute mucosal injury, ulceration, and hemorrhagic infiltrates within the first 2 d (Fig. 2 B). They completely recovered thereafter with macroscopically and histologically normal colons on day 9, when those of wild-type mice still showed severe strictures and inflammation (Fig. 2 B). Mice heterozygous for CD44v7 (or CD44v6/v7, not shown) did not differ from normal wild-type mice (Fig. 2 B). Thus, CD44v7 is essential for exacerbation of experimental colitis.
Analysis of cytokine production of LPMCs (protein and mRNA levels) during the 9-d course of TNBS treatment revealed a downregulation of Th1-type cytokines and chemokines (IL-12, IFN-γ, and macrophage inflammatory protein 1α and 1β) and a corresponding upregulation of Th2-type cytokines (IL-4, IL-10, and TGF-β) in CD44v7−/− and CD44v6/v7−/− mice in contrast to wild-type mice (or CD44v7+/− and CD44v6/v7+/− mice) (data not shown).
Resistance to TNBS Colitis Can Be Transferred from CD44v7-deficient Mice into Lethally Irradiated Susceptible Mice.
As expression of CD44v7 and v6/v7 isoforms on both epithelial cells and leukocytes was deleted in our targeted mice, either cell type might be participating in disease progression. Therefore, lethally irradiated 129SV mice were reconstituted with bone marrow from either CD44v7−/− or CD44v7+/+ mice (129SV). All 129SV mice that received bone marrow from 129SV CD44v7−/− mice survived a single application of TNBS given 6 wk after transplantation, whereas mice given bone marrow from 129SV CD44v7+/+ mice developed colitis (42% survival; Fig. 3). Similar data were obtained by transfer of CD44v7−/− and v7+/+ (BALB/c) bone marrow into BALB/c mice (88 vs. 22% survival). Hence, development of the inflammatory reaction requires CD44v7-proficient hematopoietic cells.
Targeted Deletion of CD44v6/v7 Exons Delays Onset and Ameliorates the Intensity of Chronic Enterocolitis in IL-10−/− Mice.
The importance of IL-10 in the regulation of mucosal inflammation has been demonstrated in several animal models 22. IL-10−/− mice spontaneously develop a generalized enterocolitis under conventional housing conditions, and the inflammation can be prevented by the administration of recombinant IL-10 18. Intestinal inflammation in IL-10−/− mice appears to be due to the lack of the general suppressive effects of IL-10 on cytokine production by macrophages and Th1 cells 23. IL-10 treatment also ameliorates inflammation in TNBS-induced colitis and in a T cell subset transfer model 24 25. In addition, local administration of IL-10 has been beneficial for patients with Crohn's disease 26.
IL-10 is upregulated in TNBS-treated CD44v6/v7−/− mice and anti-v7–treated wild-type mice (14 15; data not shown). To investigate the role of CD44v6/v7 in the chronic enterocolitis that spontaneously develops in IL-10−/− mice 18, we intercrossed both strains. Groups of six mice, each with different genotypes, were kept under normal housing conditions. All IL-10−/− mice (either CD44v6/v7+/+ or CD44v6/v7+/−) developed chronic colitis with macroscopically obvious anal prolapses at 12–18 wk of age, and weight loss starting around 25 wk of age (Fig. 4 A). A substantial mucosal infiltrate of mononuclear cells was present in 12-wk-old animals, whereas at 31 wk infiltrates were detectable in both mucosa and submucosa with transmural ulcerations (Fig. 4 B). At this age, disease was observed in 100% of the IL-10−/− (CD44v6/v7+/+ or +/−) mice. Control mice (IL-10+/+ and any CD44v6/v7 genotype) did not spontaneously develop colitis and continually gained weight within the observation period (Fig. 4 A). The colons of these mice showed normal morphology (Fig. 4 B). Double deficient mice (IL-10−/− CD44v6/v7−/−) developed well until an age of 24 wk, then they slowly started to lose weight (Fig. 4 A). Histological evaluation revealed only small areas of inflammation in the mucosae (Fig. 4 B). These double deficient mice did not have the shortened life span typical of IL-10−/− CD44v6/v7+/+ mice. Analysis of mucosal leukocytes showed a strongly diminished IL-12 production in the double deficient mice in contrast to IL-10−/− CD44v6/v7+/+ mice (protein and mRNA levels; data not shown). A total of 52 double deficient mice were analyzed, and all showed strongly reduced inflammation. Thus, CD44v6/v7 is required for the initiation and maintenance of the disease that spontaneously develops in IL-10−/− mice.
Increased Apoptosis of Leukocytes in Inflamed Regions of CD44v6/v7-deficient Mice.
As described previously, interactions involving CD40 and CD40L result in an immediate and strong increase of pan-CD44 expression on Th1 cells as well as on the APCs 10. Using specific reagents, we now observed that CD40 ligation induces an upregulation of CD44v7 expression on mouse LPMCs, which may be important for the interaction between Th1 cells and macrophages to sustain the inflammatory reaction. Blocking of the CD40–CD40L interaction, which is pivotal for Th1 cell priming and induction of IL-12 secretion in monocytes/macrophages 27, prevents TNBS-induced colitis 28. Deficiency for the CD44v6/v7 isoforms could thus abrogate the Th1–macrophage interaction and prevent the development of a transmural colonic inflammation with massive accumulation of LPMCs.
A further important feature of CD40–CD40L interactions is the enhancement of clonal T cell expansion and the delay in their activation-induced cell death (AICD) 29 30 31. Furthermore, there is strong evidence that a balance between the production of autoreactive T cells and their rapid elimination by AICD is perturbed in autoimmune diseases 32. Therefore, we analyzed apoptotic activity in early inflammatory lesions of wild-type and CD44v7-deficient mice. Terminal deoxynucleotidyl transferase–mediated dUTP nick end labeling (TUNEL) assays revealed three- to fourfold higher numbers of apoptotic cells in CD44v7−/− or CD44v6/v7−/− colons compared with those from similarly TNBS-treated wild-type mice (Fig. 5 A). However, in noninflammatory untreated CD44v6/v7−/− mice, such an increase in apoptotic nuclei was not observed (Fig. 5 A). Counts of apoptotic nuclei per field were 52 (± 20) for CD44 wild-type; 23 (± 11) for CD44v6/v7−/− control; 192 (± 43) for CD44v6/v7−/−; and 183 (± 49) for CD44v7−/−. Concomitantly, LPMCs from CD44v7−/− and CD44v6/v7−/− inflamed lesions revealed more apoptotic cells compared with LPMCs from TNBS-treated wild-type mice by assaying for annexin V binding and propidium iodide uptake (Fig. 5 B).
Discussion
Targeted deletion of exons 6 and 7 of the variant region of CD44 in mice allowed us to demonstrate in hapten-induced experimental colitis, by adoptive transfer as well as by crossing the mutants with IL-10−/− mice, that expression of these CD44v regions on activated hematopoietic cells, particularly of inflamed mucosa, is essential for promoting and maintaining unbridled Th1 reactions in mouse models for IBD. The requirement for CD44v6/v7 was clearly pointed out due to the fact that the isoform-specific mutant mice were not affected in the expression of the predominant hematopoietic CD44 isoform. The region encoded by exon v7 appears pivotal in these diseases, as treatment with anti-CD44v7 antibodies led to complete re-mission in TNBS-induced colitis, in contrast to v6-specific therapy 14. Furthermore, (a) CD44v7- and CD44v6/v7-deficient mice were equally resistant to TNBS colitis; (b) CD44v7-deficient bone marrow cells were able to fully protect against TNBS colitis in adoptive transfer experiments; and (c) both CD44v7- and CD44v6/v7-deficient mice exhibited a similar degree of apoptotic cells in the early inflamed lesions.
Immunomodulatory therapies, such as treatment with anti–IL-12, anti-CD40, and recombinant IL-10, have been applied successfully in experimental colitis 6 28 33. We have observed a strong downregulation of IL-12 in CD44v7- and CD44v6/v7-deficient mice when challenged with TNBS or when cross-bred with IL-10–deficient mice. The Th1-polarizing cytokine IL-12 is known to play a major role in both TNBS-induced colitis and Crohn's disease as well as sustaining the chronic phase in IL-10–deficient mice 33 34 35 36. Administration of anti-CD40L antibodies prevents the priming of Th 1 cells due to an inhibition of IL-12 secretion 28. As shown here, CD40–CD40L ligation specifically induced CD44v7 expression on mouse LN cells. Similarly, CD44 variant isoforms were upregulated on human leukocytes upon CD40 stimulation (our unpublished data).
In this study, the strong reduction of the initial inflammatory response in the CD44v7−/− mice is correlated with increased apoptotic activity in the lesions. CD44v7, which is upregulated upon CD40 ligation, thus appears to protect activated leukocytes from AICD. There is compelling evidence that pan-CD44 promotes survival of activated lymphocytes, fibroblasts, and carcinoma cells 37 38 39 40 41. CD44 may thus have a major impact in promoting the persistence of inflammation in autoimmune diseases and possibly in preventing tumor cells from undergoing apoptosis. The increased apoptotic activity of activated leukocytes results in a rapid clearing of the inflammation by phagocytosis of the dead cells. This process may lead to systemic tolerance due to presentation of antigens from the dead cells by the phagocytosing APCs and reduction of the inflammation by production of IL-10 from the dying lymphoid cells 42.
Analyses of surface molecules from inflamed regions of patients or mice with Th1-type autoimmune disease or chronic inflammations, such as systemic lupus erythematosus, rheumatoid arthritis, experimental autoimmune encephalomyelitis, insulin-dependent diabetes mellitus, and delayed-type hypersensitivity reactions all correlate with high expression levels of CD44 43 44 45 46 47. Using CD44 reagents specific for the variant isoforms, disease scores in experimental autoimmune encephalomyelitis could be strongly reduced 48. By specifically deleting exons v6 and v7 in mice, without affecting the expression of the other exons, we could now unequivocally demonstrate that the region encoded by exon v7 rather than the standard region of CD44, whose expression is unaffected by the mutation, is causally involved in chronic bowel inflammation.
In contrast to the CD44 standard isoform, devoid of any variant regions, which is expressed ubiquitously, we now demonstrate that CD44v7 expression is restricted to lymphocytes of inflammatory lesions in Th1-polarized experimental colitis. The same finding was observed in Th1- but not Th2-polarized CD4+ splenic T cells (Johansson, B., and U. Günthert, manuscript in preparation). In addition, in an earlier study we have shown that stimulation with IFN-γ in vitro results in an upregulation of CD44 variant isoforms in human leukocytes 49. Thus, CD44v7 appears to be a new marker for Th1-polarized activated T cells.
Our ongoing research in mouse models for rheumatoid arthritis, experimental autoimmune encephalomyelitis, and delayed-type hypersensitivity reactions indicates that the CD44 variant region is also of major importance in maintenance of the inflammatory reactions in these diseases. This finding may well open a new strategy of therapeutic intervention in autoimmune diseases by interfering with CD44v7 as a potent inhibitor of apoptosis. Therapeutic intervention strategies promoting cell death by interfering with inhibitors of apoptosis have been suggested in the treatment of patients with autoimmune disease and tumors 50.
Acknowledgments
The authors are grateful for discussions and critical comments by Jan Andersson, Paul Kincade, Manfred Kopf, Alexandre Potocnik, and Raul Torres (all from the Basel Institute for Immunology), Cornelia Schroeder (Berlin), Snezhana Oliferenko (Vienna), and by Andreas Stallmach (Homburg). We appreciate the excellent technical support by Urs Müller (Transgenic Unit, Basel) and Viviane Anquez (Basel), Michaela Rauchholz and Nicole Föhr (Heidelberg), and expert photographic skills by Beatrice Pfeiffer. We thank Patricia Ruiz (Berlin) for the isolation of the genomic mouse DNA clone, and Ernst Wagner and Werner Metzger (Basel) for expert help in animal care.
B. Wittig appreciates the generous support by the Curt Engelhorn foundation. M. Zöller was supported by the Deutsche Forschungsgemeinschaft (Zo 40/5-3). The Basel Institute for Immunology was founded and is supported by Hoffmann-La Roche, Inc., Basel, Switzerland.
Footnotes
B.M. Wittig's present address is Saarland University, Second Medical Clinic, D-66421 Homburg, Germany.
C. Schwärzler's present address is Novartis Research Institute, A-1235 Vienna, Austria.
Abbreviations used in this paper: AICD, activation-induced cell death; BL/6, C57BL/6; ES, embryonic stem; HPRT, hypoxanthine ribosyltransferase; IBD, inflammatory bowel disease; LPMC, lamina propria mononuclear cell; RT, reverse transcription; TNBS, trinitrobenzene sulfonic acid; TUNEL, terminal deoxynucleotidyl transferase–mediated dUTP nick end labeling; v, variant.
References
- Elson C.O., Sartor R.B., Tennyson G.S., Riddell R.H. Experimental models of inflammatory bowel disease. Gastroenterology. 1995;109:1344–1367. doi: 10.1016/0016-5085(95)90599-5. [DOI] [PubMed] [Google Scholar]
- Fiocchi C. Inflammatory bowel diseaseetiology and pathogenesis. Gastroenterology. 1998;115:182–205. doi: 10.1016/s0016-5085(98)70381-6. [DOI] [PubMed] [Google Scholar]
- Strober W., Ehrhardt R.O. Chronic intestinal inflammationan unexpected outcome in cytokine or T cell receptor mutant mice. Cell. 1993;75:203–205. doi: 10.1016/0092-8674(93)80062-j. [DOI] [PubMed] [Google Scholar]
- MacDonald T.T. Effector and regulatory lymphoid cells and cytokines in mucosal sites. Curr. Top. Microbiol. Immunol. 1999;236:113–135. doi: 10.1007/978-3-642-59951-4_7. [DOI] [PubMed] [Google Scholar]
- Strober W., Fuss I.J., Ehrhardt R.O., Neurath M., Boirivant M., Ludviksson B.R. Mucosal immunoregulation and inflammatory bowel diseasenew insights from murine models of inflammation. Scand. J. Immunol. 1998;48:453–458. [PubMed] [Google Scholar]
- Mason D., Powrie F. Control of immune pathology by regulatory T cells. Curr. Opin. Immunol. 1998;10:649–655. doi: 10.1016/s0952-7915(98)80084-8. [DOI] [PubMed] [Google Scholar]
- Powrie F. T cells in inflammatory bowel diseaseprotective and pathogenic roles. Immunity. 1995;3:171–174. doi: 10.1016/1074-7613(95)90086-1. [DOI] [PubMed] [Google Scholar]
- Strober W., Kelsall B., Marth T., Ludviksson B., Ehrhardt R., Neurath M. Reciprocal IFN-γ and TGF-β responses regulate the occurrence of mucosa inflammation. Immunol. Today. 1997;18:61–64. doi: 10.1016/s0167-5699(97)01000-1. [DOI] [PubMed] [Google Scholar]
- DeGrendele H.C., Estess P., Siegelman M.H. Requirement for CD44 in activated T-cell extravasation into an inflammatory site. Science. 1997;278:672–675. doi: 10.1126/science.278.5338.672. [DOI] [PubMed] [Google Scholar]
- Guo Y., Wu Y., Shinde S., Sy M.S., Aruffo A., Liu Y. Identification of a costimulatory molecule rapidly induced by CD40L as CD44H. J. Exp. Med. 1996;184:955–961. doi: 10.1084/jem.184.3.955. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bell M.V., Cowper A.E., Lefranc M.P., Bell J.I., Screaton G.R. Influence of intron length on alternative splicing of CD44. Mol. Cell. Biol. 1998;18:5930–5941. doi: 10.1128/mcb.18.10.5930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- König H., Ponta H., Herrlich P. Coupling of signal transduction to alternative pre-mRNA splicing by a composite splice regulator. EMBO (Eur. Mol. Biol. Organ.) J. 1998;17:2904–2913. doi: 10.1093/emboj/17.10.2904. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stauder R., Günthert U. CD44 isoformsimpact on lymphocyte activation and differentiation. The Immunologist. 1995;3:78–83. [Google Scholar]
- Wittig B., Schwärzler C., Föhr N., Günthert U., Zöller M. Curative treatment of an experimentally induced colitis by a CD44 variant v7-specific antibody. J. Immunol. 1998;161:1069–1073. [PubMed] [Google Scholar]
- Günthert U. Importance of CD44 variant isoforms in mouse models for inflammatory bowel disease. Curr. Top. Microbiol. Immunol. 1999;246:307–312. doi: 10.1007/978-3-642-60162-0_38. [DOI] [PubMed] [Google Scholar]
- Wittig B., Seiter S., Schmidt D.S., Zuber M., Neurath M., Zöller M. Selective upregulation of CD44 variant isoforms on peripheral blood leukocytes of patients with chronic inflammatory bowel disease. Lab. Investig. 1999;79:747–759. [PubMed] [Google Scholar]
- Sauer B. Manipulation of transgenes by site-specific recombinationuse of Cre recombinase. Methods Enzymol. 1993;225:890–900. doi: 10.1016/0076-6879(93)25056-8. [DOI] [PubMed] [Google Scholar]
- Kühn R., Löhler J., Rennick D., Rajewski K., Müller W. Interleukin-10-deficient mice develop chronic enterocolitis. Cell. 1993;75:263–274. doi: 10.1016/0092-8674(93)80068-p. [DOI] [PubMed] [Google Scholar]
- Stauder R., Eisterer W., Thaler J., Günthert U. CD44 variant isoforms in non-Hodgkin's lymphomaa new independent prognostic factor. Blood. 1995;85:2885–2899. [PubMed] [Google Scholar]
- Arch R., Wirth K., Hofmann M., Ponta H., Matzku S., Herrlich P., Zöller M. Participation in normal immune responses of a metastasis-inducing splice variant CD44. Science. 1992;257:682–685. doi: 10.1126/science.1496383. [DOI] [PubMed] [Google Scholar]
- Lane P., Brocker T., Hubele S., Padovan E., Lanzavecchia A., McConnell F. Soluble CD40 ligand can replace the normal T cell–derived CD40 ligand signal to B cells in T cell–dependent activation. J. Exp. Med. 1993;177:1209–1213. doi: 10.1084/jem.177.4.1209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rennick D.M., Fort M.M., Davidson N.J. Studies with IL-10−/− micean overview. J. Leukoc. Biol. 1997;61:389–396. doi: 10.1002/jlb.61.4.389. [DOI] [PubMed] [Google Scholar]
- Davidson N.J., Leach M.W., Fort M.M., Thompson-Snipes L., Kühn R., Müller W., Berg D.J., Rennick D.M. T helper cell 1–type CD4+ T cells, but not B cells, mediate colitis in interleukin 10–deficient mice. J. Exp. Med. 1996;184:241–251. doi: 10.1084/jem.184.1.241. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Duchmann R., Schmitt E., Knolle P., Meyer zum Büschenfelde K.H., Neurath M. Tolerance towards resident intestinal flora in mice is abrogated in experimental colitis and restored by treatment with interleukin-10 or antibodies to interleukin-12. Eur. J. Immunol. 1996;26:934–938. doi: 10.1002/eji.1830260432. [DOI] [PubMed] [Google Scholar]
- Powrie F., Leach M.W., Mauze S., Menon S., Caddle L.B., Coffman R. Inhibition of Th1 responses prevents inflammatory bowel disease in scid mice reconstituted with CD45RBhi CD4+ T cells. Immunity. 1994;1:553–562. doi: 10.1016/1074-7613(94)90045-0. [DOI] [PubMed] [Google Scholar]
- van Deventer S.J., Elson C.O., Fedorak R.N. Multiple doses of intravenous interleukin 10 in steroid-refractory Crohn's disease. Crohn's disease study group. Gastroenterology. 1997;113:383–389. doi: 10.1053/gast.1997.v113.pm9247454. [DOI] [PubMed] [Google Scholar]
- Cella M., Scheidegger D., Palmer-Lehmann K., Lane P., Lanzavecchia A., Alber G. Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacityT–T help via APC activation. J. Exp. Med. 1996;184:747–752. doi: 10.1084/jem.184.2.747. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stüber E., Strober W., Neurath M. Blocking the CD40L–CD40 interaction in vivo specifically prevents the priming of T helper 1 cells through the inhibition of interleukin 12 secretion. J. Exp. Med. 1996;183:693–698. doi: 10.1084/jem.183.2.693. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Björck P., Banchereau J., Flores-Romo L. CD40 ligation counteracts Fas-induced apoptosis of human dendritic cells. Int. Immunol. 1997;9:365–372. doi: 10.1093/intimm/9.3.365. [DOI] [PubMed] [Google Scholar]
- Koppi T.A., Tough-Bement T., Lewinsohn D.M., Lynch D.H., Alderson M.R. CD40 ligand inhibits Fas/CD95-mediated apoptosis of human blood-derived dendritic cells. Eur. J. Immunol. 1997;27:3161–3165. doi: 10.1002/eji.1830271212. [DOI] [PubMed] [Google Scholar]
- Maxwell J.R., Campbell J.D., Kim C.H., Vella A.T. CD40 activation boosts T cell immunity in vivo by enhancing T cell clonal expansion and delaying peripheral T cell deletion. J. Immunol. 1999;162:2024–2034. [PubMed] [Google Scholar]
- Van Parijs L., Abbas A.K. Homeostasis and self-tolerance in the immune systemturning lymphocytes off. Science. 1998;280:243–248. doi: 10.1126/science.280.5361.243. [DOI] [PubMed] [Google Scholar]
- Neurath M.F., Fuss I., Kelsall B.L., Stüber E., Strober W. Antibodies to interleukin 12 abrogate established experimental colitis in mice. J. Exp. Med. 1995;182:1281–1290. doi: 10.1084/jem.182.5.1281. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Davidson N.J., Hudak S.A., Lesley R.E., Menon S., Leach M.W., Rennick D.M. IL-12, but not IFN-gamma, plays a major role in sustaining the chronic phase of colitis in IL-10-deficient mice. J. Immunol. 1998;161:3143–3149. [PubMed] [Google Scholar]
- Monteleone G., Biancone L., Marasco R., Morrone G., Marasco O., Luzza F., Pallone F. Interleukin 12 is expressed and actively released by Crohn's disease intestinal lamina propria mononuclear cells. Gastroenterology. 1997;112:1169–1178. doi: 10.1016/s0016-5085(97)70128-8. [DOI] [PubMed] [Google Scholar]
- Gately M.K., Renzetti L.M., Magram J., Stern A.S., Adorini L., Gubler U., Presky D.H. The interleukin-12/interleukin-12-receptor systemrole in normal and pathologic immune responses. Annu. Rev. Immunol. 1998;16:495–521. doi: 10.1146/annurev.immunol.16.1.495. [DOI] [PubMed] [Google Scholar]
- Ayroldi E., Cannarile L., Ricardi C. Modulation of superantigen-induced T-cell deletion by antibody anti-Pgp-1 (CD44) Immunology. 1996;87:191–197. doi: 10.1046/j.1365-2567.1996.466540.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ayroldi E., Cannarile L., Migliorati G., Bartoli A., Nicoletti I., Riccardi C. CD44 (Pgp-1) inhibits CD3 and dexamethasone-induced apoptosis. Blood. 1995;86:2672–2678. [PubMed] [Google Scholar]
- Günthert A.R., Sträter J., von Reyher U., Henne C., Joos S., Koretz K., Moldenhauer G., Krammer P.H., Möller P. Early detachment of colon carcinoma cells during CD95 (APO-1/Fas)-mediated apoptosis. I. De-adhesion from hyaluronate by shedding of CD44. J. Cell Biol. 1996;134:1089–1096. doi: 10.1083/jcb.134.4.1089. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Henke C., Bitterman P., Roongta U., Ingbar D., Polunovsky V. Induction of fibroblast apoptosis by anti-CD44 antibodyimplications for the treatment of fibroproliferative lung disease. Am. J. Pathol. 1996;149:1639–1650. [PMC free article] [PubMed] [Google Scholar]
- Yu Q., Toole B.P., Stamenkovic I. Induction of apoptosis of metastatic mammary carcinoma cells in vivo by disruption of tumor cell surface CD44 function. J. Exp. Med. 1997;186:1985–1996. doi: 10.1084/jem.186.12.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gao Y., Herndon J.M., Zhang H., Griffith T.S., Ferguson T.A. Anti-inflammatory effects of CD95 ligand (FasL)-induced apoptosis. J. Exp. Med. 1998;188:887–896. doi: 10.1084/jem.188.5.887. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brocke S., Piercy C., Steinman L., Weissman I.L., Veromaa T. Antibodies to CD44 and integrin alpha4, but not L-selectin, prevent central nervous system inflammation and experimental encephalomyelitis by blocking secondary leukocyte recruitment. Proc. Natl. Acad. Sci. USA. 1999;96:6896–6901. doi: 10.1073/pnas.96.12.6896. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Camp R.L., Scheynius A., Johansson C., Pure E. CD44 is necessary for optimal contact allergic responses but is not required for normal leukocyte extravasation. J. Exp. Med. 1993;178:497–507. doi: 10.1084/jem.178.2.497. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Estess P., DeGrendele C., Pascual V., Siegelman M.H. Functional activation of lymphocyte CD44 in peripheral blood is a marker of autoimmune disease activity. J. Clin. Invest. 1998;102:1173–1182. doi: 10.1172/JCI4235. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mikecz K., Brennan F.R., Kim J.H., Glant T.T. Anti-CD44 treatment abrogates tissue oedema and leukocyte infiltration in murine arthritis. Nat. Med. 1995;1:558–563. doi: 10.1038/nm0695-558. [DOI] [PubMed] [Google Scholar]
- Milde K.F., Alonso M., Kong S.S., Alejandro R., Mintz D.H., Pastori R.L. Expression of a specific subset of CD44 variant transcripts in NOD pancreatic islets. Diabetes. 1996;45:718–724. doi: 10.2337/diab.45.6.718. [DOI] [PubMed] [Google Scholar]
- Laman J.D., Maassen C.B., Schellekens M.M., Visser L., Kap M., de Jong E., van Puijenbroek M., van Stipdonk M.J., van Meurs M., Schwärzler C., Günthert U. Therapy with antibodies against CD40L (CD154) and CD44-variant isoforms reduces experimental autoimmune encephalomyelitis induced by a proteolipid protein peptide. Mult. Scler. 1998;4:147–153. doi: 10.1177/135245859800400312. [DOI] [PubMed] [Google Scholar]
- Mackay C.R., Terpe H.J., Stauder R., Marston W.L., Stark H., Günthert U. Expression and modulation of CD44 variant isoforms in humans. J. Cell Biol. 1994;124:71–82. doi: 10.1083/jcb.124.1.71. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou T., Song L., Yang P., Wang Z., Lui D., Jope R.S. Bisindolylmaleimide VIII facilitates Fas-mediated apoptosis and inhibits T cell-mediated autoimmune diseases. Nat. Med. 1999;5:42–48. doi: 10.1038/4723. [DOI] [PubMed] [Google Scholar]