Skip to main content
The Journal of Experimental Medicine logoLink to The Journal of Experimental Medicine
. 2002 Apr 15;195(8):991–1001. doi: 10.1084/jem.20010809

Predominant Role of T Cell Receptor (TCR)-α Chain in Forming Preimmune TCR Repertoire Revealed by Clonal TCR Reconstitution System

Tadashi Yokosuka 1,2, Kan Takase 1, Misao Suzuki 4, Yohko Nakagawa 5, Shinsuke Taki 1, Hidemi Takahashi 5, Takehiko Fujisawa 2, Hisashi Arase 1, Takashi Saito 1,3
PMCID: PMC2193687  PMID: 11956290

Abstract

The CDR3 regions of T cell receptor (TCR)-α and -β chains play central roles in the recognition of antigen (Ag)-MHC complex. TCR repertoire is created on the basis of Ag recognition specificity by CDR3s. To analyze the potential spectrum of TCR-α and -β to exhibit Ag specificity and generate TCR repertoire, we established hundreds of TCR transfectants bearing a single TCR-α or -β chain derived from a cytotoxic T cell (CTL) clone, RT-1, specific for HIVgp160 peptide, and randomly picked up TCR-β or -α chains. Surprisingly, one-third of such TCR-β containing random CDR3β from naive T cells of normal mice could reconstitute the antigen-reactive TCR coupling with RT-1 TCR-α. A similar dominant function of TCR-α in forming Ag-specific TCR, though low-frequency, was obtained for lymphocytic choriomeningitis virus–specific TCR. Subsequently, we generated TCR-α and/or -β transgenic (Tg) mice specific for HIVgp160 peptide, and analyzed the TCR repertoire of Ag-specific CTLs. Similar to the results from TCR reconstitution, TCR-α Tg generated CTLs with heterogeneous TCR-β, whereas TCR-β Tg-induced CTLs bearing a single TCR-α. These findings of Ag recognition with minimum involvement of CDR3β expand our understanding regarding the flexibility of the spectrum of TCR and suggest a predominant role of TCR-α chain in determining the preimmune repertoire of Ag-specific TCR.

Keywords: antigen recognition, CDR3, CTL, HIV gp160, selection

Introduction

Recognition of Ag peptide assembled within the MHC groove by TCR initiates and maintains Ag-specific immune responses. TCR is composed of TCR-α and -β chains, which are both generated by somatic rearrangements of germline-encoded V, D, and J gene segments (1). TCR-α and -β chains both contain three complementarity-determining regions (CDRs), which exhibit extreme variability and are responsible for specificity. While CDR1 and 2 are encoded by germline V gene segments, CDR3 is somatically created by rearrangement of V, (D), and J segments and provides major contributions to TCR diversity (13). It has been theorized that the diversity of TCR-αβ can reach 1015 by random rearrangement and nucleotide addition (1), and that a single peptide/MHC complex positively selects at least 105 different Vβ rearrangements (4). Recent estimations of the functional repertoire of peripheral T cells by extensive sequencing of CDR3 regions have suggested that actual diversity is more limited than the theoretical assumption and that the size of the Vβ repertoire is 5–10 × 105 and the total clone size will be as small as 2 × 106 (57).

The diversity of TCR-α is shaped by numerous Vα and Jα genes and one N region, while the TCR-β chain is created by smaller numbers of Vβ and Jβ, two Cβ, but a greater contribution of two N regions. During T cell development, TCR-α rearrangement takes place in thymocytes which had undergone TCR-β rearrangement. This order of TCR rearrangement results in a significant difference between TCR-α and -β on the peripheral TCR repertoire at a single cell level. T cells bearing the same TCR-β and varied TCR-α chains could be generated because immature T cells expressing a TCR-β chain and a preT cell receptor exhibit proliferation before TCR-α rearrangement. On the contrary, a given TCR-α could not associate with multiple TCR-β chains under physiological condition. This may lead to the hypothesis that TCR-α exhibits a greater diversity than TCR-β chains and plays more important roles in the recognition of foreign antigen. In addition, a considerable percentage of T cells expresses two rearranged TCR-α chains (8), probably as a result of thymic selection of TCR, which may possibly occur through receptor editing (9, 10). Recently, several different class I–restricted TCRs and one class II–restricted TCR have been crystallized in complex with corresponding peptide/MHC (1116). In most cases, it was shown that TCR-α has more contacts with peptide than TCR-β, pointing to the possibility that peptide recognition predominantly depends on TCR-α.

In addition to these structural analyses, analysis of single TCR-transgenic (Tg)* mice has provided additional insight into the functional aspects of the structure of Ag recognition and TCR repertoire (17). Brandle et al. analyzed the TCR repertoire of lymphocytic choriomeningitis virus (LCMV)-specific CTLs upon virus infection in TCR-α or TCR-β Tg mice and found that CTLs used highly restricted VJα and more diverse VDJβ junctional regions (18). Furthermore, several experiments have analyzed the responses to altered peptide ligands in these Tg mice (3, 1921) and demonstrated that every mutation in Ag peptide resulted in a change in the CDR3 sequences of TCR-α and -β chains, which supported the model in which CDR3 loops are laid directly upon the peptide bound to the MHC groove.

Nevertheless, these analyses using Tg mice have suffered from obvious limitations in determining the potential repertoire of TCR-αβ pairs, because TCRs with strong (autoreactive) affinity, or without, to self-MHC were excluded through thymic selection. In addition, since TCR-α expression is not allelically excluded, unlike TCR-β and T cells express two TCR-α chains, simple sequencing of TCR-α cDNA cannot determine which combination of a TCR-αβ dimer exhibits Ag specificity.

To overcome such limitations and analyze the preselection repertoire, we developed a novel transfection system that determines the precise mechanism of Ag recognition and allows analysis of the functional TCR repertoire at the clonal level. This system enabled us to systematically analyze hundreds of individual TCR-αβ pairs for Ag-specific recognitions without the influence of thymic selection. In this study, we analyzed the repertoire of endogenous TCR associated with transgenic TCR chain in HIVgp160-specific CTLs in vitro using our transfection system as well as in vivo by creating single TCR-Tg mice. We found that in order to recognize the HIVgp160 peptide/H-2Dd complex, CTLs have to possess a single TCR-α chain but can use a variety of TCR-β chains. Our results with two Ag systems suggest that recognition of foreign antigens is predominantly dependent on TCR-α chain and that the diversity of TCR develops in accordance with the heterogeneity of TCR-α, which would preclude the problems of autoimmunity and unwanted deletion of useful T cell clones.

Materials and Methods

Mice, Cells, Peptides, and Reagents.

BALB/c and C57BL/6 mice were purchased from Shizuoka Laboratory Animal Corporation (Hamamatsu, Japan). RT1 is an HIV gp160 env P18IIIB-specific CTL clone as described previously (22). TG40 is a variant T cell hybridoma cell line lacking the expression of TCR-α and -β chains that has been used as recipient cells for TCR transfection (23). The sequences of Ag peptides are as follows: P18IIIB (315–329:RIQRGPGRAFVTIGK); P18MN (315–329:RIHIGPGRAFYTTKN); and LCMV p33 (KAVYNFATM).

Subcloning of TCR.

CD8+ T cells or CD69+ CD8+ blast T cells were purified by FACStar™ sorting with a purity >98%, and total cellular RNA from these cells was extracted as described previously (24). cDNA was synthesized with random hexamer primers and Superscript II cDNA synthesis kit (GIBCO BRL).

The primers used for cloning of Vα42H11+ TCR-α chain were: Vα42H11: ATGCTGATTCTAAGCCTGTT; and Cα: TCAACTGGACCACAGCCT. The primers used for CDR3β cloning were: common Vβ8 family: GGGCTGAGGCTGATCCATTA; and Cβ: CCAAGCACACGAGGGTAG. The primers for the full-length TCR-β cloning were: Vβ8.1: ATGGGCTCCAGACTCTTC; Vβ8.3: ATGGGCTCCAGGCTCTTTCT; and Cβ: TCAGGAATTTTTTTTCTTGACCAT. These primers contained EcoRI and NotI sites at 5′ ends to subclone into pMX-IRES-GFP (provided by Toshio Kitamura, Tokyo University, Tokyo, Japan.). Each cloned plasmid DNA was purified by Wizzard Plus SV DNA Purification System (Promega) and sequenced using BigDye Terminator Cycle Sequencing Ready Reagent (PE Biosystems) with an ABI 377 DNA sequencer.

Retrovirus-mediated Gene Transfer.

A recipient T cell line for expression of a variety of TCR-αβ dimers was prepared by electroporation of the expressible constructs of CD8α and CD8β in the pBCMGneo (provided by H. Nakauchi, Tsukuba University, Tsukuba, Japan) into TG40 cells by GenePulser (Bio-Rad Laboratories). Various TCR-β chains in pMX-IRES-GFP vector, were transfected into a retroviral packaging cell line, Phoenix (from G. Nolan, Stanford University, Stanford, CA), with LipofectAMIN Plus Reagent (GIBCO BRL). The culture supernatant of Phoenix after 24 h culture was collected, centrifuged at 8,000 g for 16 h to concentrate the virus, and added to CD8αβ–expressing TG40 cells together with DOTAP Liposomal Transfection Reagent (Boehringer Mannheim). Transfection was monitored by the intensity of GFP and the cell surface expression of TCR by FACS® analysis. Transfection of a variety of TCR-β chains into CD8+ TCR-α+ TG40 cells resulted in 25–40% of surface TCR+ cells.

IL-2 Production Assay.

To analyze the IL-2 secretion from various TCR-transfected TG40 cells, 2 × 104 TG40 transfectants were cultured with 106 of irradiated BALB/c splenocytes in 200 μl of complete RPMI 1640 medium in the presence of 4 μM of various peptides in a 96-well flat-bottomed plate for 24 h. As a positive control for stimulation through the TCR complex, cells were plated in 200 μl of complete RPMI 1640 medium in a 96-well flat-bottomed plate precoated with 1 μg/ml anti–TCR-β mAb, H57 (provided by R. Kubo, La Jolla Institute of Allergy and Immunology, San Diego, CA). The titer of IL-2 in the culture supernatant was determined by ELISA.

Establishment of Transgenic Mice.

The transgenic TCR-α and -β genes were isolated from RT1. The TCR-α and -β genes responsible for the recognition of P18/Dd were first analyzed by PCR using specific primers for Vα and Vβ, and Cα and Cβ, respectively. The DNA sequences of the PCR products revealed that RT1-TCR-α was composed of Vα42H11 and Jα25 and the TCR-β chain of Vβ8.1, Jβ2.1, and Cβ2. A full-length TCR-α was generated by inserting the junctional sequence into a TCR-α cDNA clone containing Vα42H11 (a gift from B. Huber, Tufts University, MA) at the site of SmaI and EcoRV. A full-length TCR-β chain was similarly constructed by recombinant PCR using pP142β8AR (TCR-β from a LCMV-specific CTL clone, P14, which was provided by H. Pircher, Freiburg University, Germany) as a template. The full-length cDNAs of RT1-TCR-αβ genes were subcloned into the SalI and BamHI sites of the expression vector pHSE3′ under control of the H-2Kb promoter (provided by H. Pircher). The inserts of these expression constructs for each TCR-α and -β were injected into C57BL/6 oocytes, and two lines of Tg mice were generated. Tg lines with higher expression of TCR-α and -β were extensively analyzed. Tg mice were backcrossed with BALB/c mice for six generations for the experiments. Details of the establishment and characteristic of Tg mice will be described elsewhere (unpublished data).

Ag-specific Cytotoxicity Assay.

Cytolytic activity of CTLs was measured by standard 51Cr release assay (25). Briefly, 5 × 106 freshly isolated splenocytes from RT1-TCR-Tg were stimulated in vitro with 2 × 105 of the gp160-transfected NIH 3T3 cells in 2 ml of complete RPMI 1640 medium containing 10% ConA supernatant. After 5-d culture, effector cells were mixed with peptide-pulsed NIH 3T3 target cells for 5 h and the 51Cr counts in the culture supernatant were measured. The percentage of specific cytotoxicity was calculated as 100 × (experimental release − spontaneous release)/maximum release − spontaneous release).

Proliferation Assay.

CD8+ T cells (>98%) were purified from splenocytes of RT1-TCR-Tg or non-Tg mice by cell sorting with FACStar™ plus (Becton Dickinson). 5 × 104 CD8+ T cells were cultured with 106 irradiated BALB/c splenocytes in 200 μl of complete RPMI medium with 4 μM Ag peptide. Culture plates were pulsed with 2 μCi/well of 3[H]-thymidine for 8 h on day 3, and the incorporated radioactivity was measured by Microbeta scintillation counter (Amersham Pharmacia Biotech).

Flow Cytometric Analysis.

Cell surface expression of Vβ8+ TCR-β chain was analyzed by staining with three different anti-Vβ8 mAbs: F23.1 and F23.2 (provided by P. Marrack, National Jewish Center, Denver, CO) for Vβ8.1+Vβ8.2+Vβ8.3 and for Vβ8.2, KJ16 (Caltag) for Vβ8.11Vβ8.2, together with anti-CD8α mAb (53–6.7) (BD PharMingen). 106 cells were incubated with Ab for 40 min, followed with biotin anti–mouse IgG Ab (BD PharMingen) for 40 min. After blocking with mouse serum, cells were incubated with anti-CD8α–FITC and streptoavidin–PE (BD PharMingen) for 30 min. Stained cells were analyzed by flow cytometry with FACScalibur™ (Becton Dickinson).

Results

Clonal Analysis of Ag Recognition by Reconstituting Various TCR-αβ Pairs.

To estimate the functional TCR repertoire to a given peptide–MHC complex at the clonal level, we developed a novel transfection system using retroviral infection. In this system, a single TCR chain (α or β) is transfected into a TCR-deficient cell line with a variety of the other TCR chains (β or α), and the specificity of a given TCR-αβ pairs is analyzed. We focused on the Ag-recognizing repertoire by the TCR-α and -β chains derived from an HIV gp160-specific, H-2Dd–restricted cytotoxic T cell clone, RT1 (22). This clone recognizes the HIV env peptide P18IIIB. We first determined the usage of TCR-α and -β chains of this clone by RT-PCR and 5′ RACE (data not shown). RT1-TCR-α chain was found to be composed of Vα42H11 and Jα25 and RT1-TCR-β chain of Vβ8.1, Jβ2.1, and Cβ2. We designed a system to analyze the specificity of TCR-αβ by creating a series of TCR-αβ dimers either by reconstituting a TCR-αβ dimer with the RT1-TCR-α chain and a variety of TCR-β chains or with the RT1-TCR-β chain and various TCR-α chains.

First, in order to analyze Ag-recognition by TCR dimers composed of the fixed RT1-TCR-β chain with various TCR-α chains, ∼30 TCR-α chains bearing Vα42H11 were isolated from unimmunized normal mice. These TCR-α chains contained random J and N region sequences (data not shown). Each Vα42H11+TCR-α chain was subcloned into a retrovirus vector and then transfected by retrovirus-mediated gene transfer into a TCR-αβ–deficient recipient T cell hybridoma cell line, TG40 (23), in which RT1-TCR-β and CD8αβ had been transfected and expressed. Expression of each transfected TCR-α chain was monitored by the cell surface expression of the TCR–CD3 complex. Approximately 30–60% of the transfectants expressed the cell surface TCR complex, and the expression levels of the TCR complex were almost the same among these transfectants. A representative profile of such transfection is shown in Fig. 1 . Functional specificity of the reconstituted TCR was assessed by measuring IL-2 production upon stimulation with specific Ag peptide, P18IIIB plus APC (Dd), or anti-TCR-β mAb cross-linking as the control. As postulated, all of the 29 different Vα42H11-bearing TCR-α chains with various junctional sequences isolated from unimmunized mice failed to reconstitute any TCR-αβ complex reactive to the P18IIIB/H-2Dd complex when coexpressed with RT1-TCR-β chain and CD8, while all clones produced a similar level of IL-2 upon anti-TCR-β Ab cross-linking (Fig. 1).

Figure 1.

Figure 1.

Transfectants expressing various TCR-α with RT1β failed to respond to P18IIIB. (A) A representative FACS® profile for the expression of TCR and GFP in transfectants expressing RT1β and a TCR-α chain. TG40, the TCR-αβ–deficient T cell hybridoma cell line (a), was transfected with RT1β chain, and GFP before TCR-α transfection (b). Vα42H11+ TCR-α chains were randomly isolated from naive CD8+ cells from wild-type BALB/c mice, and these TCR-α genes were transfected into TCR-β–expressing TG40 cells by retrovirus-mediated gene transfer. The expression of TCR was monitored by the intensity of CD3ɛ-PE and 30–60% of the transfectant expressed the cell surface TCR complex (c). (B) IL-2 production of TCR-αβ transfectants upon stimulation with Ag/MHC and anti-TCR-β Ab. The transfectants were stimulated with irradiated splenocytes and P18IIIB (right) or immobilized anti–TCR-β Ab, H57 (left) for 24 h. The concentration of secreted IL-2 was measured by ELISA and the data are presented as the percentages of RT1-TCR-αβ-transfectant (RT1β).

We next performed a similar but opposite clonal analysis with the RT1α chain and a variety of TCR-β chains derived from unimmunized naive T cells. More than 80 TCR-β chains expressing Vβ8.1 and either of Jβ2.1, Jβ2.2, or Jβ2.4 were randomly picked up. All of these TCR-β chains were transfected into TG40 cells expressing RT1α and CD8. These TCR-β chains were able to pair with the RT1-TCR-α chain and were expressed on the cell surface in a similar manner to that shown in Fig. 1 (data not shown). These transfectants expressing RT1α and various TCR-β were then tested for their reactivity to P18IIIB/H-2Dd for Ag-specific IL-2 production. To our surprise, an extremely high frequency of TCR-β chains (45% [13/29]) of Jβ2.1+, 54% [7/13] of Jβ2.2+, and 18% [6/33] of Jβ2.4+ TCR-β chains) could reconstitute TCRs with RT1-TCR-α as well as recognize P18IIIB/H-2Dd and secrete IL-2 (Fig. 2) . As a sum, one-third (25 of 75) of randomly picked-up TCR-β chains from nonTg naive T cells could generate P18/Dd-specific TCRs when reconstituting a TCR with the RT1-TCR-α chain at the clonal level. As shown in Fig. 3 , the analysis of amino acid sequences of the CDR3 regions of the TCR-β chains from these transfectants revealed no obvious difference either in the sequence or in the length of the CDR3β regions (26) between the Ag-reactive and nonreactive TCR-β chains. To examine the functional sensitivity of the reconstituted TCRs to Ag, Ag dose–responses were analyzed on several representative transfectants expressing three different Jβs, Jβ2.1, Jβ2.2, and Jβ2.4 (Fig. 4) . We found that the dose responses were clearly dependent on the structure of Jβ. While TCR reconstituted with Jβ2.2-containing TCR-β chains were more sensitive than RT1-TCR-αβ, Jβ2.1-positive TCR-β chains provided similar levels of response to RT1β-TCR-αβ. In contrast, TCRs with Jβ2.4-bearing β chains exhibited less sensitive dose–responses compared with RT1-TCR-αβ, though they were still within the physiological range (Fig. 4).

Figure 2.

Figure 2.

Ag-specific responses by transfectants expressing RT1-TCR-α and various TCR-β chains expressing random CDR3β. Vβ8+ TCR-β chains were randomly isolated from naive CD8+ cells from wild-type BALB/c mice. Their Vβ usage was Vβ8.1, the Jβ usage was Jβ2.1, 2.2, 2.4, and CDR3β sequences were random. These TCR-β genes were transfected into RT1-TCR–expressing TG40 cells by retrovirus-mediated gene transfer, and these transfectants were stimulated with irradiated splenocytes and P18IIIB (right) or immobilized anti–TCR-β Ab, H57 (left) for 24 h, as for Fig. 1. The concentration of IL-2 was measured by ELISA and the data are presented as the percentages of that of RT1-TCR-β-transfectant (RT1α).

Figure 3.

Figure 3.

Figure 3.

Amino acid sequences and the length of CDR3 of TCR-β chains. (A) Amino acid sequences of TCR-β chains used for transfection. (a) TCR-β chain capable of reconstituting the TCR complex to recognize P18IIIB/Dd with RT1-TCR-α. (b) TCR-β chain incapable of reconstituting the P18/Dd-reactive TCR complex. Amino acid sequences revealed no significant characteristics in either group. (B) Distribution of CDR3 length among the P18/Dd-reactive TCR-β (a) and nonreactive TCR-β (b).

Figure 4.

Figure 4.

Ag dose responses by representative transfectants expressing a TCR dimer of a randomly picked-up TCR-β and the RT1-TCR-α. Transfectants reconstituted with TCR-β chains bearing either Jβ2.1 (A), Jβ2.2 (B), or Jβ2.4 (C) together with RT1α were stimulated with graded doses of p18IIIB peptide for IL-2 secretion in a similar condition as described in the legend of Fig. 5.

These results revealed that, although a certain structural constraint was present in the reconstitution of TCR-αβ pairs reactive to Ag, a high frequency of irrelevant Vβ8+ TCR-β chains can form a functional TCR-αβ dimer with RT1-TCR-α chain so as to be able to respond to physiological concentrations of the HIVgp160 V3 loop peptide.

Requirement of Single TCR-α and Heterogeneous TCR-β for Ag Recognition in Single TCR Tg Mice.

To examine whether the observed high frequency of TCR-β to constitute Ag-recognizing TCR with the RT1-α chain reflects the in vivo preimmune repertoire of peripheral T cells, we established transgenic mice expressing either RT1-TCR-α or -β chain (αTg and βTg), respectively, using an expression vector containing H-2b promoter, pHSE3′ (27). Immune responses of CD8+ cells from these mice to P18IIIB/H-2Dd were then analyzed. The expression of transgenic TCR-α and -β chains was confirmed by RT-PCR and also by cell surface staining of TCR-β chain with anti-Vβ8 mAb and TCR-αβ dimer with clonotypic mAb on T cells from each kind of Tg mouse (data not shown).

Ag-specific immune responses of CD8+ T cells from each of the single TCR-α and TCR-β Tg mice as well as from TCR-αβ Tg mice were analyzed by measuring Ag-specific proliferation and cytotoxic function. CD8+ T cells from αβTg mice exhibited P18IIIB-specific proliferation (Fig. 5 A) as well as Ag-specific cytolytic activity against P18IIIB-pulsed NIH 3T3 target cells (Fig. 5 B, a). As expected from the results of in vitro TCR reconstitution experiments, primary CD8+ T cells isolated from unimmunized αTg mice showed strong proliferative responses to P18IIIB/H-2Dd, and the responses were more intensive than those from βTg mice (Fig. 5 A). In contrast, CD8+ T cells from βTg exhibited a significant, though weak, proliferative response to P18IIIB (Fig. 1 A). In accordance with the proliferation, CD8+ T cells from αTg mice exhibited P18IIIB-specific cytotoxicity as strongly as that of αβTg mice after 5-d culture with gp160-expressing cells (Fig. 5 B, b). Surprisingly, CD8+ T cells from βTg mice showed significant cytotoxicity at approximately one-third of the magnitude of CTLs from αβTg mice (Fig. 5 B, c). Collectively, these results demonstrated that TCR Tg could develop Ag-reactive CD8+ T cells upon Ag stimulation and that the actual TCR repertoire reactive to the antigen was much larger in αTg mice than in βTg, indicating that the Ag recognition of P18IIIB appeared to be mediated mainly by the TCR-α chain.

Figure 5.

Figure 5.

Ag-specific cytotoxicity and proliferation of CD8+ T cells from RT1-TCR-α Tg and/or TCR-β Tg mice. (A) Ag-specific proliferation. Purified CD8+ spleen cells from RT1-TCR Tg or nonTg mice were cultured with irradiated spleen cells from BALB/c in the presence of 4 μM of P18IIIB (closed bar), P18MN (hatched bar), or no peptide (open bar). Cultures were pulsed with 3[H]-thymidine (TdR) for 8 h on day 3 of the culture and incorporated radioactivity was measured. (B) Ag-specific cytotoxicity. Spleen cells from unprimed RT1-TCR-αβ Tg (a), TCR-α Tg (b), TCR-β Tg (c), and normal mice (d) were stimulated in vitro with HIV IIIB gp160-transfected NIH 3T3 cells. After 5 d, the cytotoxic function of induced CTLs was assessed on NIH 3T3 target cells pulsed with P18IIIB (closed circles), P18MN (open circles), or no peptide (closed triangles) in a standard 51Cr-release assay.

We then analyzed the clonal basis of Ag-specific recognition by single TCR Tg mice by determining their TCR repertoire of specific CTLs. First, we analyzed TCR-β chain usage of Ag-specific CTLs generated from αTg mice. In the FACS® analysis of Vβ repertoires, ∼30% of unstimulated CD8+ T cells from αTg mice expressed Vβ8, similar to normal mice, but the total of Vβ8+ CD8+ T cells in αTg mice was 92% after Ag stimulation, with an especially high expression of Vβ8.1 (71%) (Fig. 6 A and B). Contrary to the strong skewing in the Vβ repertoire, the junctional sequences of Vβ8+ TCR-β chains from Ag-stimulated CD8+ T cells from αTg mice revealed no predominant usage of any single Jβ gene segment and no differences in the lengths and amino acid sequences of CDR3β residues (Fig. 6 C). We next compared the junctional diversity of the Vα42H11+ TCR-α chains of Ag-stimulated CD8+ T cells from βTg mice with naive βTg mice. In sharp contrast, we found that only a single Jα gene segment, Jα25, which is the same as the original RT1 clone, and almost the same CDR3α sequences dominated in Vα42H11+ TCR-α chains from Ag-stimulated CD8+ T cells from βTg mice (Fig. 7 A). It is unlikely that the restriction in TCR-α usage was due to thymic selection during T cell development, since Jα and CDR3α residues were found to be variable in nonstimulated CD8+ cells from βTg mice (Fig. 7 B).

Figure 6.

Figure 6.

Restriction of Vβ usage but random CDR3β in Ag-responding CD8+ cells from RT1-TCR-α Tg mice. (A) Naive and Ag-stimulated CD8+ cells from RT1-TCR-α-Tg mice were stained with F23.1 (a and d), F23.2 (b and e), and KJ16 (c and f). The upper histograms (a–c) show the profiles of TCR-β Tg naive cells and the lower ones (d–f) show Ag-stimulated blast cells that were gated as blastocytes. (B) Calculated percentages of Vβ8.1+, Vβ8.2+, and Vβ8.3+ cells from the FACS® data in (A) for Ag-responding (blast cells) and nonresponding (nonblast) cells. (C) Vβ8 junctional sequences of Ag-stimulated CD8+ T cells from RT1-TCR-α Tg mice.

Figure 7.

Figure 7.

Dominant expression of a single TCR-α of Ag-stimulated CD8+ T cells from RT1-TCR-β Tg mice CD8+ cells derived from RT1-TCR-β Tg mice were stimulated or unstimulated with irradiated BALB/c whole spleen cells and antigen peptide for 3 d. RT-PCR analysis was performed with primers specific for Vα42H11 and Cα, and CDR3α sequences were compared. (A) CDR3α junctional amino acid sequences of Vα42H11-bearing TCR-α chains of Ag-stimulated CD8+ cells from RT1-TCR-β Tg mice. (B) CDR3α junctional amino acid sequences of Vα42H11-bearing TCR-α chains of naive CD8+ cells from RT1-TCR-β Tg mice.

These analyses of the TCR repertoire in single TCR Tg mice demonstrate that, similar to the in vitro TCR reconstitution data, a single TCR-α chain and heterogeneous TCR-β chains were used to recognize P18IIIB/Dd in vivo.

Another TCR Model for Ag Recognition by a Single TCR-α and a Variety of TCR-β Chains.

This unexpectedly high frequency of CDR3β sequences giving rise to a functional TCR-αβ pair with a single TCR-α chain was not peculiar to the RT1-TCR and P18IIIB/H-2Dd system. To generalize from this observation, we used the same approach to the well-established P14-TCR, which exhibits LCMV-specific, H-2Db-restricted Ag recognition. Brandle et al. reported that P14-TCRα-Tg mice, in contrast to P14-TCRβ-Tg mice, were capable of responding to the LCMV glycoprotein peptide (GP33) in vitro, suggesting that the TCR-α chain plays a dominant role in GP33/H-2Db recognition (28). We reconstituted the TCR-αβ dimer by transfection of the P14-TCR-α chain and a variety of Vβ8+ TCR-β chains isolated from naive T cells of non-Tg mice and measured the reactivity to the LCMV epitope GP33/H-2Db. The results revealed that three out of 73 clones (4%) showed Ag-specific IL-2 production when expressed with the P14-TCR-α chain (Fig. 8 A). These three TCRβ chains did not have any sequence similarity in the CDR3β regions (Fig. 8 B). There was no positive response to either GP33 or P18IIIB when any one of the three β chains was expressed with RT1-TCR-α chain (data not shown). The frequency of functionally reconstituted TCR-αβ dimers composed of P14-TCR-α and randomly cloned TCR-β was much lower than that in the case of RT1-TCR (Fig. 5). Nevertheless, since the frequency for a particular TCR chain to form an Ag-specific TCR dimer with a nonselected partner chain has been believed to be extremely low, the 4% level of randomly picked-up TCR-β chains was sufficient to illustrate high frequency.

Figure 8.

Figure 8.

Figure 8.

Ag-specific responses by transfectants expressing the P14-TCR-α chain and randomly selected Vβ8.1+ TCR-β chains from naive T cells. (A) TCR-β chains were randomly picked up from naive CD8+ cells of normal mice similarly to Fig. 5. These TCR-β chains used Vβ8.1-Jβ2.1, 2.2, 2.4, and random CDR3β segments. These TCR-β chains were transfected into P14-TCR-α–expressing TG40 cells and stimulated with APC and LCMV p33 peptide (right panel) or immobilized anti–TCR-β mAb H57 (left) for 24 h. The concentration of IL-2 was measured by ELISA and the data was presented as the percentages of that of P14-TCR-αβ transfectant (P14β). (B) The three TCR-β chains responding to p33/Db did not have any sequence similarity to P14-TCR-β (P14β).

Discussion

We developed a novel transfection system in order to determine the preimmune repertoire of Ag-specific TCR and the precise structure-function relationship of Ag recognition at the clonal level. In this system, a TCR-αβ–deficient cell line was first transfected with a particular TCR-α, followed by further transfection with a variety of randomly cloned TCR-β chains, and each transfectant expressing a pair of TCR-αβ dimers was assessed for its ability to recognize Ag peptide-triggered IL-2 production. Using this system, we were able to analyze hundreds of individual TCR-αβ dimers for the specificity of Ag recognition. In general, the TCR repertoire has until now been analyzed by determining sequences of TCR after establishing T cell clones and isolation of cDNA. However, the finding that many T cells express two allelically unexcluded functional TCR-α chains (8) made it difficult to determine the TCR-αβ dimer responsible for the Ag recognition by simple sequencing. Our system is able to analyze the specificity of the individual pair of TCR-αβ chains systematically, and further, it can analyze the repertoire without the influence of thymic selection.

When expressing various TCR-β chains together with the RT1-TCR-α chain, one-third of the randomly picked-up Vβ8+ TCR-β chains containing random CDR3β from naive T cells of nonTg mice could generate the specific TCR-αβ dimers that recognize the P18IIIB/H-2Dd complex. The result that Ag-specific TCR can be reconstituted at such an extremely high frequency could not be expected except in the case of superantigen. Since the recognition is strongly restricted by Vβ8, Vβ may have contribution to the contact with MHC–peptide. Nevertheless, this result indicates that Ag recognition by RT1-TCR is not dependent on particular CDR3β. We applied a similar analysis to the LCMV-specific P14 Tg mouse, one of the widely used Tg mice.

It has been demonstrated that CTLs from P14-TCR-α Tg showed specific cytotoxic function, and T cells from P14-TCR-β Tg mice revealed a restricted repertoire of TCR-α chain (18, 28), suggesting that TCR-α plays a dominant role in Ag recognition. In our clonal TCR reconstitution analysis, transfection of various TCR-β chains containing random CDR3β together with the P14-TCR-α chain revealed that 4% of Vβ8+ TCR-β chains were able to generate functional TCR-αβ recognizing GP33/H-2Db. This percentage, though much smaller than that of RT1, still represents an extremely high frequency from the viewpoint of randomly rearranged TCRs. It was not at all expected that the combination of a particular TCR-α chain and randomly obtained TCR-β chains from naive mice that have not been selected with the TCR-α chain could generate an Ag-specific TCR-αβ dimer. Collectively, the predominant contribution of TCR-α chain may vary depending on the T cell clone. Ag recognition by RT1-TCR with a minimum involvement of CDR3β is probably an extreme case, and P14-TCR exhibits Ag recognition with a little less independence of CDR3β than RT1-TCR.

A number of analyses of the T cell repertoire have been based on the use of single TCR Tg mice. In some of them, TCR-α and -β appeared to contribute equally to Ag recognition (3, 29), whereas in other cases Ag recognition was profoundly dependent on TCR-α (1820, 30, 31). We also analyzed the in vivo functional TCR repertoire of HIV-P18-specific CTLs by generating single TCR Tg mice to compare the endogenous TCR repertoires. In our transgenic systems, CTLs generated from RT1-βTg mice upon stimulation with Ag peptide exhibited weak but still significant Ag-specific cytotoxicity. Sequence analysis revealed that these CTLs expressed a homogeneous TCR-α chain, Vα42H11-Jα25, as did the original RT1-TCR-α chain.

Since unstimulated T cells have completely heterogeneous TCR-α similar to naive T cells, only the T cells expressing the single RT1-TCR-α chain were selected and expanded. Indeed, we observed that a majority of CD8+ T cell blasts became clonotype-positive after Ag-specific stimulation (data not shown). In contrast, CTLs from αTg mice showed cytotoxicity as strong as αβTg mice in spite of the random usage of Jβ and CDR3β sequences. These results strongly suggest that RT1-TCR-α chain played a predominant role even in the in vivo recognition of P18IIIB/H-2Dd. Although the relative dependency on TCR-α chain in Ag recognition has been described in several systems (3, 19, 3134), this is the first example of a single TCR-α being used to generate functional Ag-specific CTLs with various TCR-β chains.

The observation in single TCR Tg analyses that RT1-TCR-α chain could generate functional Ag-reactive TCRs with various Vβ8+ TCR-β chains at a high frequency similar to the in vitro TCR reconstitution system indicates that the clonal size expressing RT1α chain in preimmune repertoire is very small and only RT1α+ T cells expand after Ag stimulation. This result may reflect the fact that the functional assembly of TCR-α chains with a defined TCR-β is more easily formed than that of TCR-β chains with a defined TCR-α in the physiological repertoire. These functional constraints of TCR assembly are created during selection of the TCR repertoires in the thymus.

Since TCR-α rearrangement takes place after TCR-β and the probability of generating identical Vα-Jα joints in a T cell expressing a rearranged TCR-β is thought to be virtually nil, the chance for a single TCR-α chain to pair with multiple TCR-β chains would be extremely small. In contrast, since extensive proliferation occurs after TCR-β rearrangement, each TCR-β would be expressed in numerous immature T cells and pair with multiple TCR-α chains. If a TCR-β chain had the capacity to exhibit Ag specificity with multiple TCR-α chains, Ag stimulation would activate a large number of T cell clones with a variety of avidities, including clones reactive to other Ags as well as possibly self-antigens. Moreover, negative selection in the thymus may delete otherwise useful TCR-αβ pairs, as they also react to self-antigens. However, as shown in this study, a TCR-β chain paired with distinct TCR-α chains creates individually well-defined Ag specificities. This system reflects the mechanism for ensuring self-tolerance and generating the diversity of the T cell repertoire.

In the in vivo peripheral repertoire, each TCR-α chain pairs in principle with a unique TCR-β chain because of the order of TCR rearrangement/selection, avoiding the problems of autoimmunity and unwanted deletion of useful T cell clones. The assembly of the same β chain with a distinct α chain may exhibit different Ag specificity. Therefore, analyzing a particular pair of TCR-αβ cannot provide the potential capability of TCR-α to assemble with other β. The issue of whether the possible assembly of α chain with other β creates TCR with the same Ag specificity during T cell selection has been kept unsolved. Our present analysis could demonstrate for the first time by changing TCR composed of various TCR-β and -α defined TCR-α that multiple TCR-β can create the same Ag specificity if the rearranged β has a chance to assemble with a single TCR-α during generation of the T cell repertoire.

Recent crystallographic analyses of the trimolecular complex, TCR-αβ and peptide–MHC revealed that CDR1, CDR2, and CDR3αβ regions generally contribute to the buried surface area in the interface, and subsequently a dominant role of the Vα domain in peptide recognition was acknowledged (1115). The distribution of the buried surface area by CDR3α has been shown to be greater than by CDR3β in 2C-TCR (12). In the case of D10-TCR, 23 of 27 atomic contacts with the peptide involve Vα and only 4 involve Vβ (14). In addition, these reports suggested that the pivot point and the orientation angle between TCR and peptide/MHC might regulate the contact sites of CDR3α to the peptide.

These results imply that TCR-α chain may present dominant contribution to Ag recognition, which is consistent with our results of extensive functional analysis of RT1- and P14-TCR. Although CDR3β residues can be random for P18IIIB/H-2Dd recognition, the Vβ usage is restricted to be Vβ8, suggesting that Vβ contributes to the contact with MHC and/or peptide. The actual structural basis of Ag recognition with random CDR3β will have to wait for the crystallographic analysis of the RT1-TCR-αβ/P18IIIB/H-2Dd trimolecular complex.

This study suggests the predominant role of TCR-α in the formation of the functional preimmune TCR repertoire. Numerous analyses of T cell clones and populations mostly by analyzing the junctional sequences of TCR have not been able to determine the functional contribution of TCR-α versus TCR-β in Ag recognition, as simple determination of each TCR sequence does not reveal functional TCR dimers. It has been postulated that CDR3α and CDR3β may equally contribute to most Ag recognition in general. Thus, the median of the dependency on CDR3α versus CDR3β for Ag recognition was postulated to be located in the middle of the distribution.

Our approach by functional and clonal TCR reconstitution unveiled the existence of TCR recognition with minimum involvement of CDR3β and predominant dependency on TCR-α. Together with structural data, it can now be postulated that Ag recognition is mediated predominantly by TCR-α and the contribution of TCR-α versus TCR-β on Ag recognition may be shifted toward TCR-α. A considerable proportion of T cells expresses two TCR-α chains after possible receptor editing during thymic selection (8). Although the physiological meaning of two TCR-α on a single T cell is not yet clear, one of the possibilities is a role in the shifting of the TCR contribution to Ag recognition toward TCR-α. Systematic analysis of functional repertoire as shown in the present study as well as structural determination of various TCR-αβ dimers may provide the whole profile of the Ag recognition structure by TCR-αβ.

Acknowledgments

We would like to thank Drs. Y. Kumagai and H. Maeda for the initial experimental help, Dr. H. Ohno, S. Yamosaki, and L. Tayton for discussion, Ms. M. Sakuma and R. Shiina for technical help, and Ms. H. Yamaguchi and Y. Kurihara for secretarial assistance.

This work was supported by a grant-in-aid for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan.

H. Arase's current address is Dept. of Microbiology and Immunology, University of California at San Francisco, San Francisco, CA 94143.

Footnotes

*

Abbreviations used in this paper: LCMV, lymphocytic choriomeningitis virus; Tg, transgenic.

References

  • 1.Davis, M.M., and P.J. Bjorkman. 1988. T-cell antigen receptor genes and T-cell recognition. Nature. 334:395–402. [DOI] [PubMed] [Google Scholar]
  • 2.Blackwell, T.K., and F.W. Alt. 1989. Molecular characterization of the lymphoid V(D)J recombination activity. J. Biol. Chem. 264:10327–10330. [PubMed] [Google Scholar]
  • 3.Jorgensen, J.L., U. Esser, B. Fazekas de St. Groth, P.A. Reay, and M.M. Davis. 1992. Mapping T-cell receptor-peptide contacts by variant peptide immunization of single-chain transgenics. Nature. 355:224–230. [DOI] [PubMed] [Google Scholar]
  • 4.Gapin, L., Y. Fukui, J. Kanellopoulos, T. Sano, A. Casrouge, V. Malier, E. Beaung, D. Gautheret, J.M. Claverie, T. Sasazuki, and P. Kourilsky. 1998. Quantitative analysis of the T cell repertoire selected by a single peptide-major histocompatibility complex. J. Exp. Med. 187:1871–1883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Casrouge, A., E. Beaung, S. Dalle, C. Pannetier, J. Kanellopoulos, and P. Kourilsky. 2000. Size estimate of the αβ TCR repertoire of naive mouse splenocytes. J. Immunol. 164:5782–5787. [DOI] [PubMed] [Google Scholar]
  • 6.Arstila, T.P., A. Casrouge, V. Baron, J. Even, J. Kanellopoulos, and P. Kourilsky. 1999. A direct estimate of the human αβ T cell receptor diversity. Science. 286:958–961. [DOI] [PubMed] [Google Scholar]
  • 7.Bousso, P., and P. Kourilsky. 1999. A clonal view of αβ T cell responses. Semin. Immunol. 11:423–431. [DOI] [PubMed] [Google Scholar]
  • 8.Padovan, E., G. Casorati, P. Dellabona, S. Meyer, M. Brockhaus, and A. Lanzavecchia. 1993. Expression of two T cell receptor α chains: dual receptor T cells. Science. 262:422–424. [DOI] [PubMed] [Google Scholar]
  • 9.Wang, F., C.Y. Huang, and O. Kanagawa. 1998. Rapid deletion of rearranged T cell antigen receptor (TCR) Vα-Jα segment by secondary rearrangement in the thymus: role of continuous rearrangement of TCR α chain gene and positive selection in the T cell repertoire formation. Proc. Natl. Acad. Sci. USA. 95:11834–11839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Polic, B., D. Kunkel, A. Scheffold, and K. Rajewsky. 2001. How αβ T cells deal with induced TCR α ablation. Proc. Natl. Acad. Sci. USA. 98:8744–8749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Garcia, K.C., M. Degano, R.L. Stanfield, A. Brunmark, M.R. Jackson, P.A. Peterson, L. Teyton, and I.A. Wilson. 1996. An αβ T cell receptor structure at 2.5 A and its orientation in the TCR-MHC complex. Science. 274:209–219. [DOI] [PubMed] [Google Scholar]
  • 12.Garcia, K.C., M. Degano, L.R. Pease, M. Huang, P.A. Peterson, L. Teyton, and I.A. Wilson. 1998. Structural basis of plasticity in T cell receptor recognition of a self peptide-MHC antigen. Science. 279:1166–1172. [DOI] [PubMed] [Google Scholar]
  • 13.Ding, Y.H., K.J. Smith, D.N. Garboczi, U. Utz, W.E. Biddison, and D.C. Wiley. 1998. Two human T cell receptors bind in a similar diagonal mode to the HLA- A2/Tax peptide complex using different TCR amino acids. Immunity. 8:403–411. [DOI] [PubMed] [Google Scholar]
  • 14.Reinherz, E.L., K. Tan, L. Tang, P. Kern, J. Liu, Y. Xiong, R.E. Hussey, A. Smolyar, B. Hare, R. Zhang, et al. 1999. The crystal structure of a T cell receptor in complex with peptide and MHC class II. Science. 286:1913–1921. [DOI] [PubMed] [Google Scholar]
  • 15.Ding, Y.H., B.M. Baker, D.N. Garboczi, W.E. Biddison, and D.C. Wiley. 1999. Four A6-TCR/peptide/HLA-A2 structures that generate very different T cell signals are nearly identical. Immunity. 11:45–56. [DOI] [PubMed] [Google Scholar]
  • 16.Hennecke, J., A. Carfi, and D.C. Wiley. 2000. Structure of a covalently stabilized complex of a human αβ T-cell receptor, influenza HA peptide and MHC class II molecule, HLA-DR1. EMBO J. 19:5611–5624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhang, W., S. Honda, F. Wang, T.P. DiLorenzo, A.M. Kargis, D.A. Ostrov, and S.G. Nathenson. 2001. Immunobiological analysis of TCR single-chain transgenic mice reveals new possibilities for interaction between cDR3α and an antigenic peptide bound to MHC class I. J. Immunol. 167:4396–4404. [DOI] [PubMed] [Google Scholar]
  • 18.Brandle, D., K. Burki, V.A. Wallace, U.H. Rohrer, T.W. Mak, B. Malissen, H. Hengartner, and H. Pircher. 1991. Involvement of both T cell receptor Vα and Vβ variable region domains and α chain junctional region in viral antigen recognition. Eur. J. Immunol. 21:2195–2202. [DOI] [PubMed] [Google Scholar]
  • 19.Hsu, B.L., D.L. Donermeyer, and P.M. Allen. 1996. TCR recognition of the Hb(64-76)/I-Ek determinant: single conservative amino acid changes in the complementarity-determining region 3 dramatically alter antigen fine specificity. J. Immunol. 157:2291–2298. [PubMed] [Google Scholar]
  • 20.Sant'Angelo, D.B., G. Waterbury, P. Preston-Hurlburt, S.T. Yoon, R. Medzhitov, S.C. Hong, and C.A. Janeway, Jr. 1996. The specificity and orientation of a TCR to its peptide-MHC class II ligands. Immunity. 4:367–376. [DOI] [PubMed] [Google Scholar]
  • 21.Wienhold, W., G. Malcherek, C. Jung, S. Stevanovic, G. Jung, H. Schild, and A. Melms. 2000. An example of immunodominance: engagement of synonymous TCR by invariant CDR3β. Int. Immunol. 12:747–756. [DOI] [PubMed] [Google Scholar]
  • 22.Takahashi, H., R. Houghten, S.D. Putney, D.H. Margulies, B. Moss, R.N. Germain, and J.A. Berzofsky. 1989. Structural requirements for class I MHC molecule-mediated antigen presentation and cytotoxic T cell recognition of an immunodominant determinant of the human immunodeficiency virus envelope protein. J. Exp. Med. 170:2023–2035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ohno, H., C. Ushiyama, M. Taniguchi, R.N. Germain, and T. Saito. 1991. CD2 can mediate TCR/CD3-independent T cell activation. J. Immunol. 146:3742–3746. [PubMed] [Google Scholar]
  • 24.Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156–159. [DOI] [PubMed] [Google Scholar]
  • 25.Takahashi, H., J. Cohen, A. Hosmalin, K.B. Cease, R. Houghten, J.L. Cornette, C. DeLisi, B. Moss, R.N. Germain, and J.A. Berzofsky. 1988. An immunodominant epitope of the human immunodeficiency virus envelope glycoprotein gp160 recognized by class I major histocompatibility complex molecule-restricted murine cytotoxic T lymphocytes. Proc. Natl. Acad. Sci. USA. 85:3105–3109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chothia, C., D.R. Boswell, and A.M. Lesk. 1988. The outline structure of the T-cell αβ receptor. EMBO J. 7:3745–3755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Pircher, H., T.W. Mak, R. Lang, W. Ballhausen, E. Ruedi, H. Hengartner, R.M. Zinkernagel, and K. Burki. 1989. T cell tolerance to Mlsa encoded antigens in T cell receptor Vβ 8.1 chain transgenic mice. EMBO J. 8:719–727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Brandle, D., K. Brduscha-Riem, A.C. Hayday, M.J. Owen, H. Hengartner, and H. Pircher. 1995. T cell development and repertoire of mice expressing a single T cell receptor α chain. Eur. J. Immunol. 25:2650–2655. [DOI] [PubMed] [Google Scholar]
  • 29.McHeyzer-Williams, M.G., and M.M. Davis. 1995. Antigen-specific development of primary and memory T cells in vivo. Science. 268:106–111. [DOI] [PubMed] [Google Scholar]
  • 30.Verdaguer, J., J.W. Yoon, B. Anderson, N. Averill, T. Utsugi, B.J. Park, and P. Santamaria. 1996. Acceleration of spontaneous diabetes in TCR-β-transgenic nonobese diabetic mice by β-cell cytotoxic CD8+ T cells expressing identical endogenous TCR-α chains. J. Immunol. 157:4726–4735. [PubMed] [Google Scholar]
  • 31.Burns, R.P., Jr., K. Natarajan, N.J. LoCascio, D.P. O'Brien, J.A. Kobori, N. Shastri, and R.K. Barth. 1998. Molecular analysis of skewed Tcra-V gene use in T-cell receptor β-chain transgenic mice. Immunogenetics. 47:107–114. [DOI] [PubMed] [Google Scholar]
  • 32.Dillon, S.R., S.C. Jameson, and P.J. Fink. 1994. Vβ5+ T cell receptors skew toward OVA+H-2Kb recognition. J. Immunol. 152:1790–1801. [PubMed] [Google Scholar]
  • 33.Sant'Angelo, D.B., P.G. Waterbury, B.E. Cohen, W.D. Martin, L. Van Kaer, A.C. Hayday, and C.A. Janeway, Jr. 1997. The imprint of intrathymic self-peptides on the mature T cell receptor repertoire. Immunity. 7:517–524. [DOI] [PubMed] [Google Scholar]
  • 34.Saito, T., and R.N. Germain. 1987. Predictable acquisition of a new MHC recognition specificity following expression of a transfected T-cell receptor β-chain gene. Nature. 329:256–259. [DOI] [PubMed] [Google Scholar]

Articles from The Journal of Experimental Medicine are provided here courtesy of The Rockefeller University Press

RESOURCES